Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Collection
2.2. Selected Specimens Examined
2.3. Systematic Treatment
Identification and Nomenclature
2.4. DNA Extraction and PCR Amplification
2.5. DNA Sequencing
2.6. Molecular Data Analysis
2.6.1. Molecular Identification
2.6.2. BLAST (Basic Local Alignment Search Tool) and Reference Datasets
2.6.3. Tree-Based Analysis
3. Results
3.1. Taxonomic Identity of Rosa arabica
3.2. Molecular Identification Approach
3.3. Phylogenetic Relationship
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Mabberley, D.J. The Plant-Book: A Portable Dictionary of the Vascular Plants; Cambridge University Press: Cambridge, UK, 1997. [Google Scholar]
- Heywood, V.H.D.; Moore, I.; Richardson, W.T.S. Flowering Plants of the World; Oxford University Press: Oxford, UK, 1993. [Google Scholar]
- Christenhusz, M.J.; Fay, M.F.; Chase, M.W. Plants of the World: An Illustrated Encyclopedia of Vascular Plants; University of Chicago Press: Chicago, IL, USA, 2017. [Google Scholar]
- Ku, T.; Robertson, K. Rosa (Rosaceae). Flora China 2003, 9, 339–381. [Google Scholar]
- Bisby, F.A.; Roskov, Y.; Orrell, T.M.; Nicolson, D.; Paglinawan, L.E.; Bailly, N.; Kirk, P.M.; Bourgoin, T.; Baillargeon, G.; Ouvrard, D. Species 2000 and ITIS Catalogue of Life; 2020-09-01 Beta; Species 2000: Leiden, The Netherlands, 2020. [Google Scholar]
- Wissemann, V. Conventional taxonomy of wild roses. S. 111–117. In Encyclopedia of Rose Science; Roberts, A., Debener, T., Gudin, S., Eds.; Academic Press: London, UK, 2003. [Google Scholar]
- Focke, W. Rosaceae en Engler u. Prantl. Die Nat. Pflanz. 1888, 3, 53. [Google Scholar]
- Rehder, A.; Dudley, T.R. Manual of Cultivated Trees and Shrubs Hardy in North America: Exclusive of the Subtropical and Warmer Temperate Regions; Macmillan: New York, NY, USA, 1940. [Google Scholar]
- Cockerell, T. Rosa stellata. Nature 1913, 90, 571. [Google Scholar] [CrossRef][Green Version]
- Bean, W.J. Trees and Shrubs Hardy in the British Isles; John Murray: London, UK, 1973; Volume 1. [Google Scholar]
- Wissemann, V.; Ritz, C.M. The genus Rosa (Rosoideae, Rosaceae) revisited: Molecular analysis of nrITS-1 and atp B-rbc L intergenic spacer (IGS) versus conventional taxonomy. Bot. J. Linn. Soc. 2005, 147, 275–290. [Google Scholar] [CrossRef]
- Fougère-Danezan, M.; Joly, S.; Bruneau, A.; Gao, X.-F.; Zhang, L. Phylogeny and biogeography of wild roses with specific attention to polyploids. Ann. Bot. 2014, 115, 275–291. [Google Scholar] [CrossRef]
- Zhu, Z.-M.; Gao, X.-F.; Fougère-Danezan, M. Phylogeny of Rosa sections Chinenses and Synstylae (Rosaceae) based on chloroplast and nuclear markers. Mol. Phylogen. Evol. 2015, 87, 50–64. [Google Scholar] [CrossRef]
- Liu, C.; Wang, G.; Wang, H.; Xia, T.; Zhang, S.; Wang, Q.; Fang, Y. Phylogenetic relationships in the genus Rosa revisited based on rpl16, trnL-F, and atpB-rbcL sequences. Hortscience 2015, 50, 1618–1624. [Google Scholar] [CrossRef]
- Erlanson, E.W. Phylogeny and polyploidy in Rosa. New Phytol. 1938, 37, 72–81. [Google Scholar] [CrossRef]
- Bruneau, A.; Starr, J.R.; Joly, S. Phylogenetic relationships in the Genus Rosa: New evidence from chloroplast DNA sequences and an appraisal of current knowledge. Syst. Bot. 2007, 32, 366–378. [Google Scholar] [CrossRef]
- Koopman, W.J.M.; Wissemann, V.; De Cock, K.; Van Huylenbroeck, J.; De Riek, J.; Sabatino, G.J.H.; Visser, D.; Vosman, B.; Ritz, C.M.; Maes, B.; et al. AFLP markers as a tool to reconstruct complex relationships: A case study in Rosa (Rosaceae). Am. J. Bot. 2008, 95, 353–366. [Google Scholar] [CrossRef]
- Tackholm, V.; Drar, M. Students’ Flora of Egypt; Cairo University: Cairo, Egypt, 1956. [Google Scholar]
- El-Hadidi, M. Materials from excursion flora of Egypt (EFE). Taeckholmia 1995, 15, 74–75. [Google Scholar]
- Boulos, L. Flora of Egypt; Al Hadara Publishing: Cairo, Egypt, 1999; Volume 1. [Google Scholar]
- Omar, K. Rosa Arabica; The IUCN Red List of Threatened Species: London, UK, 2017. [Google Scholar] [CrossRef]
- Klââterskÿ, I. Rosa, L. In Flora Europaea; Tutin, T., Heywood, V., Burges, N., Moore, D., Valentine, D., Walters, S., Eds.; Cambridge University Press: Cambridge, UK, 1981; pp. 25–32. [Google Scholar]
- Crépin, F. Primitiae Monographiae Rosarum: Matériaux Pour Servir à L’histoire des Roses; Imprimerie C. Annoot-Braeckman: Ghent, Belgium, 1869. [Google Scholar]
- Qiu, X.; Zhang, H.; Wang, Q.; Jian, H.; Yan, H.; Zhang, T.; Wang, J.; Tang, K. Phylogenetic relationships of wild roses in China based on nrDNA and matK data. Sci. Hortic. 2012, 140, 45–51. [Google Scholar] [CrossRef]
- Kalwij, J.M. Review of ‘The Plant List, a working list of all plant species’. J. Veg. Sci. 2012, 23, 998–1002. [Google Scholar] [CrossRef]
- De la Cruz, R. The usefulness of weed diversity in slash/mulch bean production: Difficulties in herbicide use. In Tapado Slash/Mulch: How Farmers Use It and What Researchers Know about It; Cornell International Institute for Food, Agriculture and Development: Brighton, UK, 1994; pp. 233–237. [Google Scholar]
- Thiers, B. Continuously Updated: Index Herbariorum: A Global Directory of Public Herbaria and Associated Staff. New York Botanical Garden’s Virtual Herbarium. Available online: http://sweetgum.nybg.org/science/ih/ (accessed on 7 May 2020).
- Doyle, J. DNA protocols for plants. In Molecular Techniques in Taxonomy; Springer: Berlin, Germany, 1991; pp. 283–293. [Google Scholar]
- The Plant List. 2013. Available online: http://www.theplantlist.org/ (accessed on 9 April 2020).
- The Online, Nomenclatural Database of the Missouri Botanical Garden. 2018. Available online: http://www.tropicos.org (accessed on 12 April 2020).
- Abderabbi, K.A.; Adda, H.; Benhassaini, O.M. Leaf morphological and anatomical traits variation of Artemisia herba-alba in a steppe zone of Algeria. Bulg. J. Agric. Sci. 2018, 24, 631–637. [Google Scholar]
- Integrated Digitized Biocollections. Available online: https://www.idigbio.org/portal/records/3f406bb6-d54d-443b-92ce-016166dace53#citation (accessed on 12 February 2020).
- Khan, A.S.; Ali, S.; Khan, I.A. Morphological and molecular characterization and evaluation of mango germplasm: An overview. Sci. Hortic. 2015, 194, 353–366. [Google Scholar] [CrossRef]
- Plant of the World Online. Available online: http://powo.science.kew.org/taxon/731621-1 (accessed on 16 February 2020).
- De Azeredo, R.M.A.; Mendes, M.A.; Joko, C.Y.; Delgado, M.N. Effect of expansion time and sunlight radiation on the functional and anatomical traits of mango tree leaves. Rev. Agrogeoambiental 2018, 9, 4. [Google Scholar] [CrossRef][Green Version]
- Catalogue of Life. Available online: http://www.catalogueoflife.org/col/search/all/key/Rosa+arabica/fossil/1/match/1 (accessed on 16 February 2020).
- WFO. World Flora Online. 2020. Available online: http://www.worldfloraonline.org/ (accessed on 8 December 2020).
- Torrecilla, P.; Catalán, P. Phylogeny of broad-leaved and fine-leaved Festuca lineages (Poaceae) based on nuclear ITS sequences. Syst. Bot. 2002, 27, 241–251. [Google Scholar]
- Douzery, E.J.P.; Pridgeon, A.M.; Kores, P.; Linder, H.P.; Kurzweil, H.; Chase, M.W. Molecular phylogenetics of Diseae (Orchidaceae): A contribution from nuclear ribosomal ITS sequences. Am. J. Bot. 1999, 86, 887–899. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.L.; Yi, D.K.; Kim, J.S.; Kim, K.J. Development of plant DNA barcoding markers from the variable noncoding regions of chloroplast genome. In Proceedings of the International Barcode of Life Conference, Taipei, Taiwan, 16–21 September 2007. [Google Scholar]
- Wong, K.-L.; But, P.P.-H.; Shaw, P.-C. Evaluation of seven DNA barcodes for differentiating closely related medicinal Gentiana species and their adulterants. Chin. Med. 2013, 8, 16. [Google Scholar] [CrossRef] [PubMed]
- Taberlet, P.; Gielly, L.; Pautou, G.; Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 1991, 17, 1105–1109. [Google Scholar] [CrossRef]
- Gong, W.; Liu, Y.; Chen, J.; Hong, Y.; Kong, H. DNA barcodes identify Chinese medicinal plants and detect geographical patterns of Sinosenecio (Asteraceae). J. Syst. Evol. 2015, 54, 83–91. [Google Scholar] [CrossRef]
- Mao, Y.-R.; Zhang, Y.-H.; Nakamura, K.; Guan, B.-C.; Qiu, Y.-X. Developing DNA barcodes for species identification in Podophylloideae (Berberidaceae). J. Syst. Evol. 2014, 52, 487–499. [Google Scholar] [CrossRef]
- Larranaga, N.; Hormaza, J.I. DNA barcoding of perennial fruit tree species of agronomic interest in the genus Annona (Annonaceae). Front. Plant Sci. 2015, 6, 589. [Google Scholar] [CrossRef] [PubMed]
- Thompson, J.D.; Gibson, T.J.; Higgins, D.G. Multiple sequence alignment using ClustalW and ClustalX. Curr. Prot. Bioinfor. 2003, 1, 1–22. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010. [Google Scholar]
- Posada, D.; Crandall, K.A. Modeltest: Testing the model of DNA substitution. Bioinformatics 1998, 14, 817–818. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
- Elias, M.; Joron, M.; Willmott, K.; Kaiser, V.; Silva-Brandão, K.; Freitas, A.; Mejia, C.A.; Pineres, L.; Brower, A.; Jiggins, C. Phylogenetic hypothesis, pattern of speciation and evolution of wing pattern in neotropical Napeogenes butterflies (Lepidoptera: Nymphalidae). J. Insect Sci. 2007, 7, 13–14. [Google Scholar]
- El-Banhawy, A.; Al-Juhani, W. DNA barcoding and phylogeny of Phlomis aurea (Lamiaceae) endemic to Sinai Peninsula, Egypt. Pak. J. Bot. 2019, 51, 1263–1271. [Google Scholar] [CrossRef]
- Herbarium Hamburgense. Available online: http://www.herbariumhamburgense.de/herbarsheets/disk_batch04/medium/HBG-511228.jpg (accessed on 10 May 2020).
- Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef]
- Tomljenovic, N.; Pejić, I. Taxonomic review of the genus Rosa. Agric. Consp. Sci. 2018, 83, 139–147. [Google Scholar]
- Shamso, E.; Sadek, A.; Hosni, H. Morphological and anatomical characteristics of endemic Rosa arabica (Rosoideae, Rosaceae) from Sinai, Egypt. Taeckholmia 2019, 39, 34–43. [Google Scholar] [CrossRef]
- Ussery, D. Encyclopedia of Genetics; Academic Press: New York, NY, USA, 2001. [Google Scholar]
- Faried, A.; El-Banhawy, A.; Elqahtani, M. Taxonomic, DNA barcoding and phylogenetic reassessment of the Egyptian Ephedra, L. (Ephedraceae). Int. J. Environ. Sci. 2018, 17, 1–13. [Google Scholar]
Query | Retrieved Name | Name Resolution | Synonym | Taxonomic Status | Database /Flora |
---|---|---|---|---|---|
R. arabica | R. arabica Crép. | Accepted | None | Species | IDigBio |
R. arabica Crép. | Accepted | R. rubiginosa | Species | Open Tree of Life | |
R. arabica Crép. | Accepted | None | Species | IPNI | |
R. arabica (Crép. ex Boiss.) Déségl. | Accepted | None | Species | PoWo | |
R. arabica Crép. | Accepted | R. rubiginosa var. arabica (Crépin) Boiss. | Species | Catalog of Life | |
R. arabica | Synonym | R. arvensis Huds. | Species | GBIF | |
R. rubiginosa L. | Synonym | R. arabica Crép. R. eglanteria L. | Species | Weeds of Australia | |
R. arabica (Crép. ex Boiss.) Déségl. | Not recognized | Not recognized | Not recognized | Tropicos | |
R. arabica Crép. | Unresolved | None | Unresolved | TPL | |
R. arabica (Crép. ex Boiss.) Déségl. | Unresolved | None | Unresolved | ||
R. arabica (Crép.) | Ambiguous | None | Ambiguous | WFO |
Region | Primer F/R | Primer Sequence (5′–3′) | Reference |
---|---|---|---|
ITS | KRC | GCACGCGCGCTACACTGA | [38] |
AB102 | TAGAATTCCCCGGTTCGCTCGCCGTTAC | [39] | |
matK | K1R | ACCCAGTCCATCTGGAAATCTTGGTTC | [40] |
K3F | CGTACAGTACTTTTGTGTTTACGAG | ||
rbcL | rbcL a-F | ATGTCACCACAAACAGAGACTAAAGC | [41] |
rbcL a-R | GTAAAATCAAGTCCACCRCG | ||
trnL(UAG) | CTGCTTCCTAAGAGCAGCGT | ||
trnT-trnL | trn-b | TCTACCGATTTCGCCATATC | [42] |
trn-a | CATTACAAATGCGATGCTCT | ||
trnL (intron) | trn-d | GGGGATAGAGGGACTTGAAC | |
trn-c | CGAAATCGGTAGACGCTACG |
Characters | Taxa | |
---|---|---|
R. arabica Crép. | R. rubiginosa L. | |
Habitus | Erect or scrambling | Erect |
Life form | Shrub | Shrub |
Plant height | 0.5–1.5 m | 1.5–2 m |
Prickles | Stout, falcate up to 1.5 cm | Falcate or curved, sometimes mixed with acicles and glandular setae |
Leaflets shape | Broadly elliptic obovate | Suborbicular to broadly ovate to obovate |
Leaflet No. | 5–7 | 5–7 |
Leaflets length | 10–30 mm | 10–25 mm |
Leaflets width | 6–18 mm | 8–15 mm |
Leaflets margin | Doubly serrate | Compound–serrate |
Leaflet base | Rounded | Rounded |
Leaflet upper surface | Glabrous, sparsely glandular, or slightly setose along midtrip | Glabrous or pubescent |
Leaflet lower surface | Sparsely glandular | Pubescent or densely glandular–viscid |
Pedicels length | 10 mm | 10–15 mm |
Pedicels surface | Setose–glandular | Densely stipitate or setose–glandular |
Sepals nature | Recurved, persistent after anthesis | Erect and persistent after anthesis |
Sepals dorsal surface | Setose–glandular | Glandular |
Sepals ventral surface | Densely tomentose | Glandular |
Hypanthium Shape | Globose | Sub globose, ovoid or ellipsoid |
Hypanthium surface | Setose–sparsely glandular | Glabrous or glandular–hispid |
Hypanthium color | Bright red | Bright red |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
EL-Banhawy, A.; Acedo, C.; Qari, S.; Elkordy, A. Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species. Life 2020, 10, 335. https://doi.org/10.3390/life10120335
EL-Banhawy A, Acedo C, Qari S, Elkordy A. Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species. Life. 2020; 10(12):335. https://doi.org/10.3390/life10120335
Chicago/Turabian StyleEL-Banhawy, Ahmed, Carmen Acedo, Sameer Qari, and Ahmed Elkordy. 2020. "Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species" Life 10, no. 12: 335. https://doi.org/10.3390/life10120335
APA StyleEL-Banhawy, A., Acedo, C., Qari, S., & Elkordy, A. (2020). Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species. Life, 10(12), 335. https://doi.org/10.3390/life10120335