Next Article in Journal
FSH-R Human Early Male Genital Tract, Testicular Tumors and Sperm: Its Involvement in Testicular Disorders
Previous Article in Journal
Unique Mitochondrial Single Nucleotide Polymorphisms Demonstrate Resolution Potential to Discriminate Theileria parva Vaccine and Buffalo-Derived Strains
 
 
Due to scheduled maintenance work on our servers, there may be short service disruptions on this website between 11:00 and 12:00 CEST on March 28th.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species

1
Botany Department, Faculty of Science, Suez Canal University, Ismailia 41522, Egypt
2
Biodiversity and Environment Management Department, Faculty of Biological and Environmental Sciences, University of León, 24071 León, Spain
3
Biology Department, Aljumum University College, Umm Al-Qura University, Makkah 21421, Saudi Arabia
4
Botany and Microbiology Department, Faculty of Science, Sohag University, Sohag 82524, Egypt
*
Authors to whom correspondence should be addressed.
Life 2020, 10(12), 335; https://doi.org/10.3390/life10120335
Submission received: 29 October 2020 / Revised: 25 November 2020 / Accepted: 7 December 2020 / Published: 9 December 2020
(This article belongs to the Section Evolutionary Biology)

Abstract

The Egyptian narrowly endemic and critically endangered plant species Rosa arabica Crép. was studied employing a taxonomic and molecular approach. Morphological investigations, distance analysis, and phylogenetic reconstruction revealed that R. arabica is a distinct species with great affinity to R. canina and differentiated from R. rubiginosa. Molecular identification based on the sequences of multiple markers single or in combination ITS, matK, rbcL, and trnL-F succeeded in identifying R. arabica at genus and species levels. We evaluated the potential of each marker and a combination of the nuclear ITS -Internal Transcribed Spacer- with one of the plastid markers, matK, rbcL, or trnL-F, to accurately identify Rosa species. All of them were successful in identifying R. arabica. Classification based on DNA sequences shows that R. arabica is placed within section Caninae in a clade comprising R. canina and R. rubiginosa. Moreover, R. arabica is closely related to other European Rosa species. In conclusion, our results indicate that the four DNA markers can provide species resolution in the context of the genus Rosa and relatives, aiming to characterize morphology and genetic diversity in the ecological and economically important genus Rosa.

1. Introduction

The family Rosaceae is a large sub-cosmopolitan family located mainly in the temperate and warm areas of the Northern Hemisphere [1]. Heywood [2] stated that the family consists of 122 genera and 3370 species. Christenhusz et al. [3], reported 54–75 (90) genera and 2950 species. The genus Rosa L. comprises approximately 200 species [4]. Recently, ref. [5] updated those numbers as 5819 species in 109 genera and 310 species in the Genus Rosa.
Conventional taxonomy by Wissemann [6] divides the genus into four subgenera, three of which are monotypic or contain two species (Hulthemia Dumort. [7], Platyrhodon (Hurst) Rehder [8], and Hesperhodos Cockerell [9]) and subgenus Rosa L. with 11 sections [10]. In 2005, ref. [11] stated that all the subgenera of Rosa are “best treated as sections, and not as separate genera”. They formally transferred all subgenera to sections. This was later supported by [12,13,14].
Hybridization is common within the genus Rosa. Hybrids contribute to the diversity of the genus, increasing the difficulty in reconstructing the species relationships based on morphology. Numerous researches investigated the phylogeny of the genus Rosa, most of which suggested that the divisions of most subgenera and sections based on morphology were artificial [12,15,16,17].
The Rosaceae family is represented in Egypt by seven taxa belonging to six genera, namely, Crataegus azarolus L., Crataegus × sinaica Boiss., Cotoneaster orbicularis Schltall., Potentilla supina L., Rosa arabica Crép., Rubus sanctus Schreb., and Sanguisorba minor Scop. Of these taxa, only Potentilla supina is ubiquitous, while the others are either of rare or of sporadic occurrence [18,19,20].
The genus Rosa is represented in Egypt by only one species, i.e., R. arabica Crép. Its vernacular name is Sant Catherine wild rose, or “Ward Barre”. This species is endemic and is on the red list of the world’s most threatened species; it has a narrow distribution restricted to Mount Catherine, South Sinai, Egypt [21].
Rosa rubiginosa is a native rose species to Europe and Northern Asia [22]. R. arabica was proposed by Crépin, who classified R. arabica as an Asian variety of the European R. rubiginosa L. [23]. R. arabica and R. rubiginosa were treated as closely related on the basis of their morphology, as well as the many floras, monographs, and electronic sites treated R. arabica among the synonyms of R. rubiginosa [6,8,23,24]. According to The Plant List database (TPL) [25], the name R. arabica is reported as an unresolved name, i.e., not established as either accepted or a synonym. The Weeds of Australia website [26] reports both R. arabica and R. eglanteria as synonyms of R. rubiginosa.
Prior to this study, no phylogenetic study of R. arabica was undertaken. The phylogenetic analyses of the genus Rosa did not include samples of this species [12,15,16,17].
The origin of endemism is an important evolutionary and taxonomic question. Is R. arabica a distinct species? Is it an infraspecific taxon of R. rubiginosa? What precisely are its origin, phylogenetic position, and route of evolution? The current study uses classical and cutting-edge taxonomic tools to answer these questions.

2. Materials and Methods

2.1. Plant Collection

The present study was based on fresh and dried herbarium materials. The fresh materials were collected from Mount Catherine (2629 m), Saint Catherine, South Sinai, Egypt. Herbarium materials were obtained from Egyptian herbaria: Suez Canal University (SCUI, Ismailia, Egypt), Sohag University (SHG, Sohag, Egypt), and Cairo University herbarium (CAI, Cairo, Egypt). The herbarium materials for non-Egyptian species were obtained from the Florida Museum of Natural History, University of Florida Herbarium (FLAS), Gainesville, FL, USA. Herbarium acronyms follow The Index Herbariorum [27].

2.2. Selected Specimens Examined

The following specimens were examined: Rosa arabica, Egypt, Southern Sinai, Wadi El-Arbaeen, Kahf El-Ghola: 28°32′49″ north (N), 33°56′93″ east (E), 1 May 2016, Ahmed EL-Banhawy & Ahmed Elkordy AEB#301, (SCUI s.n.); Wadi El-Arbaeen, Kahf El-Ghola, 18 June 2005, K. Abdelkhalik, (SHG s.n.); Wadi El-Arbaeen, (Encl. 3): 28°32′56.9″ N, 33°56′56.2″ E, Alt. 1650 m, 2 April 2004, K. Shaltout et al., (Herbarium of Elsalam Botanical Garden, Sharm Elsheikh, s.n.); Saint Catherine, April 1940, M. Hassib (CAI); Rosa eglanteria L. USA, Pennsylvania: 1.2 mi. E–NE of Pricetown, Berks County, dry soil in the field, W.C. Brumbach, 4283, 15 June 1950 (FLAS); New York: old field on South Hill near Ithaca, Tompkins Co11, October 1940, E.S. Ford #638 (FLAS); North Carolina: Orange County, University of North Carolina campus, cultivated, Chapel Hill, 9 July 1957, Max Newbery 236 (FALS); Rosa rubiginosa L. USA, Oregon: Clackamas County, one mile south of Canby, in open pasture, 12 June 1943 R. H. Belton,1943. (FLAS); Pennsylvania: Berks County, 1.2 mi, S.W. of Weavertown, dry soil along the highway, W. C. Brumbach 3745, 19 June 1944 (FLAS).

2.3. Systematic Treatment

Identification and Nomenclature

Examined specimens were identified according to the latest available literature, [18,19,20,22]. An image of several original specimens collected by W. Schimper in 1835 from Saint Catharine, South Sinai, Egypt, was downloaded from the internet repository of the Herbarium Hamburgense (Figure 1).
To assess the traits of the original specimen R. arabica, we studied the specimens collected in the loco classic. There is no certainty about the type specimen of this species due to the presence of several W. Schimper specimens, and nobody has assigned the type.
A survey of international floras, as well as 10 online databases, was conducted to evaluate the status of R. arabica nomenclature (Table 1).

2.4. DNA Extraction and PCR Amplification

Fresh leaf materials used for molecular analyses were collected and preserved in silica gel. DNA was extracted using the cetyltrimethylammonium bromide (CTAB) protocol with some modifications [28]. The PCR amplification was performed in 15 µL volume for ITS -Internal Transcribed Spacer-, matK, rbcL, and trnL-F containing 5 U/µL Taq DNA polymerase with 25 µM MgCl2, 10 µM dNTPs, and 10 µM of each primer. Amplifications were conducted using an Applied Biosystems®-Veriti™ 96-well thermal cycler (Thermo Fisher Scientific-Fisher Scientific AS-Postboks 114, Smestad-0309 Oslo–Norway). The thermal cycling program for amplification of the ITS region was as follows: 95 °C for 2 min, 34 cycles of 95 °C for 45 s, 58 °C for 45 s, and 72 °C for 90 s, and a final extension at 72 °C for 5 min; that for the matK region was as follows: 95 °C for 3 min, 40 cycles of 94 °C for 30 s, 49 °C for 1 min, and 72 °C for 1 min, and a final extension at 72 °C for 10 min; that for the rbcL region was as follows: 95 °C for 6 min, 30 cycles of 95 °C for 45 s, 48 °C for 45 s, and 72 °C for 90 s, and a final extension at 72 °C for 6 min; that for the trnL-F region was as follows: 95 °C for 5 min, 15 cycles of 95 °C for 45 s and 60 °C for 1 min, with an extension at 72 °C for 2 min, followed by 20 cycles of 95 °C for 45 s and 54 °C for 1 min, and a final extension at 72 °C for 2 min. The primers used in this study are shown in Table 2.

2.5. DNA Sequencing

PCR products were purified with ExoSAP-IT (USB Corporation, Cleveland, OH, USA) according to manufacturer recommendations. PCR products were sent to Macrogen Spain for direct sequencing in both directions with an ABI 3730XL Genetic Analyzer (Life Technologies Corporation, Carlsbad, CA, USA).
These novel DNA sequences of R. arabica were deposited in the GenBank under the following accession numbers: ITS, MT358870; matK, MT416573; rbcL, MT415957; trnL-F, MT427590.

2.6. Molecular Data Analysis

2.6.1. Molecular Identification

There is no general agreement for a single method that supports species discrimination using DNA sequence data. During this study, molecular identification and phylogenetic analysis were implemented using multiple approaches [43,44].

2.6.2. BLAST (Basic Local Alignment Search Tool) and Reference Datasets

A total of four markers (one nuclear and three plastid) were selected for this study; 39 ITS, 26 matK, 24 rbcL, and 16 trnL-F sequences of Rosa taxa were used in our study. Verified representative sequences of each taxon were tentatively identified using the BLASTN algorithm available on the NCBI –National Center for Biotechnology Information website. Additional sequences were obtained and included in the datasets. GenBank accession numbers and similarity matching percentage are presented in the Supplementary Materials (Table S1).
A reference sequence dataset was constructed, which consisted of sequences matching 92–99% in sequence similarity [45]. For the newly generated sequences, forward and reverse reads were assembled and edited into contigs in GENEIOUS® v.R9 (Biomatters Ltd., Berkeley, CA, USA, 94709-1405, https://www.geneious.com) using a personal license (C.A.). Four data matrices were constructed: ITS, matK, rbcL, and trnL-F. The ingroup was selected to cover most of the major sections in the genus Rosa. Datasets of each marker were initially aligned using ClustalW [46] or MAFFT algorithms [47], implemented in Geneious, using default alignment parameters.

2.6.3. Tree-Based Analysis

Analyses were run on the CIPRES portal [48]. The aligned DNA sequences for three chloroplast DNA (cpDNA) and one nuclear DNA (nrDNA) were used to construct four single markers and three combined datasets. The optimal nucleotide substitution model was estimated using MrModeltest [49] and executed in MrBayes blocks. Monte Carlo Markov chain (MCMC) was conducted using MrBayes 3.0b4 [50]. Four heated MCMC chains were run over 10 million generations, using general time reversible (GTR) plus gamma distribution substitution rates, random seed trees, and the default starting value for the nucleotide substitution model. Trees were sampled every 1000 generations, resulting in 20,001 trees. The first 25% “burn-in” trees were deleted from the analysis. A 50% majority role consensus tree was constructed to get the posterior probabilities (PP). For each analysis, two independent runs were executed using initial parameters. Posteriori probabilities >0.5 at a given branch were considered strong support for the existence of that branch [44,51,52].

3. Results

3.1. Taxonomic Identity of Rosa arabica

Shrubs and shoots were 0.5–1.5 m tall, erect or scrambling, terete, sparsely prickly, usually curved or hooked, with or without a stout base. Branchlets were dark brownish red, 5.0–10 mm in diameter, pubescent or glabrate. Prickles were dark brownish, stout, falcate up to 1.5 cm. Leaves were alternate, odd-pinnately compound, including petioles 0.5–1.2 × 0.2–0.3 cm. Stipules were 4–10 × 2–4 mm, apex acute, margin doubly serrate. Leaflets were 5–7 in number, broadly elliptic to elliptic obovate, 10–30 × 6–18 mm, abaxially green, sparsely pubescent with glandular trichome, adaxially green, glabrous, sparsely pubescent with glandular trichome, or slightly setose along midrib, apex acute, margin doubly glandular–serrate, base rounded. Flowers were solitary, 3.5–4.5 cm in diameter, pedicel ca. 10 mm long, setose–glandular trichome, as long as or longer than the fruit, bracts lanceolate, 8.0–12 × 2.0–5.0 mm, margins stipitate-glandular, glabrous, and eglandular surfaces. The hypanthium was globose, bright red, setose to sparsely glandular trichome. Sepals were five in number, reddish green, broadly lanceolate, 9–21 × 2.5–4.0 mm, abaxially setose–glandular trichome, adaxially densely tomentose, attenuate apex, margin lobed, pinnatifid, recurved, and persistent after anthesis. Petals were five in number, free, pink to deep rose, fragrant, obovate, 9.0–20 × 6.0–10 mm, entire margin, emarginate apex, and cuneate base. Stamens were numerous filaments, 3.0–5.0 mm. Styles were filiform, 4.0–6.0 mm long, exerted, slightly longer than stamens. Fruits were hip, usually ripe with bright red color, globose, 10–21 × 8.0–19 mm, sparsely setose glandular trichome, shiny. Achenes were ovoid to sub elliptic, trigonous, 3.5–4.0 × 2.5–3.0 mm, ventral side roof like with a longitudinal suture, acute apex, and mostly truncate base. Main differences with R. rubiginosa are listed in Table 3.
Flowering occurred from May to June, while fruiting occurred from June to July.
Its distribution is restricted to Egypt, Southern Sinai, Endemic.
Type: Rosa arabica Crépin. Herbarium Hamburgense. Bull. Soc. Roy. Bot. Belgique 8(2):344. 1869. Egypt, South Sinai, Saint Catharine, 1835, W. Schimper s.n. (HBG 511228) [53] (Figure 1).
To determine the current state of the name of R. arabica, we surveyed 10 electronic databases (Table 1). The results showed that there is some ambiguity in nomenclature and taxonomic status. The Plant List Database (TPL) retrieved the name R. arabica without its related taxonomic or nomenclature status. The World Flora Online (WFO) database considered R. arabica as an ambiguous name, while the Catalog of Life database showed R. arabica as an accepted name. Moreover, the Weeds of Australia retrieved R. arabica as a synonym for R. rubiginosa, while the name R. arabica is not recognized by the Tropicos database. The International Plant Name Index (IPNI), Plant of the World Online (PoWo), Global Biodiversity Information Facility (GBIF), Integrated Digitized Biocollections (IDigBio), and Open Tree of Life databases accepted the name R. arabica as a distinct species.

3.2. Molecular Identification Approach

For the first time, DNA sequences of ITS, matK, rbcL, and trnL-F markers were generated and used for molecular identification of R. arabica. Generally, the single markers ITS, matK, rbcL, and trnL-F succeeded in identifying the query sequence at the genus and species level and provided support to discriminate the species R. arabica (Table S2). The ITS and matK markers displayed the highest-level discriminatory power.

3.3. Phylogenetic Relationship

Bayesian inference (BI) of the four single markers ITS, matK, rbcL, and trnL-F, combined datasets ITS + matK and ITS + rbcL, and a concatenated dataset of all four markers was conducted.
The dataset of the single marker ITS (Figure 2), and the combined ITS + matK (Figure 3), retrieved two congruent phylogenetic trees. The ITS phylogenetic tree comprised 39 Rosa species, as well as two outgroup taxa: Rubus bifrons and Rubus odoratus. Despite some polytomies, a moderately resolved clade A consisted of 18 taxa. In clade A, R. primula and R. xanthine were sister groups. The subclade B “posterior probabilities (PP) = 0.6” comprised nine Rosa species including R. arabica (Figure 2).
All taxa under investigation belonged to the genus Rosa. The current study shows genus Rosa subdivided into 12 sections. Clade A includes six sections: section Caninae “eight taxa” section Synstaylae “six taxa” section Pimpinellifoliae “two taxa” and two more sections with a single taxon, section Rosa, and section Laevigatae (Figure 2).
The phylogenetic tree obtained from the combined dataset comprised 21 Rosa species and Rubus ulmifolius × R. caesius as an outgroup. Clade A was composed of 12 Rosa species. R. laevigata and R. roxburghii were sisters to subclade B. Subclade B (PP = 1) comprised 10 Rosa species including R. arabica. Most of the main clades were moderately to highly supported (0.7–1) (Figure 3).
Nei’s [54] distance analysis (Table S2) applied to the ITS marker between R. arabica and R. rubiginosa and R. canina was 96.25 and 81.93. In matK, the distance between R. arabica and R. canina and R. rubiginosa was 99.70 and 99.79. In rbcL, the distance between R. arabica and R. canina and R. rubiginosa was (97.45 and 97.97). In trnL-F, the divergence between R. arabica and R. canina and R. rubiginosa was 48.78 and 48.84.

4. Discussion

According to the IUCN – International Union for Conservation of Nature—criteria of plant conservation, the Saint Catherine wild rose R. arabica is considered to be one of the most critically endangered plant species in Egypt [21], which justified our interest in its phylogenetic placement.
Tomljenović and Pejić [55] reviewed the taxonomy of the genus Rosa. They discussed the efforts to classify and systematize roses from the 16th century until recently. They determined that species discrimination based on morphological characterization was very challenging over the last three centuries due to (1) few described species, (2) a low number of apparent morphological differences between closely related species, and (3) extensive hybridization and polyploidy. Tomljenović and Pejić [55] also suggested that modern tools of classification, such as molecular markers and phylogenetic analyses, as well as traditional morphological methods, would be of great help in clarifying the phylogenetic relationships within the genus Rosa.
The inability to retrieve the correct information for a particular plant species nomenclature status using taxonomic or biological databases might arise from the accumulation of outdated information (e.g., TPL has been static since 2013 but was used as the starting point for the Taxonomic Backbone of the WFO). We recommend that plant databases should be curated regularly with the findings of recent taxonomic and ecological studies incorporated. This is especially necessary where the plants concerned are rare and threatened, as is the case with R. arabica.
Although there is no certainty about the type specimen of the name R. arabica Crép., it was possible to study several specimens cited by [23] that are part of the original material; however, a more detailed and specific study is needed to confirm typification of the name.
Rosa arabica has never been the subject of extensive taxonomic or phylogenetic investigation. Even though the identification and nomenclature of R. arabica seem to be straight forward, they have represented a challenge even for some experts. Although R. arabica and R. rubiginosa have been treated as closely related based on their morphology, and many floras and databases treated R. arabica as a synonym of R. rubiginosa [6,7,8,23,24], several critical distinctive morphological traits differentiate R. arabica and R. rubiginosa. The most important diagnostic features for R. arabica are stout prickles, falcate up to 1.5 cm (falcate or curved in R. rubiginosa), leaflets shaped broadly elliptic to obovate (suborbicular in R. rubiginosa), the texture of the leaflet upper surface being glabrous, sparsely glandular, or slightly setose along midrib (glabrous or pubescent in R. rubiginosa), and the hypanthium texture being setose to sparsely glandular in R. arabica (glabrous or glandular–hispid in R. rubiginosa), Table 3.
By applying tree-based analysis, the query sequence was assigned to a species if clustered with sequences from their correct taxon with strong support value [44]. The current study recommends the use of ITS, matK, rbcL, and trnL-F as molecular marker candidates for identification of R. arabica.
Sectional classification of the genus Rosa was partially retrieved using analyses of a single dataset of DNA sequences of the nuclear marker ITS, as well as a combined dataset of DNA sequences of the chloroplast marker (ITS + matK). The genus Rosa is composed of 12 sections: Caninae, Synstaylae, Rosa, Chinensis, Laevigatae Pimpinellifoliae, Carolina, Cassiorhodon, Microphyllae, Indica, Minulifoliae, and Banksianae (Figure 2 and Figure 3). Although the sectional classification of the genus Rosa is beyond the scope of the current study, the sectional classification is congruent with previous studies [16]. The present study aimed to place R. arabica within its related section within the genus Rosa (s.l.). According to our Bayesian analysis of the DNA sequences of ITS and ITS + matK, R. arabica was placed within section Caninae (Figure 2 and Figure 3). Morphologically, section Caninae is characterized by pink or white flowers. R. arabica exhibits a range of intermediate morphological characters between R. canina and R. rubiginosa, especially in terms of the petal color; R. arabica shows pale to deep rose petals [56].
Distance analysis of DNA sequences represents another excellent tool to compare closely related species. Ussery [57] recommends using multi-locus data distance analysis instead of a single locus. In the current study, we carried out distance analysis using the ITS, matK, rbcL, and trnL-F data sequences to compare R. arabica and its closely related species within the section Caninae. The distance analyses indicated that R. arabica is much more closely related to those two species (Table S2). All members of section Caninae are distributed in Europe, North America, Asia, and North Africa [6].
According to [58], the Egyptian flora is a mix between South Mediterranean and East Asia. The Sinai Peninsula is the contact point between those two geographical routes. Thus, R. arabica might be a hybrid and, after having been isolated in its minimal distribution range, became a new species.

5. Conclusions

The result of our taxonomical and molecular study confirmed the identity of R. arabica. A better taxonomy and molecular distance comparison of this Rosa species group support the distinct identity of the Red-Listed R. arabica. The phylogenetic results allow redefining its position in the genus Rosa and its close relatives, as well as its accurate identification using the identity of molecular markers. The results show that R. arabica is a sister of R. canina and a relative of R. rubiginosa belonging to section Caninae. The use of two molecular markers (ITS and matK) can help provide insights into Rosa species-level taxonomy, and this may be essential in identifying the correct taxonomy or new species. This will be useful especially where morphology-based identification is difficult. The use of a molecular identification approach for Rosa revealed more accurate identification than classical morphologically based taxonomy. A better understanding of the taxonomy and the phylogenetic relationships in Rosa is fundamental toward the proposal of conservation strategies. We show that the use of the selected molecular markers represents a powerful tool in cases where correct identification is essential, e.g., for the recognition of critically endangered species that must be protected.

Supplementary Materials

The following are available online at https://www.mdpi.com/2075-1729/10/12/335/s1, Table S1. BLAST results for each marker (single locus) of tested samples. Database search match for similarities and phylogenetic relationships of ITS, matK, rbcL, and trnL-F sequences; Table S2. Matrix of pairwise divergences of ITS, matK, rbcL, and trnL-F for all samples studied.

Author Contributions

Conceptualization, A.E.-B.; methodology, A.E.-B. and C.A.; software, A.E.-B. and C.A.; formal analysis, A.E.-B., C.A., and A.E.; data curation, C.A. and A.E.-B.; investigation, A.E.-B., S.Q., and C.A.; resources, A.E.-B., S.Q., A.E., and C.A.; writing—original draft preparation, A.E.-B.; writing—review and editing, A.E.-B., C.A., A.E., and S.Q.; funding acquisition, A.E., C.A., and S.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funding by the Spanish Ministerio de Educación under the program “Campus de Excelencia Internacional CEI Triangular E3 (Grants 2017)”, which provided important financial support for the postdoctoral stay of Ahmed Elkordy at the University of León (Spain). The Research Team of the University of León 395 TaCoBi (Taxonomy and Biodiversity Conservation) partially supported the experimental study.

Acknowledgments

The authors would like to express thanks to Pamela Soltis and Douglas Soltis, Florida Museum of Natural History and Herbarium (FLAS), University of Florida, Gainesville, FL, USA. The authors would also like to thank the staff and institutions of the Herbaria consulted for helping us with the original materials, particularly Matthias Schultz (HBG), who provided permission to use the picture. They also extend the most profound gratitude to Stephanie Bird, Royal Horticulture Society (RHS), Wisely, UK, John Gaskin, Pest Management Research Unit, US Department of Agriculture, Sidney, Montana, and Felix Llamas, University of León for reading the manuscript and making valuable suggestions.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mabberley, D.J. The Plant-Book: A Portable Dictionary of the Vascular Plants; Cambridge University Press: Cambridge, UK, 1997. [Google Scholar]
  2. Heywood, V.H.D.; Moore, I.; Richardson, W.T.S. Flowering Plants of the World; Oxford University Press: Oxford, UK, 1993. [Google Scholar]
  3. Christenhusz, M.J.; Fay, M.F.; Chase, M.W. Plants of the World: An Illustrated Encyclopedia of Vascular Plants; University of Chicago Press: Chicago, IL, USA, 2017. [Google Scholar]
  4. Ku, T.; Robertson, K. Rosa (Rosaceae). Flora China 2003, 9, 339–381. [Google Scholar]
  5. Bisby, F.A.; Roskov, Y.; Orrell, T.M.; Nicolson, D.; Paglinawan, L.E.; Bailly, N.; Kirk, P.M.; Bourgoin, T.; Baillargeon, G.; Ouvrard, D. Species 2000 and ITIS Catalogue of Life; 2020-09-01 Beta; Species 2000: Leiden, The Netherlands, 2020. [Google Scholar]
  6. Wissemann, V. Conventional taxonomy of wild roses. S. 111–117. In Encyclopedia of Rose Science; Roberts, A., Debener, T., Gudin, S., Eds.; Academic Press: London, UK, 2003. [Google Scholar]
  7. Focke, W. Rosaceae en Engler u. Prantl. Die Nat. Pflanz. 1888, 3, 53. [Google Scholar]
  8. Rehder, A.; Dudley, T.R. Manual of Cultivated Trees and Shrubs Hardy in North America: Exclusive of the Subtropical and Warmer Temperate Regions; Macmillan: New York, NY, USA, 1940. [Google Scholar]
  9. Cockerell, T. Rosa stellata. Nature 1913, 90, 571. [Google Scholar] [CrossRef][Green Version]
  10. Bean, W.J. Trees and Shrubs Hardy in the British Isles; John Murray: London, UK, 1973; Volume 1. [Google Scholar]
  11. Wissemann, V.; Ritz, C.M. The genus Rosa (Rosoideae, Rosaceae) revisited: Molecular analysis of nrITS-1 and atp B-rbc L intergenic spacer (IGS) versus conventional taxonomy. Bot. J. Linn. Soc. 2005, 147, 275–290. [Google Scholar] [CrossRef]
  12. Fougère-Danezan, M.; Joly, S.; Bruneau, A.; Gao, X.-F.; Zhang, L. Phylogeny and biogeography of wild roses with specific attention to polyploids. Ann. Bot. 2014, 115, 275–291. [Google Scholar] [CrossRef]
  13. Zhu, Z.-M.; Gao, X.-F.; Fougère-Danezan, M. Phylogeny of Rosa sections Chinenses and Synstylae (Rosaceae) based on chloroplast and nuclear markers. Mol. Phylogen. Evol. 2015, 87, 50–64. [Google Scholar] [CrossRef]
  14. Liu, C.; Wang, G.; Wang, H.; Xia, T.; Zhang, S.; Wang, Q.; Fang, Y. Phylogenetic relationships in the genus Rosa revisited based on rpl16, trnL-F, and atpB-rbcL sequences. Hortscience 2015, 50, 1618–1624. [Google Scholar] [CrossRef]
  15. Erlanson, E.W. Phylogeny and polyploidy in Rosa. New Phytol. 1938, 37, 72–81. [Google Scholar] [CrossRef]
  16. Bruneau, A.; Starr, J.R.; Joly, S. Phylogenetic relationships in the Genus Rosa: New evidence from chloroplast DNA sequences and an appraisal of current knowledge. Syst. Bot. 2007, 32, 366–378. [Google Scholar] [CrossRef]
  17. Koopman, W.J.M.; Wissemann, V.; De Cock, K.; Van Huylenbroeck, J.; De Riek, J.; Sabatino, G.J.H.; Visser, D.; Vosman, B.; Ritz, C.M.; Maes, B.; et al. AFLP markers as a tool to reconstruct complex relationships: A case study in Rosa (Rosaceae). Am. J. Bot. 2008, 95, 353–366. [Google Scholar] [CrossRef]
  18. Tackholm, V.; Drar, M. Students’ Flora of Egypt; Cairo University: Cairo, Egypt, 1956. [Google Scholar]
  19. El-Hadidi, M. Materials from excursion flora of Egypt (EFE). Taeckholmia 1995, 15, 74–75. [Google Scholar]
  20. Boulos, L. Flora of Egypt; Al Hadara Publishing: Cairo, Egypt, 1999; Volume 1. [Google Scholar]
  21. Omar, K. Rosa Arabica; The IUCN Red List of Threatened Species: London, UK, 2017. [Google Scholar] [CrossRef]
  22. Klââterskÿ, I. Rosa, L. In Flora Europaea; Tutin, T., Heywood, V., Burges, N., Moore, D., Valentine, D., Walters, S., Eds.; Cambridge University Press: Cambridge, UK, 1981; pp. 25–32. [Google Scholar]
  23. Crépin, F. Primitiae Monographiae Rosarum: Matériaux Pour Servir à L’histoire des Roses; Imprimerie C. Annoot-Braeckman: Ghent, Belgium, 1869. [Google Scholar]
  24. Qiu, X.; Zhang, H.; Wang, Q.; Jian, H.; Yan, H.; Zhang, T.; Wang, J.; Tang, K. Phylogenetic relationships of wild roses in China based on nrDNA and matK data. Sci. Hortic. 2012, 140, 45–51. [Google Scholar] [CrossRef]
  25. Kalwij, J.M. Review of ‘The Plant List, a working list of all plant species’. J. Veg. Sci. 2012, 23, 998–1002. [Google Scholar] [CrossRef]
  26. De la Cruz, R. The usefulness of weed diversity in slash/mulch bean production: Difficulties in herbicide use. In Tapado Slash/Mulch: How Farmers Use It and What Researchers Know about It; Cornell International Institute for Food, Agriculture and Development: Brighton, UK, 1994; pp. 233–237. [Google Scholar]
  27. Thiers, B. Continuously Updated: Index Herbariorum: A Global Directory of Public Herbaria and Associated Staff. New York Botanical Garden’s Virtual Herbarium. Available online: http://sweetgum.nybg.org/science/ih/ (accessed on 7 May 2020).
  28. Doyle, J. DNA protocols for plants. In Molecular Techniques in Taxonomy; Springer: Berlin, Germany, 1991; pp. 283–293. [Google Scholar]
  29. The Plant List. 2013. Available online: http://www.theplantlist.org/ (accessed on 9 April 2020).
  30. The Online, Nomenclatural Database of the Missouri Botanical Garden. 2018. Available online: http://www.tropicos.org (accessed on 12 April 2020).
  31. Abderabbi, K.A.; Adda, H.; Benhassaini, O.M. Leaf morphological and anatomical traits variation of Artemisia herba-alba in a steppe zone of Algeria. Bulg. J. Agric. Sci. 2018, 24, 631–637. [Google Scholar]
  32. Integrated Digitized Biocollections. Available online: https://www.idigbio.org/portal/records/3f406bb6-d54d-443b-92ce-016166dace53#citation (accessed on 12 February 2020).
  33. Khan, A.S.; Ali, S.; Khan, I.A. Morphological and molecular characterization and evaluation of mango germplasm: An overview. Sci. Hortic. 2015, 194, 353–366. [Google Scholar] [CrossRef]
  34. Plant of the World Online. Available online: http://powo.science.kew.org/taxon/731621-1 (accessed on 16 February 2020).
  35. De Azeredo, R.M.A.; Mendes, M.A.; Joko, C.Y.; Delgado, M.N. Effect of expansion time and sunlight radiation on the functional and anatomical traits of mango tree leaves. Rev. Agrogeoambiental 2018, 9, 4. [Google Scholar] [CrossRef][Green Version]
  36. Catalogue of Life. Available online: http://www.catalogueoflife.org/col/search/all/key/Rosa+arabica/fossil/1/match/1 (accessed on 16 February 2020).
  37. WFO. World Flora Online. 2020. Available online: http://www.worldfloraonline.org/ (accessed on 8 December 2020).
  38. Torrecilla, P.; Catalán, P. Phylogeny of broad-leaved and fine-leaved Festuca lineages (Poaceae) based on nuclear ITS sequences. Syst. Bot. 2002, 27, 241–251. [Google Scholar]
  39. Douzery, E.J.P.; Pridgeon, A.M.; Kores, P.; Linder, H.P.; Kurzweil, H.; Chase, M.W. Molecular phylogenetics of Diseae (Orchidaceae): A contribution from nuclear ribosomal ITS sequences. Am. J. Bot. 1999, 86, 887–899. [Google Scholar] [CrossRef] [PubMed]
  40. Lee, H.L.; Yi, D.K.; Kim, J.S.; Kim, K.J. Development of plant DNA barcoding markers from the variable noncoding regions of chloroplast genome. In Proceedings of the International Barcode of Life Conference, Taipei, Taiwan, 16–21 September 2007. [Google Scholar]
  41. Wong, K.-L.; But, P.P.-H.; Shaw, P.-C. Evaluation of seven DNA barcodes for differentiating closely related medicinal Gentiana species and their adulterants. Chin. Med. 2013, 8, 16. [Google Scholar] [CrossRef] [PubMed]
  42. Taberlet, P.; Gielly, L.; Pautou, G.; Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 1991, 17, 1105–1109. [Google Scholar] [CrossRef]
  43. Gong, W.; Liu, Y.; Chen, J.; Hong, Y.; Kong, H. DNA barcodes identify Chinese medicinal plants and detect geographical patterns of Sinosenecio (Asteraceae). J. Syst. Evol. 2015, 54, 83–91. [Google Scholar] [CrossRef]
  44. Mao, Y.-R.; Zhang, Y.-H.; Nakamura, K.; Guan, B.-C.; Qiu, Y.-X. Developing DNA barcodes for species identification in Podophylloideae (Berberidaceae). J. Syst. Evol. 2014, 52, 487–499. [Google Scholar] [CrossRef]
  45. Larranaga, N.; Hormaza, J.I. DNA barcoding of perennial fruit tree species of agronomic interest in the genus Annona (Annonaceae). Front. Plant Sci. 2015, 6, 589. [Google Scholar] [CrossRef] [PubMed]
  46. Thompson, J.D.; Gibson, T.J.; Higgins, D.G. Multiple sequence alignment using ClustalW and ClustalX. Curr. Prot. Bioinfor. 2003, 1, 1–22. [Google Scholar] [CrossRef]
  47. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  48. Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010. [Google Scholar]
  49. Posada, D.; Crandall, K.A. Modeltest: Testing the model of DNA substitution. Bioinformatics 1998, 14, 817–818. [Google Scholar] [CrossRef]
  50. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
  51. Elias, M.; Joron, M.; Willmott, K.; Kaiser, V.; Silva-Brandão, K.; Freitas, A.; Mejia, C.A.; Pineres, L.; Brower, A.; Jiggins, C. Phylogenetic hypothesis, pattern of speciation and evolution of wing pattern in neotropical Napeogenes butterflies (Lepidoptera: Nymphalidae). J. Insect Sci. 2007, 7, 13–14. [Google Scholar]
  52. El-Banhawy, A.; Al-Juhani, W. DNA barcoding and phylogeny of Phlomis aurea (Lamiaceae) endemic to Sinai Peninsula, Egypt. Pak. J. Bot. 2019, 51, 1263–1271. [Google Scholar] [CrossRef]
  53. Herbarium Hamburgense. Available online: http://www.herbariumhamburgense.de/herbarsheets/disk_batch04/medium/HBG-511228.jpg (accessed on 10 May 2020).
  54. Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef]
  55. Tomljenovic, N.; Pejić, I. Taxonomic review of the genus Rosa. Agric. Consp. Sci. 2018, 83, 139–147. [Google Scholar]
  56. Shamso, E.; Sadek, A.; Hosni, H. Morphological and anatomical characteristics of endemic Rosa arabica (Rosoideae, Rosaceae) from Sinai, Egypt. Taeckholmia 2019, 39, 34–43. [Google Scholar] [CrossRef]
  57. Ussery, D. Encyclopedia of Genetics; Academic Press: New York, NY, USA, 2001. [Google Scholar]
  58. Faried, A.; El-Banhawy, A.; Elqahtani, M. Taxonomic, DNA barcoding and phylogenetic reassessment of the Egyptian Ephedra, L. (Ephedraceae). Int. J. Environ. Sci. 2018, 17, 1–13. [Google Scholar]
Figure 1. Type of R. arabica, collected by W. Schimper from Saint Catharine, South Sinai, Egypt, 19 May 1835, from the original collection, conserved in the Herbarium Hamburgense (HBG 511228). Available at Herbarium Hamburgense. Reproduced with permission.
Figure 1. Type of R. arabica, collected by W. Schimper from Saint Catharine, South Sinai, Egypt, 19 May 1835, from the original collection, conserved in the Herbarium Hamburgense (HBG 511228). Available at Herbarium Hamburgense. Reproduced with permission.
Life 10 00335 g001
Figure 2. Bayesian phylogenetic tree of ITS marker showing the relationships between R. arabica and representatives of most Rosa sections. Numbers above branches are posterior probability (PP) values >0.6. Accessions numbers of sequences retrieved from GenBank are detailed in Table S1 (Supplementary Materials). Clade A and Sub-Clade B defined in the text.
Figure 2. Bayesian phylogenetic tree of ITS marker showing the relationships between R. arabica and representatives of most Rosa sections. Numbers above branches are posterior probability (PP) values >0.6. Accessions numbers of sequences retrieved from GenBank are detailed in Table S1 (Supplementary Materials). Clade A and Sub-Clade B defined in the text.
Life 10 00335 g002
Figure 3. Bayesian phylogenetic tree of combined datasets of ITS + matk markers, showing the relationships between R. arabica and representatives of most Rosa sections and outgroups. Numbers above branches are PP values >0.5. Accessions numbers of sequences retrieved from GenBank are detailed in Table S1 (Supplementary Materials). Clade A and Sub-Clade B defined in the text.
Figure 3. Bayesian phylogenetic tree of combined datasets of ITS + matk markers, showing the relationships between R. arabica and representatives of most Rosa sections and outgroups. Numbers above branches are PP values >0.5. Accessions numbers of sequences retrieved from GenBank are detailed in Table S1 (Supplementary Materials). Clade A and Sub-Clade B defined in the text.
Life 10 00335 g003
Table 1. Nomenclature status and resolution of Rosa arabica according to modern biological databases.
Table 1. Nomenclature status and resolution of Rosa arabica according to modern biological databases.
QueryRetrieved NameName ResolutionSynonymTaxonomic StatusDatabase /Flora
R. arabicaR. arabica Crép.AcceptedNoneSpeciesIDigBio
R. arabica Crép.AcceptedR. rubiginosaSpeciesOpen Tree of Life
R. arabica Crép.AcceptedNoneSpeciesIPNI
R. arabica
(Crép. ex Boiss.) Déségl.
AcceptedNoneSpeciesPoWo
R. arabica Crép.AcceptedR. rubiginosa var. arabica (Crépin) Boiss.SpeciesCatalog of Life
R. arabicaSynonymR. arvensis Huds.SpeciesGBIF
R. rubiginosa L.SynonymR. arabica Crép.
R. eglanteria L.
SpeciesWeeds of Australia
R. arabica
(Crép. ex Boiss.) Déségl.
Not recognizedNot recognizedNot recognizedTropicos
R. arabica Crép.UnresolvedNoneUnresolvedTPL
R. arabica
(Crép. ex Boiss.) Déségl.
UnresolvedNoneUnresolved
R. arabica (Crép.)AmbiguousNoneAmbiguousWFO
TPL: The Plant List [29]; Tropicos: the online, nomenclatural database of the Missouri Botanical Garden [30]; GBIF: Global Biodiversity Information Facility [31]; IDigBio: Integrated Digitized Biocollections [32]; IPNI: International Plant Name Index [33]; PoWo: Plant of the World Online [34]; Open Tree of Life [35]; Catalog of Life [36]; Weeds of Australia [26]; WFO: World Flora Online [37].
Table 2. DNA primer sequences used in molecular analysis. F, forward; R, reverse.
Table 2. DNA primer sequences used in molecular analysis. F, forward; R, reverse.
RegionPrimer F/RPrimer Sequence (5′–3′)Reference
ITSKRCGCACGCGCGCTACACTGA[38]
AB102TAGAATTCCCCGGTTCGCTCGCCGTTAC[39]
matKK1RACCCAGTCCATCTGGAAATCTTGGTTC[40]
K3FCGTACAGTACTTTTGTGTTTACGAG
rbcLrbcL a-FATGTCACCACAAACAGAGACTAAAGC[41]
rbcL a-RGTAAAATCAAGTCCACCRCG
trnL(UAG)CTGCTTCCTAAGAGCAGCGT
trnT-trnLtrn-bTCTACCGATTTCGCCATATC [42]
trn-aCATTACAAATGCGATGCTCT
trnL (intron)trn-dGGGGATAGAGGGACTTGAAC
trn-cCGAAATCGGTAGACGCTACG
Table 3. List of morphological characters for R. arabica and R. rubiginosa.
Table 3. List of morphological characters for R. arabica and R. rubiginosa.
CharactersTaxa
R. arabica Crép.R. rubiginosa L.
HabitusErect or scramblingErect
Life formShrubShrub
Plant height0.5–1.5 m1.5–2 m
PricklesStout, falcate up to 1.5 cmFalcate or curved, sometimes mixed with acicles and glandular setae
Leaflets shapeBroadly elliptic obovateSuborbicular to broadly ovate to obovate
Leaflet No.5–75–7
Leaflets length10–30 mm10–25 mm
Leaflets width6–18 mm8–15 mm
Leaflets marginDoubly serrateCompound–serrate
Leaflet baseRoundedRounded
Leaflet upper surfaceGlabrous, sparsely glandular, or slightly setose along midtripGlabrous or pubescent
Leaflet lower surfaceSparsely glandularPubescent or densely glandular–viscid
Pedicels length10 mm10–15 mm
Pedicels surfaceSetose–glandularDensely stipitate or setose–glandular
Sepals natureRecurved, persistent after anthesisErect and persistent after anthesis
Sepals dorsal surfaceSetose–glandularGlandular
Sepals ventral surfaceDensely tomentoseGlandular
Hypanthium ShapeGloboseSub globose, ovoid or ellipsoid
Hypanthium surfaceSetose–sparsely glandularGlabrous or glandular–hispid
Hypanthium colorBright redBright red
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

EL-Banhawy, A.; Acedo, C.; Qari, S.; Elkordy, A. Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species. Life 2020, 10, 335. https://doi.org/10.3390/life10120335

AMA Style

EL-Banhawy A, Acedo C, Qari S, Elkordy A. Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species. Life. 2020; 10(12):335. https://doi.org/10.3390/life10120335

Chicago/Turabian Style

EL-Banhawy, Ahmed, Carmen Acedo, Sameer Qari, and Ahmed Elkordy. 2020. "Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species" Life 10, no. 12: 335. https://doi.org/10.3390/life10120335

APA Style

EL-Banhawy, A., Acedo, C., Qari, S., & Elkordy, A. (2020). Molecular Identification and Phylogenetic Placement of Rosa arabica Crép. (Rosaceae), a Critically Endangered Plant Species. Life, 10(12), 335. https://doi.org/10.3390/life10120335

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop