MitoTEMPOL Inhibits ROS-Induced Retinal Vascularization Pattern by Modulating Autophagy and Apoptosis in Rat-Injected Streptozotocin Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Housing and Handling of the Animals
2.2. MitoTEMPOL and STZ Dose
2.3. Fundus Photography and Average Numbers of Retinal Vessel
2.4. Fasting Blood Glucose
2.5. Real-Time PCR Studies
2.6. Western Blot Analysis
2.7. Statistical Analysis
3. Results
3.1. Effect of STZ Injection and MitoTEMPOL on Body Weight, Fasting Blood Glucose Level, Food Intake, and Water Intake
3.2. Effect of STZ Injection and MitoTEMPOL on Funduscopy and Vessel Diameter of the Retina
3.3. Effect of STZ Injection and MitoTEMPOL on SOD and Autophagy Gene Expression
3.4. Effect of STZ Injection and MitoTEMPOL on Carbonyl and Caspase Protein Levels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Animaw, W.; Seyoum, Y. Increasing prevalence of diabetes mellitus in a developing country and its related factors. PLoS ONE 2017, 12, e0187670. [Google Scholar] [CrossRef]
- Saeedi, P.; Petersohn, I.; Salpea, P.; Malanda, B.; Karuranga, S.; Unwin, N.; Colagiuri, S.; Guariguata, L.; Motala, A.A.; Ogurtsova, K.; et al. Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9(th) edition. Diabetes Res. Clin. Pract. 2019, 157, 107843. [Google Scholar] [CrossRef]
- Wild, S.; Roglic, G.; Green, A.; Sicree, R.; King, H. Global prevalence of diabetes: Estimates for the year 2000 and projections for 2030. Diabetes Care 2004, 27, 1047–1053. [Google Scholar] [CrossRef]
- Chawla, A.; Chawla, R.; Jaggi, S. Microvasular and macrovascular complications in diabetes mellitus: Distinct or continuum? Indian J. Endocrinol. Metab. 2016, 20, 546–551. [Google Scholar] [CrossRef]
- Zheng, Y.; He, M.; Congdon, N. The worldwide epidemic of diabetic retinopathy. Indian J. Ophthalmol. 2012, 60, 428–431. [Google Scholar]
- Sasongko, M.B.; Widyaputri, F.; Agni, A.N.; Wardhana, F.S.; Kotha, S.; Gupta, P.; Widayanti, T.W.; Haryanto, S.; Widyaningrum, R.; Wong, T.Y.; et al. Prevalence of Diabetic Retinopathy and Blindness in Indonesian Adults with Type 2 Diabetes. Am. J. Ophthalmol. 2017, 181, 79–87. [Google Scholar] [CrossRef]
- Kowluru, R.A.; Mishra, M. Oxidative stress, mitochondrial damage and diabetic retinopathy. Biochim. Biophys. Acta-Mol. Basis Dis. 2015, 1852, 2474–2483. [Google Scholar] [CrossRef]
- Fong, D.S.; Aiello, L.P.; Ferris, F.L., 3rd; Klein, R. Diabetic retinopathy. Diabetes Care 2004, 27, 2540–2553. [Google Scholar] [CrossRef]
- Kaštelan, S.; Tomić, M.; Gverović Antunica, A.; Salopek Rabatić, J.; Ljubić, S. Inflammation and pharmacological treatment in diabetic retinopathy. Mediators Inflamm. 2013, 2013, 213130. [Google Scholar] [CrossRef]
- Everett, L.A.; Paulus, Y.M. Laser Therapy in the Treatment of Diabetic Retinopathy and Diabetic Macular Edema. Curr. Diabetes Rep. 2021, 21, 35. [Google Scholar] [CrossRef]
- Osaadon, P.; Fagan, X.J.; Lifshitz, T.; Levy, J. A review of anti-VEGF agents for proliferative diabetic retinopathy. Eye 2014, 28, 510–520. [Google Scholar] [CrossRef]
- Tao, Y.; Jiang, P.; Zhao, Y.; Song, L.; Ma, Y.; Li, Y.; Wang, H. Retrospective study of aflibercept in combination therapy for high-risk proliferative diabetic retinopathy and diabetic maculopathy. Int. Ophthalmol. 2021, 41, 2157–2165. [Google Scholar] [CrossRef]
- Maeshima, K.; Utsugi-Sutoh, N.; Otani, T.; Kishi, S. Progressive enlargement of scattered photocoagulation scars in diabetic retinopathy. Retina 2004, 24, 507–511. [Google Scholar] [CrossRef]
- Volpe, C.M.O.; Villar-Delfino, P.H.; Dos Anjos, P.M.F.; Nogueira-Machado, J.A. Cellular death, reactive oxygen species (ROS) and diabetic complications. Cell Death Dis. 2018, 9, 119. [Google Scholar] [CrossRef]
- Jiang, Q.; Yin, J.; Chen, J.; Ma, X.; Wu, M.; Liu, G.; Yao, K.; Tan, B.; Yin, Y. Mitochondria-Targeted Antioxidants: A Step towards Disease Treatment. Oxid. Med. Cell. Longev. 2020, 2020, 8837893. [Google Scholar] [CrossRef]
- Zhan, L.; Li, R.; Sun, Y.; Dou, M.; Yang, W.; He, S.; Zhang, Y. Effect of mito-TEMPO, a mitochondria-targeted antioxidant, in rats with neuropathic pain. Neuroreport 2018, 29, 1275–1281. [Google Scholar] [CrossRef]
- Schilling, J.D. The mitochondria in diabetic heart failure: From pathogenesis to therapeutic promise. Antioxid. Redox Signal. 2015, 22, 1515–1526. [Google Scholar] [CrossRef]
- Ni, R.; Cao, T.; Xiong, S.; Ma, J.; Fan, G.-C.; Lacefield, J.C.; Lu, Y.; Tissier, S.T.; Peng, T. Therapeutic inhibition of mitochondrial reactive oxygen species with mito-TEMPO reduces diabetic cardiomyopathy. Free Radic. Biol. Med. 2016, 90, 12–23. [Google Scholar] [CrossRef]
- Trnka, J.; Blaikie, F.H.; Smith, R.A.J.; Murphy, M.P. A mitochondria-targeted nitroxide is reduced to its hydroxylamine by ubiquinol in mitochondria. Free Radic. Biol. Med. 2008, 44, 1406–1419. [Google Scholar] [CrossRef]
- Mustafa, A.G.; Bani-Ahmad, M.A.; Jaradat, A.Q.; Allouh, M.Z. Tempol protects blood proteins and lipids against peroxynitrite-mediated oxidative damage. Exp. Biol. Med. 2015, 240, 109–112. [Google Scholar] [CrossRef]
- Peixoto, E.B.; Papadimitriou, A.; De Faria, J.M.L.; De Faria, J.B.L. Tempol reduces podocyte apoptosis via PARP signaling pathway in experimental diabetes mellitus. Nephron Exp. Nephrol. 2012, 120, e81–e90. [Google Scholar] [CrossRef] [PubMed]
- Ge, Z.; Wang, C.; Zhang, J.; Li, X.; Hu, J. Tempol Protects Against Acetaminophen Induced Acute Hepatotoxicity by Inhibiting Oxidative Stress and Apoptosis. Front. Physiol. 2019, 10, 660. [Google Scholar] [CrossRef]
- Ma, Y.; Huang, Z.; Zhou, Z.; He, X.; Wang, Y.; Meng, C.; Huang, G.; Fang, N. A novel antioxidant Mito-Tempol inhibits ox-LDL-induced foam cell formation through restoration of autophagy flux. Free Radic. Biol. Med. 2018, 129, 463–472. [Google Scholar] [CrossRef]
- Lestari, K.; Diantini, A.; Barliana, M.I.; Achmad, T.H.; Subarnas, A.; Mutakin; Rizky, A.; Ronny, L.; Hwang, J.K. Potential Natural Dual Agonist PPARα/γ-induced Antidiabetic and Antidyslipidemic Properties of Safrole-Free Nutmeg Seed (Myristica fragrans Houtt) Extract. Nat. Prod. J. 2019, 9, 248–253. [Google Scholar] [CrossRef]
- Wu, J.; Yan, L.-J. Streptozotocin-induced type 1 diabetes in rodents as a model for studying mitochondrial mechanisms of diabetic β cell glucotoxicity. Diabetes Metab. Syndr. Obes. 2015, 8, 181–188. [Google Scholar] [PubMed]
- Ahmed, L.A.; Shehata, N.I.; Abdelkader, N.F.; Khattab, M.M. Tempol, a superoxide dismutase mimetic agent, ameliorates cisplatin-induced nephrotoxicity through alleviation of mitochondrial dysfunction in mice. PLoS ONE 2014, 9, e108889. [Google Scholar] [CrossRef]
- Qinna, N.A.; Badwan, A.A. Impact of streptozotocin on altering normal glucose homeostasis during insulin testing in diabetic rats compared to normoglycemic rats. Drug Des. Dev. Ther. 2015, 9, 2515–2525. [Google Scholar] [CrossRef]
- Santos, J.M.; Tewari, S.; Kowluru, R.A. A compensatory mechanism protects retinal mitochondria from initial insult in diabetic retinopathy. Free Radic. Biol. Med. 2012, 53, 1729–1737. [Google Scholar] [CrossRef]
- Wang, L.; Hao, H.; Wang, J.; Wang, X.; Zhang, S.; Du, Y.; Lv, T.; Zuo, L.; Li, Y.; Liu, H. Decreased autophagy: A major factor for cardiomyocyte death induced by β1-adrenoceptor autoantibodies. Cell Death Dis. 2015, 6, e1862. [Google Scholar] [CrossRef]
- Ding, S.; Jiang, J.; Zhang, G.; Bu, Y.; Zhang, G.; Zhao, X. Resveratrol and caloric restriction prevent hepatic steatosis by regulating SIRT1-autophagy pathway and alleviating endoplasmic reticulum stress in high-fat diet-fed rats. PLoS ONE 2017, 12, e0183541. [Google Scholar] [CrossRef]
- Sun, Q.; Xin, F.; Wen, X.; Lu, C.; Chen, R.; Ruan, G. Protective Effects of Different Kinds of Filtered Water on Hypertensive Mouse by Suppressing Oxidative Stress and Inflammation. Oxid. Med. Cell. Longev. 2018, 2018, 2917387. [Google Scholar] [CrossRef]
- Nita, M.; Grzybowski, A. The Role of the Reactive Oxygen Species and Oxidative Stress in the Pathomechanism of the Age-Related Ocular Diseases and Other Pathologies of the Anterior and Posterior Eye Segments in Adults. Oxid. Med. Cell. Longev. 2016, 2016, 3164734. [Google Scholar] [CrossRef]
- Juan, C.A.; Pérez de la Lastra, J.M.; Plou, F.J.; Pérez-Lebeña, E. The Chemistry of Reactive Oxygen Species (ROS) Revisited: Outlining Their Role in Biological Macromolecules (DNA, Lipids and Proteins) and Induced Pathologies. Int. J. Mol. Sci. 2021, 22, 4642. [Google Scholar] [CrossRef]
- Santos, J.M.; Tewari, S.; Lin, J.Y.; Kowluru, R.A. Interrelationship between activation of matrix metalloproteinases and mitochondrial dysfunction in the development of diabetic retinopathy. Biochem. Biophys. Res. Commun. 2013, 438, 760–764. [Google Scholar] [CrossRef]
- Kanwar, M.; Chan, P.-S.; Kern, T.S.; Kowluru, R.A. Oxidative damage in the retinal mitochondria of diabetic mice: Possible protection by superoxide dismutase. Investig. Ophthalmol. Vis. Sci. 2007, 48, 3805–3811. [Google Scholar] [CrossRef]
- Oyewole, A.O.; Birch-Machin, M.A. Mitochondria-targeted antioxidants. FASEB J. 2015, 29, 4766–4771. [Google Scholar] [CrossRef]
- Lian, K.; Wang, Q.; Zhao, S.; Yang, M.; Chen, G.; Chen, Y.; Li, C.; Gao, H.; Li, C. Pretreatment of Diabetic Adipose-derived Stem Cells with mitoTEMPO Reverses their Defective Proangiogenic Function in Diabetic Mice with Critical Limb Ischemia. Cell Transplant. 2019, 28, 1652–1663. [Google Scholar] [CrossRef]
- Jin, H.; Kanthasamy, A.; Ghosh, A.; Anantharam, V.; Kalyanaraman, B.; Kanthasamy, A.G. Mitochondria-targeted antioxidants for treatment of Parkinson’s disease: Preclinical and clinical outcomes. Biochim. Biophys. Acta-Mol. Basis Dis. 2014, 1842, 1282–1294. [Google Scholar] [CrossRef]
- Green, D.R.; Galluzzi, L.; Kroemer, G. Cell biology. Metabolic control of cell death. Science 2014, 345, 1250256. [Google Scholar] [CrossRef]
- Apostolova, N.; Victor, V.M. Molecular strategies for targeting antioxidants to mitochondria: Therapeutic implications. Antioxid. Redox Signal. 2015, 22, 686–729. [Google Scholar] [CrossRef]
- She, S.; Liu, W.; Li, T.; Hong, Y. Effects of puerarin in STZ-induced diabetic rats by oxidative stress and the TGF-β1/Smad2 pathway. Food Funct. 2014, 5, 944–950. [Google Scholar] [CrossRef]
- Aldahmash, B.A.; El-Nagar, D.M.; Ibrahim, K.E. Attenuation of hepatotoxicity and oxidative stress in diabetes STZ-induced type 1 by biotin in Swiss albino mice. Saudi J. Biol. Sci. 2016, 23, 311–317. [Google Scholar] [CrossRef]
- Abdollahi, M.; Hosseini, A. Streptozotocin. In Wexler PBT-E of T, 3rd ed.; Oxford Academic Press: Oxford, UK, 2014; pp. 402–404. [Google Scholar]
- Fernández-Alvarez, J.; Barberà, A.; Nadal, B.; Barceló-Batllori, S.; Piquer, S.; Claret, M.; Guinovart, J.J.; Gomis, R. Stable and functional regeneration of pancreatic beta-cell population in nSTZ-rats treated with tungstate. Diabetologia 2004, 47, 470–477. [Google Scholar] [CrossRef][Green Version]
- Wang-Fischer, Y.; Garyantes, T. Improving the reliability and utility of streptozotocin-induced rat diabetic model. J. Diabetes Res. 2018, 2018, 8054073. [Google Scholar] [CrossRef]
- Röder, P.V.; Wu, B.; Liu, Y.; Han, W. Pancreatic regulation of glucose homeostasis. Exp. Mol. Med. 2016, 48, e219. [Google Scholar] [CrossRef]
- Grams, J.; Garvey, W.T. Weight Loss and the Prevention and Treatment of Type 2 Diabetes Using Lifestyle Therapy, Pharmacotherapy, and Bariatric Surgery: Mechanisms of Action. Curr. Obes. Rep. 2015, 4, 287–302. [Google Scholar] [CrossRef]
- Frank, R.N. Diabetic retinopathy. N. Engl. J. Med. 2004, 350, 48–58. [Google Scholar] [CrossRef]
- Noma, H.; Minamoto, A.; Funatsu, H.; Tsukamoto, H.; Nakano, K.; Yamashita, H.; Mishima, H.K. Intravitreal levels of vascular endothelial growth factor and interleukin-6 are correlated with macular edema in branch retinal vein occlusion. Graefe’s Arch. Clin. Exp. Ophthalmol. 2006, 244, 309–315. [Google Scholar] [CrossRef]
- Cho, H.; Alwassia, A.A.; Regiatieri, C.V.; Zhang, J.Y.; Baumal, C.; Waheed, N.; Duker, J.S. Retinal neovascularization secondary to proliferative diabetic retinopathy characterized by spectral domain optical coherence tomography. Retina 2013, 33, 542–547. [Google Scholar] [CrossRef]
- Duh, E.J.; Sun, J.K.; Stitt, A.W. Diabetic retinopathy: Current understanding, mechanisms, and treatment strategies. JCI Insight 2017, 2, e93751. [Google Scholar] [CrossRef]
- Younus, H. Therapeutic potentials of superoxide dismutase. International journal of health sciences. Int. J. Health Sci. 2018, 12, 88–93. [Google Scholar]
- Wang, Y.; Branicky, R.; Noë, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef]
- Scheen, M.; Giraud, R.; Bendjelid, K. Stress hyperglycemia, cardiac glucotoxicity, and critically ill patient outcomes current clinical and pathophysiological evidence. Physiol. Rep. 2021, 9, e14713. [Google Scholar] [CrossRef]
- Swarup, A.; Samuels, I.S.; Bell, B.A.; Han, J.Y.S.; Du, J.; Massenzio, E.; Abel, D.E.; Boesze-Battaglia, K.; Peachey, N.S.; Philp, N.J. Modulating GLUT1 expression in retinal pigment epithelium decreases glucose levels in the retina: Impact on photoreceptors and müller glial cells. Am. J. Physiol. Cell Physiol. 2019, 316, C121–C133. [Google Scholar] [CrossRef]
- Kawakami, T.; Puri, N.; Sodhi, K.; Bellner, L.; Takahashi, T.; Morita, K.; Rezzani, R.; Oury, T.D.; Abraham, N.G. Reciprocal Effects of Oxidative Stress on Heme Oxygenase Expression and Activity Contributes to Reno-Vascular Abnormalities in EC-SOD Knockout Mice. Int. J. Hypertens. 2012, 2012, 740203. [Google Scholar] [CrossRef]
- Hauck, A.K.; Huang, Y.; Hertzel, A.V.; Bernlohr, D.A. Adipose oxidative stress and protein carbonylation. J. Biol. Chem. 2019, 294, 1083–1088. [Google Scholar] [CrossRef]
- Loukovaara, S.; Koivunen, P.; Inglés, M.; Escobar, J.; Vento, M.; Andersson, S. Elevated protein carbonyl and HIF-1α levels in eyes with proliferative diabetic retinopathy. Acta Ophthalmol. 2013, 92, 323–327. [Google Scholar] [CrossRef]
- Margetis, P.I.; Antonelou, M.H.; Petropoulos, I.K.; Margaritis, L.H.; Papassideri, I.S. Increased protein carbonylation of red blood cell membrane in diabetic retinopathy. Exp. Mol. Pathol. 2009, 87, 76–82. [Google Scholar] [CrossRef]
- Mandel, E.R.; Dunford, E.C.; Abdifarkosh, G.; Turnbull, P.C.; Perry, C.G.R.; Riddell, M.C.; Haas, T.L. The superoxide dismutase mimetic tempol does not alleviate glucocorticoid-mediated rarefaction of rat skeletal muscle capillaries. Physiol. Rep. 2017, 5, e13243. [Google Scholar] [CrossRef]
- Yin, Z.; Pascual, C.; Klionsky, D.J. Autophagy: Machinery and regulation. Microb. Cell 2016, 3, 588–596. [Google Scholar] [CrossRef]
- Jiang, T.; Harder, B.; de la Vega, M.R.; Wong, P.K.; Chapman, E.; Zhang, D.D. P62 links autophagy and Nrf2 signaling. Free Radic. Biol. Med. 2015, 88, 199–204. [Google Scholar] [CrossRef]
- Schaaf, M.B.E.; Keulers, T.G.; Vooijs, M.A.; Rouschop, K.M.A. LC3/GABARAP family proteins: Autophagy-(un)related functions. FASEB J. 2016, 30, 3961–3978. [Google Scholar] [CrossRef]
- Bhattacharya, D.; Mukhopadhyay, M.; Bhattacharyya, M.; Karmakar, P. Is autophagy associated with diabetes mellitus and its complications? A review. EXCLI J. 2018, 17, 709–720. [Google Scholar]
- Piano, I.; Novelli, E.; Della Santina, L.; Strettoi, E.; Cervetto, L.; Gargini, C. Involvement of Autophagic Pathway in the Progression of Retinal Degeneration in a Mouse Model of Diabetes. Front. Cell. Neurosci. 2016, 10, 42. [Google Scholar] [CrossRef]
- Rosa, M.D.; Distefano, G.; Gagliano, C.; Rusciano, D.; Malaguarnera, L. Autophagy in Diabetic Retinopathy. Curr. Neuropharmacol. 2016, 14, 810–825. [Google Scholar] [CrossRef]
- Lai, A.K.W.; Lo, A.C.Y. Animal models of diabetic retinopathy: Summary and comparison. J. Diabetes Res. 2013, 2013, 106594. [Google Scholar] [CrossRef]
- Rajagopal, R.; Bligard, G.W.; Zhang, S.; Yin, L.; Lukasiewicz, P.; Semenkovich, C.F. Functional Deficits Precede Structural Lesions in Mice With High-Fat Diet-Induced Diabetic Retinopathy. Diabetes 2016, 65, 1072–1084. [Google Scholar] [CrossRef]
Gene Symbol | Primer Sequence (5′ to 3′) Upper Strand: Sense Lower Strand: Antisense | Product Size (bp) | References |
---|---|---|---|
SOD2 | AATGTTGTGTCGGGCGGCGT | 173 bp | [28] |
AGGTCGCGTGGTGCTTGCTG | |||
LC3 | CATGCCGTCCGAGAAGACCT | 70 bp | [29] |
GATGAGCCGGACATCTTCCACT | |||
p62 | CGGAAGTCAGCAAACC | 149 bp | [30] |
ATGCGTCCAGTCGTCA | |||
GAPDH | AGGTCGGTGTGAACGGATTTG | 123 bp | [31] |
TGTAGACCATGTAGTTGAGGTCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Virgana, R.; Atik, N.; Gunadi, J.W.; Jonathan, E.; Ramadhani, D.E.; Soetadji, R.S.; Goenawan, H.; Lesmana, R.; Kartasasmita, A. MitoTEMPOL Inhibits ROS-Induced Retinal Vascularization Pattern by Modulating Autophagy and Apoptosis in Rat-Injected Streptozotocin Model. Life 2022, 12, 1061. https://doi.org/10.3390/life12071061
Virgana R, Atik N, Gunadi JW, Jonathan E, Ramadhani DE, Soetadji RS, Goenawan H, Lesmana R, Kartasasmita A. MitoTEMPOL Inhibits ROS-Induced Retinal Vascularization Pattern by Modulating Autophagy and Apoptosis in Rat-Injected Streptozotocin Model. Life. 2022; 12(7):1061. https://doi.org/10.3390/life12071061
Chicago/Turabian StyleVirgana, Rova, Nur Atik, Julia Windi Gunadi, Evelyn Jonathan, Dona Erisa Ramadhani, Ray Sebastian Soetadji, Hanna Goenawan, Ronny Lesmana, and Arief Kartasasmita. 2022. "MitoTEMPOL Inhibits ROS-Induced Retinal Vascularization Pattern by Modulating Autophagy and Apoptosis in Rat-Injected Streptozotocin Model" Life 12, no. 7: 1061. https://doi.org/10.3390/life12071061
APA StyleVirgana, R., Atik, N., Gunadi, J. W., Jonathan, E., Ramadhani, D. E., Soetadji, R. S., Goenawan, H., Lesmana, R., & Kartasasmita, A. (2022). MitoTEMPOL Inhibits ROS-Induced Retinal Vascularization Pattern by Modulating Autophagy and Apoptosis in Rat-Injected Streptozotocin Model. Life, 12(7), 1061. https://doi.org/10.3390/life12071061