Dietary Supplementation with Boswellia serrata, Verbascum thapsus, and Curcuma longa in Show Jumping Horses: Effects on Serum Proteome, Antioxidant Status, and Anti-Inflammatory Gene Expression
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Samples Collection
2.2. Cells Stimulation and RNA Extraction
2.3. Analysis of mRNA Levels by Real Time RT-PCR
2.4. Total Serum Antioxidant Capacity
2.5. Proteomic Analysis
2.6. Statistical Analysis
3. Results
3.1. Cellular Anti-Inflammatory and Antioxidant Activities
3.2. Cellular Antioxidant Activities
3.3. In Vitro Antioxidant Capacity of Serum
3.4. Serum Proteomic Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sjödin, B.; Westing, Y.H.; Apple, F.S. Biochemical Mechanisms for Oxygen Free Radical Formation During Exercise. Sports Med. 1990, 10, 236–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arfuso, F.; Rizzo, M.; Giannetto, C.; Giudice, E.; Cirincione, R.; Cassata, G.; Cicero, L.; Piccione, G. Oxidant and Antioxidant Parameters’ Assessment Together with Homocysteine and Muscle Enzymes in Racehorses: Evaluation of Positive Effects of Exercise. Antioxidants 2022, 11, 1176. [Google Scholar] [CrossRef] [Scilit]
- Williams, C.A. HORSE SPECIES SYMPOSIUM: The Effect of Oxidative Stress during Exercise in the Horse1. J. Anim. Sci. 2016, 94, 4067–4075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shono, S.; Gin, A.; Minowa, F.; Okubo, K.; Mochizuki, M. The Oxidative Stress Markers of Horses—The Comparison with Other Animals and the Influence of Exercise and Disease. Animals 2020, 10, 617. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiaradia, E.; Avellini, L.; Rueca, F.; Spaterna, A.; Porciello, F.; Antonioni, M.T.; Gaiti, A. Physical Exercise, Oxidative Stress and Muscle Damage in Racehorses. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 1998, 119, 833–836. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarkson, P.M.; Thompson, H.S. Antioxidants: What Role Do They Play in Physical Activity and Health? Am. J. Clin. Nutr. 2000, 72, 637S–646S. [Google Scholar] [CrossRef] [Scilit]
- Kinnunen, S.; Atalay, M.; Hyyppä, S.; Lehmuskero, A.; Hänninen, O.; Oksala, N. Effects of Prolonged Exercise on Oxidative Stress and Antioxidant Defense in Endurance Horse. J Sports Sci. Med 2005, 4, 415–421. [Google Scholar]
- Kinnunen, S.; Hyyppä, S.; Lappalainen, J.; Oksala, N.; Venojärvi, M.; Nakao, C.; Hänninen, O.; Sen, C.K.; Atalay, M. Exercise-Induced Oxidative Stress and Muscle Stress Protein Responses in Trotters. Eur. J. Appl. Physiol. 2005, 93, 496–501. [Google Scholar] [CrossRef] [Scilit]
- Urso, M.L.; Clarkson, P.M. Oxidative Stress, Exercise, and Antioxidant Supplementation. Toxicology 2003, 189, 41–54. [Google Scholar] [CrossRef] [Scilit]
- Clarkson, P.M.; Hubal, M.J. Exercise-Induced Muscle Damage in Humans. Am. J. Phys. Med. Rehabilitation 2002, 81, S52–S69. [Google Scholar] [CrossRef] [Scilit]
- Malm, C. Exercise-Induced Muscle Damage and Inflammation: Fact or Fiction?: Exercise Induced Muscle Inflammation. Acta Physiol. Scand. 2001, 171, 233–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Febbraio, M.A.; Pedersen, B.K. Muscle-derived Interleukin-6: Mechanisms for Activation and Possible Biological Roles. FASEB J. 2002, 16, 1335–1347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arent, S.M.; Senso, M.; Golem, D.L.; McKeever, K.H. The Effects of Theaflavin-Enriched Black Tea Extract on Muscle Soreness, Oxidative Stress, Inflammation, and Endocrine Responses to Acute Anaerobic Interval Training: A Randomized, Double-Blind, Crossover Study. J Int. Soc. Sports Nutr. 2010, 7, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive Oxygen Species in Inflammation and Tissue Injury. Antioxid. Redox Signal. 2014, 20, 1126–1167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Biswas, S.K. Does the Interdependence between Oxidative Stress and Inflammation Explain the Antioxidant Paradox? Oxid. Med. Cell. Longev. 2016, 2016, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Djuric, Z.; Kashif, M.; Fleming, T.; Muhammad, S.; Piel, D.; von Bauer, R.; Bea, F.; Herzig, S.; Zeier, M.; Pizzi, M.; et al. Targeting Activation of Specific NF-ΚB Subunits Prevents Stress-Dependent Atherothrombotic Gene Expression. Mol. Med. 2012, 18, 1375–1386. [Google Scholar] [CrossRef] [Scilit]
- Kirschvink, N.; Art, T.; Moffarts, B.; Smith, N.; Marlin, D.; Roberts, C.; Lekeux, P. Relationship between Markers of Blood Oxidant Status and Physiological Variables in Healthy and Heaves-Affected Horses after Exercise. Equine Vet. J. 2010, 34, 159–164. [Google Scholar] [CrossRef] [Scilit]
- El-Ashker, M.; El-Khodery, S.; Metwally, N.; Hussein, H.; El-Boshy, M. Prognostic Significance of Oxidative Stress Markers in Colitis Associated with Phenylbutazone Administration in Draft Horses. J. Equine Vet. Sci. 2012, 32, 146–152. [Google Scholar] [CrossRef] [Scilit]
- Molinari, L.; Basini, G.; Ramoni, R.; Bussolati, S.; Aldigeri, R.; Grolli, S.; Bertini, S.; Quintavalla, F. Evaluation of Oxidative Stress Parameters in Healthy Saddle Horses in Relation to Housing Conditions, Presence of Stereotypies, Age, Sex and Breed. Processes 2020, 8, 1670. [Google Scholar] [CrossRef] [Scilit]
- Smarsh, D.N.; Williams, C.A. Oxidative Stress and Antioxidant Status in Standardbreds: Effect of Age and Acute Exercise Before and After Training. J. Equine Vet. Sci. 2016, 47, 92–106. [Google Scholar] [CrossRef] [Scilit]
- Williams, C.A.; Kronfeld, D.S.; Hess, T.M.; Saker, K.E.; Waldron, J.N.; Crandell, K.M.; Hoffman, R.M.; Harris, P.A. Antioxidant Supplementation and Subsequent Oxidative Stress of Horses during an 80-Km Endurance Race1. J. Anim. Sci. 2004, 82, 588–594. [Google Scholar] [CrossRef] [PubMed]
- Marañón, G.; Muñoz-Escassi, B.; Manley, W.; García, C.; Cayado, P.; de la Muela, M.S.; Olábarri, B.; León, R.; Vara, E. The Effect of Methyl Sulphonyl Methane Supplementation on Biomarkers of Oxidative Stress in Sport Horses Following Jumping Exercise. Acta Vet. Scand. 2008, 50, 45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ememe, M.U.; Mshelia, W.P.; Ayo, J.O. Ameliorative Effects of Resveratrol on Oxidative Stress Biomarkers in Horses. J. Equine Vet. Sci. 2015, 35, 518–523. [Google Scholar] [CrossRef] [Scilit]
- Kienzle, E.; Freismuth, A.; Reusch, A. Double-Blind Placebo-Controlled Vitamin E or Selenium Supplementation of Sport Horses with Unspecified Muscle Problems. An Example of the Potential of Placebos. J. Nutr. 2006, 136, 2045S–2047S. [Google Scholar] [CrossRef] [Scilit]
- Nemec Svete, A.; Vovk, T.; Bohar Topolovec, M.; Kruljc, P. Effects of Vitamin E and Coenzyme Q10 Supplementation on Oxidative Stress Parameters in Untrained Leisure Horses Subjected to Acute Moderate Exercise. Antioxidants 2021, 10, 908. [Google Scholar] [CrossRef] [Scilit]
- White, A.; Estrada, M.; Walker, K.; Wisnia, P.; Filgueira, G.; Valdés, F.; Araneda, O.; Behn, C.; Martínez, R. Role of Exercise and Ascorbate on Plasma Antioxidant Capacity in Thoroughbred Race Horses. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2001, 128, 99–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yonezawa, L.A.; Machado, L.P.; Silveira, V.F.D.; Watanabe, M.J.; Saito, M.E.; Kitamura, S.S.; Kohayagawa, A. Malondialdeído e Troponina I Cardíaca Em Equinos Da Raça Puro Sangue Árabe Submetidos Ao Exercício e à Suplementação Com Vitamina E. Ciência Rural 2010, 40, 1321–1326. [Google Scholar] [CrossRef] [Scilit]
- Elghandour, M.M.M.Y.; Kanth Reddy, P.R.; Salem, A.Z.M.; Ranga Reddy, P.P.; Hyder, I.; Barbabosa-Pliego, A.; Yasaswini, D. Plant Bioactives and Extracts as Feed Additives in Horse Nutrition. J. Equine Vet. Sci. 2018, 69, 66–77. [Google Scholar] [CrossRef] [Scilit]
- Dockalova, H.; Baholet, D.; Batik, A.; Zeman, L.; Horky, P. Effect of Milk Thistle (Silybum Marianum) Seed Cakes by Horses Subjected to Physical Exertion. J. Equine Vet. Sci. 2022, 113, 103937. [Google Scholar] [CrossRef] [Scilit]
- Tsuda, T. Curcumin as a Functional Food-Derived Factor: Degradation Products, Metabolites, Bioactivity, and Future Perspectives. Food Funct. 2018, 9, 705–714. [Google Scholar] [CrossRef] [Scilit]
- Nelson, K.M.; Dahlin, J.L.; Bisson, J.; Graham, J.; Pauli, G.F.; Walters, M.A. The Essential Medicinal Chemistry of Curcumin: Miniperspective. J. Med. Chem. 2017, 60, 1620–1637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashrafizadeh, M.; Ahmadi, Z.; Mohammadinejad, R.; Farkhondeh, T.; Samarghandian, S. Curcumin Activates the Nrf2 Pathway and Induces Cellular Protection Against Oxidative Injury. Curr. Mol. Med. 2020, 20, 116–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menon, V.P.; Sudheer, A.R. Antioxidant and anti-inflammatory properties of curcumin. In The Molecular Targets and Therapeutic Uses of Curcumin in Health and Disease; Aggarwal, B.B., Surh, Y.-J., Shishodia, S., Eds.; Advances in Experimental Medicine and Biology; Springer: Boston, MA, USA, 2007; Volume 595, pp. 105–125. ISBN 978-0-387-46400-8. [Google Scholar]
- Andrews, F.M.; Riggs, L.M.; Lopez, M.J.; Keowen, M.L.; Garza, F.; Takawira, C.; Liu, C.-C.; Liu, Y.; Seeram, N.P.; Cairy, A.; et al. Effect of an Oral Supplement Containing Curcumin Extract (Longvida ® ) on Lameness Due to Osteoarthritis and Gastric Ulcer Scores. Equine Vet. Educ. 2022, eve.13616. [Google Scholar] [CrossRef] [Scilit]
- Wuest, S.; Atkinson, R.L.; Bland, S.D.; Hastings, D. A Pilot Study on the Effects of Curcumin on Parasites, Inflammation, and Opportunistic Bacteria in Riding Horses. J. Equine Vet. Sci. 2017, 57, 46–50. [Google Scholar] [CrossRef] [Scilit]
- Innes, J.F.; Fuller, C.J.; Grover, E.R.; Kelly, A.L.; Burn, J.F. Randomised, Double-Blind, Placebocontrolled Parallel Group Study of P54FP for the Treatment of Dogs with Osteoarthritis. Vet. Rec. 2003, 152, 457–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kulkarni, R.R.; Patki, P.S.; Jog, V.P.; Gandage, S.G.; Patwardhan, B. Treatment of Osteoarthritis with a Herbomineral Formulation: A Double-Blind, Placebo-Controlled, Cross-over Study. J. Ethnopharmacol. 1991, 33, 91–95. [Google Scholar] [CrossRef] [Scilit]
- Starzonek, J.; Roscher, K.; Blüher, M.; Blaue, D.; Schedlbauer, C.; Hirz, M.; Raila, J.; Vervuert, I. Effects of a Blend of Green Tea and Curcuma Extract Supplementation on Lipopolysaccharide-Induced Inflammation in Horses and Ponies. PeerJ 2019, 7, e8053. [Google Scholar] [CrossRef] [Scilit]
- Siddiqui, M.Z. Boswellia Serrata, a Potential Antiinflammatory Agent: An Overview. Indian J. Pharm. Sci 2011, 73, 255–261. [Google Scholar] [CrossRef] [Scilit]
- Hamm, S.; Bleton, J.; Connan, J.; Tchapla, A. A Chemical Investigation by Headspace SPME and GC–MS of Volatile and Semi-Volatile Terpenes in Various Olibanum Samples. Phytochemistry 2005, 66, 1499–1514. [Google Scholar] [CrossRef] [Scilit]
- Ammon, H.P.T. Salai Guggal—Boswellia Serrata: From a Herbal Medicine to a Specific Inhibitor of Leukotriene Biosynthesis. Phytomedicine 1996, 3, 67–70. [Google Scholar] [CrossRef] [Scilit]
- Al-Yasiry, A.R.M.; Kiczorowska, B. Frankincense–Therapeutic Properties. Postepy. Hig. Med. Dosw. 2016, 70, 380–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Umar, S.; Umar, K.; Sarwar, A.H.M.G.; Khan, A.; Ahmad, N.; Ahmad, S.; Katiyar, C.K.; Husain, S.A.; Khan, H.A. Boswellia Serrata Extract Attenuates Inflammatory Mediators and Oxidative Stress in Collagen Induced Arthritis. Phytomedicine 2014, 21, 847–856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Franceschi, F.; Togni, S.; Belcaro, G.; Dugall, M.; Luzzi, R.; Ledda, A.; Pellegrini, L.; Eggenhoffner, R.; Giacomelli, L. A Novel Lecithin Based Delivery Form of Boswellic Acids (Casperome®) for the Management of Osteo-Muscular Pain: A Registry Study in Young Rugby Players. Eur. Rev. Med. Pharmacol. Sci. 2016, 20, 4156–4161. [Google Scholar] [PubMed]
- Chilelli, N.; Ragazzi, E.; Valentini, R.; Cosma, C.; Ferraresso, S.; Lapolla, A.; Sartore, G. Curcumin and Boswellia Serrata Modulate the Glyco-Oxidative Status and Lipo-Oxidation in Master Athletes. Nutrients 2016, 8, 745. [Google Scholar] [CrossRef] [Scilit]
- Speranza, L.; Franceschelli, S.; Pesce, M.; Reale, M.; Menghini, L.; Vinciguerra, I.; De Lutiis, M.A.; Felaco, M.; Grilli, A. Antiinflammatory Effects in THP-1 Cells Treated with Verbascoside: ANTIINFLAMMATORY ACTION IN THP-1 CELLS OF VERBASCOSIDE. Phytotherapy Res. 2010, 24, 1398–1404. [Google Scholar] [CrossRef] [Scilit]
- Turker, A.U.; Camper, N.D. Biological Activity of Common Mullein, a Medicinal Plant. J.Ethnopharmacol. 2002, 82, 117–125. [Google Scholar] [CrossRef] [Scilit]
- Calabrese, G.; Zappalà, A.; Dolcimascolo, A.; Acquaviva, R.; Parenti, R.; Malfa, G.A. Phytochemical Analysis and Anti-Inflammatory and Anti-Osteoarthritic Bioactive Potential of Verbascum Thapsus L. (Scrophulariaceae) Leaf Extract Evaluated in Two In Vitro Models of Inflammation and Osteoarthritis. Molecules 2021, 26, 5392. [Google Scholar] [CrossRef] [Scilit]
- Lans, C.; Turner, N.; Brauer, G.; Lourenco, G.; Georges, K. Ethnoveterinary Medicines Used for Horses in Trinidad and in British Columbia, Canada. J Ethnobiol. Ethnomedicine 2006, 2, 31. [Google Scholar] [CrossRef] [Scilit]
- Carroll, C.L.; Huntington, P.J. Body Condition Scoring and Weight Estimation of Horses. Equine Vet. J. 1988, 20, 41–45. [Google Scholar] [CrossRef] [Scilit]
- Nkuimi Wandjou, J.G.; Lancioni, L.; Barbalace, M.C.; Hrelia, S.; Papa, F.; Sagratini, G.; Vittori, S.; Dall’Acqua, S.; Caprioli, G.; Beghelli, D.; et al. Comprehensive Characterization of Phytochemicals and Biological Activities of the Italian Ancient Apple ‘Mela Rosa Dei Monti Sibillini’. Food Res. Int. 2020, 137, 109422. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant Activity Applying an Improved ABTS Radical Cation Decolorization Assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bianchi, L.; Gagliardi, A.; Campanella, G.; Landi, C.; Capaldo, A.; Carleo, A.; Armini, A.; De Leo, V.; Piomboni, P.; Focarelli, R.; et al. A Methodological and Functional Proteomic Approach of Human Follicular Fluid En Route for Oocyte Quality Evaluation. J. Proteom. 2013, 90, 61–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beghelli, D.; Zallocco, L.; Barbalace, M.C.; Paglia, S.; Strocchi, S.; Cirilli, I.; Marzano, V.; Putignani, L.; Lupidi, G.; Hrelia, S.; et al. Pterostilbene Promotes Mean Lifespan in Both Male and Female Drosophila Melanogaster Modulating Different Proteins in the Two Sexes. Oxidative Med. Cell. Longev. 2022, 2022, 1–21. [Google Scholar] [CrossRef] [Scilit]
- Lacerenza, S.; Ciregia, F.; Giusti, L.; Bonotti, A.; Greco, V.; Giannaccini, G.; D’Antongiovanni, V.; Fallahi, P.; Pieroni, L.; Cristaudo, A.; et al. Putative Biomarkers for Malignant Pleural Mesothelioma Suggested by Proteomic Analysis of Cell Secretome. Cancer Genom. Proteom. 2020, 17, 225–236. [Google Scholar] [CrossRef] [Scilit]
- Ciregia, F.; Giusti, L.; Da Valle, Y.; Donadio, E.; Consensi, A.; Giacomelli, C.; Sernissi, F.; Scarpellini, P.; Maggi, F.; Lucacchini, A.; et al. A Multidisciplinary Approach to Study a Couple of Monozygotic Twins Discordant for the Chronic Fatigue Syndrome: A Focus on Potential Salivary Biomarkers. J. Transl. Med. 2013, 11, 243. [Google Scholar] [CrossRef] [Scilit]
- Barbalace, M.C.; Zallocco, L.; Beghelli, D.; Ronci, M.; Scortichini, S.; Digiacomo, M.; Macchia, M.; Mazzoni, M.R.; Fiorini, D.; Lucacchini, A.; et al. Antioxidant and Neuroprotective Activity of Extra Virgin Olive Oil Extracts Obtained from Quercetano Cultivar Trees Grown in Different Areas of the Tuscany Region (Italy). Antioxidants 2021, 10, 421. [Google Scholar] [CrossRef] [Scilit]
- Płóciennikowska, A.; Hromada-Judycka, A.; Borzęcka, K.; Kwiatkowska, K. Co-Operation of TLR4 and Raft Proteins in LPS-Induced pro-Inflammatory Signaling. Cell. Mol. Life Sci. 2015, 72, 557–581. [Google Scholar] [CrossRef] [Scilit]
- Liburt, N.R.; McKeever, K.H.; Streltsova, J.M.; Franke, W.C.; Gordon, M.E.; Manso Filho, H.C.; Horohov, D.W.; Rosen, R.T.; Ho, C.T.; Singh, A.P.; et al. Effects of Ginger and Cranberry Extracts on the Physiological Response to Exercise and Markers of Inflammation in Horses. Comp. Exerc. Physiol. 2009, 6, 157–169. [Google Scholar] [CrossRef] [Scilit]
- Liburt, N.R.; Adams, A.A.; Betancourt, A.; Horohov, D.W.; McKEEVER, K.H. Exercise-Induced Increases in Inflammatory Cytokines in Muscle and Blood of Horses: Muscle Cytokine Response in Horses. Equine Vet. J. 2010, 42, 280–288. [Google Scholar] [CrossRef] [Scilit]
- Iyer, S.S.; Cheng, G. Role of Interleukin 10 Transcriptional Regulation in Inflammation and Autoimmune Disease. Crit. Rev. Immunol. 2012, 32, 23–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Doyle, S.E.; Vaidya, S.A.; O’Connell, R.; Dadgostar, H.; Dempsey, P.W.; Wu, T.-T.; Rao, G.; Sun, R.; Haberland, M.E.; Modlin, R.L.; et al. IRF3 Mediates a TLR3/TLR4-Specific Antiviral Gene Program. Immunity 2002, 17, 251–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Molle, C.; Nguyen, M.; Flamand, V.; Renneson, J.; Trottein, F.; De Wit, D.; Willems, F.; Goldman, M.; Goriely, S. IL-27 Synthesis Induced by TLR Ligation Critically Depends on IFN Regulatory Factor 3. J. Immunol. 2007, 178, 7607–7615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Howes, A.; Taubert, C.; Blankley, S.; Spink, N.; Wu, X.; Graham, C.M.; Zhao, J.; Saraiva, M.; Ricciardi-Castagnoli, P.; Bancroft, G.J.; et al. Differential Production of Type I IFN Determines the Reciprocal Levels of IL-10 and Proinflammatory Cytokines Produced by C57BL/6 and BALB/c Macrophages. J. Immunol. 2016, 197, 2838–2853. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coutinho-Wolino, K.S.; Almeida, P.P.; Mafra, D.; Stockler-Pinto, M.B. Bioactive Compounds Modulating Toll-like 4 Receptor (TLR4)-Mediated Inflammation: Pathways Involved and Future Perspectives. Nutr. Res. 2022, 107, 96–116. [Google Scholar] [CrossRef] [Scilit]
- Saleh, H.A.; Yousef, M.H.; Abdelnaser, A. The Anti-Inflammatory Properties of Phytochemicals and Their Effects on Epigenetic Mechanisms Involved in TLR4/NF-ΚB-Mediated Inflammation. Front. Immunol. 2021, 12, 606069. [Google Scholar] [CrossRef] [Scilit]
- Romano, C.; Del Mastro, A.; Sellitto, A.; Solaro, E.; Esposito, S.; Cuomo, G. Tocilizumab Reduces Complement C3 and C4 Serum Levels in Rheumatoid Arthritis Patients. Clin. Rheumatol. 2018, 37, 1695–1700. [Google Scholar] [CrossRef] [Scilit]
- Barclay, A.N. Ig-like Domains: Evolution from Simple Interaction Molecules to Sophisticated Antigen Recognition. Proc. Natl. Acad. Sci. USA 1999, 96, 14672–14674. [Google Scholar] [CrossRef] [Scilit]
- Demaria, S.; Schwab, R.; Gottesman, S.R.; Bushkin, Y. Soluble Beta 2-Microglobulin-Free Class I Heavy Chains Are Released from the Surface of Activated and Leukemia Cells by a Metalloprotease. J. Biol. Chem. 1994, 269, 6689–6694. [Google Scholar] [CrossRef] [Scilit]
- Bouillon, R.; Schuit, F.; Antonio, L.; Rastinejad, F. Vitamin D Binding Protein: A Historic Overview. Front. Endocrinol. 2020, 10, 910. [Google Scholar] [CrossRef] [Scilit]
- Haridas, V.; Shetty, P.; Sarathkumar, E.; Bargale, A.; Vishwanatha, J.K.; Patil, V.; Dinesh, U.S. Reciprocal Regulation of Pro-Inflammatory Annexin A2 and Anti-Inflammatory Annexin A1 in the Pathogenesis of Rheumatoid Arthritis. Mol. Biol. Rep. 2019, 46, 83–95. [Google Scholar] [CrossRef] [Scilit]
- Kanters, E.; van Rijssel, J.; Hensbergen, P.J.; Hondius, D.; Mul, F.P.J.; Deelder, A.M.; Sonnenberg, A.; van Buul, J.D.; Hordijk, P.L. Filamin B Mediates ICAM-1-Driven Leukocyte Transendothelial Migration. J. Biol. Chem. 2008, 283, 31830–31839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakamura, F.; Osborn, T.M.; Hartemink, C.A.; Hartwig, J.H.; Stossel, T.P. Structural Basis of Filamin A Functions. J. Cell Biol. 2007, 179, 1011–1025. [Google Scholar] [CrossRef] [Scilit]
- Piktel, E.; Levental, I.; Durnaś, B.; Janmey, P.; Bucki, R. Plasma Gelsolin: Indicator of Inflammation and Its Potential as a Diagnostic Tool and Therapeutic Target. Int. J. Mol. Sci. 2018, 19, 2516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DiNubile, M.J. Plasma Gelsolin as a Biomarker of Inflammation. Arthritis Res. Ther. 2008, 10, 124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jackson, A.O.; Rahman, G.A.; Long, S. Apolipoprotein-AI and AIBP Synergetic Anti-Inflammation as Vascular Diseases Therapy: The New Perspective. Mol. Cell Biochem. 2021, 476, 3065–3078. [Google Scholar] [CrossRef] [Scilit]
- Yao, X.; Gordon, E.M.; Figueroa, D.M.; Barochia, A.V.; Levine, S.J. Emerging Roles of Apolipoprotein E and Apolipoprotein A-I in the Pathogenesis and Treatment of Lung Disease. Am. J. Respir. Cell Mol. Biol. 2016, 55, 159–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Navab, M.; Anantharamaiah, G.; Fogelman, A. The Role of High-Density Lipoprotein in Inflammation. Trends Cardiovasc. Med. 2005, 15, 158–161. [Google Scholar] [CrossRef] [Scilit]
- Voegele, A.F.; Jerković, L.; Wellenzohn, B.; Eller, P.; Kronenberg, F.; Liedl, K.R.; Dieplinger, H. Characterization of the Vitamin E-Binding Properties of Human Plasma Afamin. Biochemistry 2002, 41, 14532–14538. [Google Scholar] [CrossRef] [Scilit]
- Köninger, A.; Edimiris, P.; Koch, L.; Enekwe, A.; Lamina, C.; Kasimir-Bauer, S.; Kimmig, R.; Dieplinger, H. Serum Concentrations of Afamin Are Elevated in Patients with Polycystic Ovary Syndrome. Endocr. Connect. 2014, 3, 120–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pennington, P.M.; Splan, R.K.; Jacobs, R.D.; Chen, Y.; Singh, R.P.; Li, Y.; Gucek, M.; Wagner, A.L.; Freeman, E.W.; Pukazhenthi, B.S. Influence of Metabolic Status and Diet on Early Pregnant Equine Histotroph Proteome: Preliminary Findings. J. Equine Vet. Sci. 2020, 88, 102938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finney, J.; Moon, H.-J.; Ronnebaum, T.; Lantz, M.; Mure, M. Human Copper-Dependent Amine Oxidases. Arch. Biochem. Biophys. 2014, 546, 19–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jalkanen, S.; Karikoski, M.; Mercier, N.; Koskinen, K.; Henttinen, T.; Elima, K.; Salmivirta, K.; Salmi, M. The Oxidase Activity of Vascular Adhesion Protein-1 (VAP-1) Induces Endothelial E- and P-Selectins and Leukocyte Binding. Blood 2007, 110, 1864–1870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandooren, J.; Itoh, Y. Alpha-2-Macroglobulin in Inflammation, Immunity and Infections. Front. Immunol. 2021, 12, 803244. [Google Scholar] [CrossRef] [Scilit]
- Baker, S.K.; Strickland, S. A Critical Role for Plasminogen in Inflammation. J. Exp. Med. 2020, 217, e20191865. [Google Scholar] [CrossRef] [Scilit]
- Chekol Abebe, E.; Tilahun Muche, Z.; Behaile T/Mariam, A.; Mengie Ayele, T.; Mekonnen Agidew, M.; Teshome Azezew, M.; Abebe Zewde, E.; Asmamaw Dejenie, T.; Asmamaw Mengstie, M. The Structure, Biosynthesis, and Biological Roles of Fetuin-A: A Review. Front. Cell Dev. Biol. 2022, 10, 945287. [Google Scholar] [CrossRef] [Scilit]
- Celkan, T. Plasminogen Deficiency. J. Thromb. Thrombolysis 2017, 43, 132–138. [Google Scholar] [CrossRef] [Scilit]
- Keragala, C.B.; Medcalf, R.L. Plasminogen: An Enigmatic Zymogen. Blood 2021, 137, 2881–2889. [Google Scholar] [CrossRef] [Scilit]
- Öner-İyidoğan, Y.; Koçak, H.; Seyidhanoğlu, M.; Gürdöl, F.; Gülçubuk, A.; Yildirim, F.; Çevik, A.; Uysal, M. Curcumin Prevents Liver Fat Accumulation and Serum Fetuin-A Increase in Rats Fed a High-Fat Diet. J. Physiol. Biochem. 2013, 69, 677–686. [Google Scholar] [CrossRef] [Scilit]






| Gene | 5′-Forward-3′ | 5′-Reverse-3′ |
|---|---|---|
| IL-1α | TTGAGTCGGCAAAGAAATC | GAGAGAGATGGTCAATTTCAG |
| IL-6 | CAGCACATTAAGTACATCCTC | AAAGACCAGTGGTGATTTTC |
| IL-10 | CAGGGTGAAGACTTTCTTTC | AAACTGGATCATCTCCGAC |
| TLR4 | CAGAAAATGCCAGGATGATG | TAGAGATTCAGGTCCATGC |
| NFE2L2 | CAACACATCTCATCAGAACC | GGAGAAACCTCATTGTCATC |
| IFNγ | AGAACTGGGAAAGAGGATAGTG | ATGGCTCTTTTGAATGACCTG |
| IKBKB | ATGAATGCCTCTCGACTTAG | CCAGTTCTTCACTCTTCTTG |
| SOD | CCTATGTGAACAACCTGAAC | CTCCACCATTGAACTTGAG |
| RN18S | CAATACAGGACTCTTTCGAG | ATATACGCTATTGGAGCTGG |
| Spot n. | ID | Gene | Description | Cov. (%) | #Pept. | #Uniq. | MW | pI | Ratio DS_T1/DS_T0 |
|---|---|---|---|---|---|---|---|---|---|
| 594 | A0A3Q2H1S8 | FLNB | Filamin B | 1 | 1 | 1 | 275,363 | 5.5 | 1.33 |
| 594 | F6XT77 | FLNB | Filamin B | 1 | 1 | 1 | 277,858 | 5.46 | |
| 594 | A0A5F5PVA4 | FLNB | Filamin B | 1 | 1 | 1 | 281,354 | 5.42 | |
| 853 | F7DLT3 | AOC3 | Amine oxidase | 1 | 1 | 1 | 84,500 | 5.93 | 0.70 |
| 853 | A0A5F5PLA5 | AOC3 | Amine oxidase | 1 | 1 | 1 | 84,561 | 5.98 | |
| 853 | F6T7X3 | AOC3 | Amine oxidase | 1 | 1 | 1 | 84,745 | 5.93 | |
| 931 | A0A3Q2H4N7 | GSN | Gelsolin | 13 | 10 | 10 | 82,588 | 5.34 | 1.22 |
| 935 | Q28372 | GSN | Gelsolin | 5 | 5 | 5 | 80,827 | 5.58 | 1.25 |
| 961 | F7E2D1 | GSN | Gelsolin | 6 | 5 | 5 | 580,745 | 5.64 | 1.21 |
| 1111 | F7B3I5 | AFM | Afamin | 3 | 2 | 2 | 68,871 | 5.49 | 0.73 |
| 1111 | A0A3Q2ID60 | AFM | Afamin | 3 | 2 | 2 | 71,279 | 5.48 | |
| 1430 | H9GZQ9 | - | Immunoglobulin heavy constant µ | 6 | 4 | 2 | 48,112 | 6.64 | 0.76 |
| 1433 | F6T0P6 | GC | Vitamin D binding protein | 15 | 7 | 7 | 54,327 | 5.46 | 1.35 |
| 1461 | H9GZT5 | - | Immunoglobulin heavy constant µ | 2 | 1 | 1 | 60,138 | 6.17 | 1.23 |
| 1549 | H9GZU8 | - | Immunoglobulin heavy constant µ | 9 | 3 | 2 | 48,837 | 7.5 | 0.80 |
| 1650 | A0A3Q2LPE6 | ANXA2 | Annexin | 14 | 6 | 6 | 44,464 | 6.68 | 1.24 |
| 1735 | A0A3Q2HWQ6 | LOC100060505 | Complement C3 | 1 | 2 | 2 | 186,448 | 0.69 | |
| 1807 | F7AAK7 | ACTG1 | Actin γ 1 | 15 | 4 | 4 | 41,793 | 5.31 | 0.80 |
| 1828 | F6RZ27 | APOA4 | Apolipoprotein A-IV | 25 | 10 | 10 | 43,252 | 5.38 | 1.49 |
| 2494 | A0A3Q2HMJ3 | - | Ig-like domain-containing protein | 20 | 3 | 1 | 14,975 | 8.58 | 1.89 |
| 2393 | A0A0A1E6N9 | IGL | Immunoglobulin λ light chain variable reg | 11 | 2 | 1 | 22,794 | 5.11 | 0.89 |
| Spot n. | ID | Gene | Protein Name | Cov. (%) | #Pept. | #Uniq. | MW | pI | Ratio DS_T1/CTRL_T1 |
|---|---|---|---|---|---|---|---|---|---|
| 635 | F6RI47 | A2M | α-2-macroglobulin | 1 | 1 | 1 | 161,000 | 6.17 | 0.73 |
| 803 | A0A3Q2L7R0 | PLG | Plasminogen | 4 | 5 | 5 | 91,934 | 6.72 | 0.48 |
| 826 | A0A3Q2KNA7 | C7 | Complement C7 | 2 | 2 | 2 | 93,001 | 6.61 | 0.51 |
| 1409 | F7C450 | AHSG | α-2-HS glycoprotein | 6 | 2 | 2 | 38,724 | 5.68 | 0.59 |
| 1623 | A0A3Q2I440 | KRT18 | IF rod domain-containing protein | 4 | 2 | 1 | 48,300 | 5.74 | 0.83 |
| 1735 | A0A3Q2HWQ6 | LOC100060505 | Complement C3 | 1 | 2 | 2 | 186,448 | 0.69 | |
| 1741 | A0A3Q2HWQ6 | LOC100060505 | Complement C3 | 4 | 8 | 8 | 186,448 | 0.73 | |
| 1820 | F6XWM5 | LOC100067869 | Haptoglobin | 3 | 1 | 1 | 38,466 | 5.59 | 0.56 |
| 1968 | D9MNN2 | Eqca-N | MHC class I antigen (Fragment) | 6 | 2 | 2 | 34,847 | 5.28 | 2.37 |
| 1988 | F6TTP1 | RPLP0 | 60S acidic ribomal protein P0 | 3 | 1 | 1 | 34,288 | 5.7 | 0.88 |
| 2256 | F6XSF7 | LOC100059239 | Complement C4 γ chain | 3 | 5 | 5 | 174,058 | 6.17 | 0.61 |
| 2494 | A0A3Q2HMJ3 | - | Ig-like domain-containing protein | 20 | 3 | 1 | 14,975 | 8.58 | 1.89 |
| 2505 | A0A0A1E6K7 | IGL | Immunoglobulin λ light chain variable reg | 11 | 2 | 1 | 23,195 | 2.00 | |
| 2518 | A0A5F5PPG4 | - | Ig-like domain-containing protein | 6 | 1 | 1 | 17,340 | 6.99 | 1.73 |
| 2526 | A0A3Q2H7F5 | - | Ig-like domain-containing protein | 6 | 1 | 1 | 16,902 | 1.36 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Beghelli, D.; Zallocco, L.; Angeloni, C.; Bistoni, O.; Ronci, M.; Cavallucci, C.; Mazzoni, M.R.; Nuccitelli, A.; Catalano, C.; Hrelia, S.; et al. Dietary Supplementation with Boswellia serrata, Verbascum thapsus, and Curcuma longa in Show Jumping Horses: Effects on Serum Proteome, Antioxidant Status, and Anti-Inflammatory Gene Expression. Life 2023, 13, 750. https://doi.org/10.3390/life13030750
Beghelli D, Zallocco L, Angeloni C, Bistoni O, Ronci M, Cavallucci C, Mazzoni MR, Nuccitelli A, Catalano C, Hrelia S, et al. Dietary Supplementation with Boswellia serrata, Verbascum thapsus, and Curcuma longa in Show Jumping Horses: Effects on Serum Proteome, Antioxidant Status, and Anti-Inflammatory Gene Expression. Life. 2023; 13(3):750. https://doi.org/10.3390/life13030750
Chicago/Turabian StyleBeghelli, Daniela, Lorenzo Zallocco, Cristina Angeloni, Onelia Bistoni, Maurizio Ronci, Clarita Cavallucci, Maria Rosa Mazzoni, Anna Nuccitelli, Chiara Catalano, Silvana Hrelia, and et al. 2023. "Dietary Supplementation with Boswellia serrata, Verbascum thapsus, and Curcuma longa in Show Jumping Horses: Effects on Serum Proteome, Antioxidant Status, and Anti-Inflammatory Gene Expression" Life 13, no. 3: 750. https://doi.org/10.3390/life13030750
APA StyleBeghelli, D., Zallocco, L., Angeloni, C., Bistoni, O., Ronci, M., Cavallucci, C., Mazzoni, M. R., Nuccitelli, A., Catalano, C., Hrelia, S., Lucacchini, A., & Giusti, L. (2023). Dietary Supplementation with Boswellia serrata, Verbascum thapsus, and Curcuma longa in Show Jumping Horses: Effects on Serum Proteome, Antioxidant Status, and Anti-Inflammatory Gene Expression. Life, 13(3), 750. https://doi.org/10.3390/life13030750

