First Report of Antibiotic-Resistant Coagulase-Negative Staphylococcus Strains Isolated from Technical Snow on Ski Slopes in Mountain Areas
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Analysis
2.2. Isolation and Identification of Staphylococci
2.3. Culture-Based Antibiotic Resistance Determination
2.4. Detection of Antibiotic Resistance Genes
2.5. Statistical Analysis
3. Results and Discussion
3.1. Staphylococcal Counts
3.2. Staphylococcus spp. Species Prevalence
3.3. Antibiotic Resistance of Isolated CoNS
3.4. Genetic Determinants of Staphylococcal Resistance to MLSb Antibiotics
3.5. Resistance Rates Through the Technical Snow Production Cycle
3.6. Resistance Rates in Various River Catchments
4. Conclusions
- -
- Technical snow produced from microbiologically contaminated water may frequently contain coagulase-negative staphylococci (CoNS), since as many as 60% of technical snowmelt water samples proved positive for the presence of Staphylococcus spp.;
- -
- The CoNS counts in technical snowmelt water reached high values, in some cases exceeding those observed in water used for the production of technical snow. If maintenance and cleaning of snowmaking devices is conducted too rarely, staphylococi-containing water microbiota may form biofilms within the devices, resulting in increased concentrations of these microorganisms in technical snow;
- -
- Ten CoNS species were identified in the study, including opportunistic pathogens such as S. haemolyticus, S. warneri and S. lugdunensis. Among them, S. lugdunensis shares some clinical features with S. aureus, with several virulence factors already demonstrated, while S. warneri has been recently recognized as a new emerging pathogen responsible for severe invasive infections;
- -
- Resistance to the antibiotic erythromycin (macrolide) was the most frequent in all three types of samples—the same as the MLSb type of resistance—probably due to the fact that erythromycin is one of the “oldest” antibiotics used in medicine. This was coupled with the most frequent detection of msrA gene, which encodes the erythromycin efflux pump.
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Becker, K.; Both, A.; Weißelberg, S.; Heilmann, C.; Rohde, H. Emergence of Coagulase-Negative Staphylococci. Expert Rev. Anti-Infect. Ther. 2020, 18, 349–366. [Google Scholar] [CrossRef] [PubMed]
- Becker, K.; Heilmann, C.; Peters, G. Coagulase-Negative Staphylococci. Clin. Microbiol. Rev. 2014, 27, 870–926. [Google Scholar] [CrossRef] [PubMed]
- Faria, C.; Vaz-Moreira, I.; Serapicos, E.; Nunes, O.C.; Manaia, C.M. Antibiotic Resistance in Coagulase Negative Staphylococci Isolated from Wastewater and Drinking Water. Sci. Total Environ. 2009, 407, 3876–3882. [Google Scholar] [CrossRef] [PubMed]
- Santos, G.A.C.; Dropa, M.; Martone-Rocha, S.; Peternella, F.A.S.; Veiga, D.P.B.; Razzolini, M.T.P. Microbiological Monitoring of Coagulase-Negative Staphylococcus in Public Drinking Water Fountains: Pathogenicity Factors, Antimicrobial Resistance and Potential Health Risks. J. Water Health 2023, 21, 361–371. [Google Scholar] [CrossRef]
- Fowoyo, P.T.; Ogunbanwo, S.T. Antimicrobial Resistance in Coagulase-Negative Staphylococci from Nigerian Traditional Fermented Foods. Ann. Clin. Microbiol. Antimicrob. 2017, 16, 4. [Google Scholar] [CrossRef]
- Grünewald, T.; Wolfsperger, F. Water Losses During Technical Snow Production: Results From Field Experiments. Front. Earth Sci. 2019, 7, 435385. [Google Scholar] [CrossRef]
- Vanham, D.; Fleischhacker, E.; Rauch, W. Technical Note: Seasonality in Alpine Water Resources Management—A Regional Assessment. Hydrol. Earth Syst. Sci. 2008, 12, 91–100. [Google Scholar] [CrossRef]
- Kulik, K.; Lenart-Boroń, A.; Wyrzykowska, K. Impact of Antibiotic Pollution on the Bacterial Population within Surface Water with Special Focus on Mountain Rivers. Water 2023, 15, 975. [Google Scholar] [CrossRef]
- Stankiewicz, K.; Boroń, P.; Prajsnar, J.; Żelazny, M.; Heliasz, M.; Hunter, W.; Lenart-Boroń, A. Second Life of Water and Wastewater in the Context of Circular Economy—Do the Membrane Bioreactor Technology and Storage Reservoirs Make the Recycled Water Safe for Further Use? Sci. Total Environ. 2024, 921, 170995. [Google Scholar] [CrossRef]
- Hijazin, M.; Hassan, A.A.; Alber, J.; Lämmler, C.; Timke, M.; Kostrzewa, M.; Prenger-Berninghoff, E.; Zschöck, M. Evaluation of Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) for Species Identification of Bacteria of Genera Arcanobacterium and Trueperella. Vet. Microbiol. 2012, 157, 243–245. [Google Scholar] [CrossRef]
- Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic Susceptibility Testing by a Standardized Single Disk Method. Am. J. Clin. Pathol. 1966, 45, 493–496. [Google Scholar] [CrossRef] [PubMed]
- EUCAST European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. 2023, pp. 0–77. Available online: http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_5.0_Breakpoint_Table_01.pdf (accessed on 5 June 2023).
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
- Fiebelkorn, K.R.; Crawford, S.A.; McElmeel, M.L.; Jorgensen, J.H. Practical Disk Diffusion Method for Detection of Inducible Clindamycin Resistance in Staphylococcus aureus and Coagulase-Negative Staphylococci. J. Clin. Microbiol. 2003, 41, 4740–4744. [Google Scholar] [CrossRef] [PubMed]
- EUCAST. EUCAST_RefStaemme_Sollwerte; European Committee On Antimicrobial Susceptibility Testing: Basel, Switzerland, 2024. [Google Scholar]
- Geha, D.J.; Uhl, J.R.; Gustaferro, C.A.; Persing, D.H. Multiplex PCR for Identification of Methicillin-Resistant Staphylococci in the Clinical Laboratory. J. Clin. Microbiol. 1994, 32, 1768–1772. [Google Scholar] [CrossRef]
- Lina, G.; Quaglia, A.; Reverdy, M.E.; Leclercq, R.; Vandenesch, F.; Etienne, J. Distribution of Genes Encoding Resistance to Macrolides, Lincosamides, and Streptogramins among Staphylococci. Antimicrob. Agents Chemother. 1999, 43, 1062–1066. [Google Scholar] [CrossRef]
- Sutcliffe, J.; Grebe, T.; Tait-Kamradt, A.; Wondrack, L. Detection of Erythromycin-Resistant Determinants by PCR. Antimicrob. Agents Chemother. 1996, 40, 2562–2566. [Google Scholar] [CrossRef]
- Lenart-Boroń, A.; Prajsnar, J.; Boroń, P. Survival and Antibiotic Resistance of Bacteria in Artificial Snow Produced from Contaminated Water. Water Environ. Res. 2017, 89, 2059–2069. [Google Scholar] [CrossRef]
- Lenart-Boroń, A.; Boroń, P.; Kulik, K.; Prajsnar, J.; Żelazny, M.; Chmiel, M.J. Anthropogenic Pollution Gradient along a Mountain River Affects Bacterial Community Composition and Genera with Potential Pathogenic Species. Sci. Rep. 2022, 12, 18140. [Google Scholar] [CrossRef]
- Williams, M.M.; Domingo, J.W.S.; Meckes, M.C.; Kelty, C.A.; Rochon, H.S. Phylogenetic Diversity of Drinking Water Bacteria in a Distribution System Simulator. J. Appl. Microbiol. 2004, 96, 954–964. [Google Scholar] [CrossRef]
- Michels, R.; Last, K.; Becker, S.L.; Papan, C. Update on Coagulase-Negative Staphylococci—What the Clinician Should Know. Microorganisms 2021, 9, 830. [Google Scholar] [CrossRef]
- Kosecka-Strojek, M.; Wolska-Gębarzewska, M.; Podbielska-Kubera, A.; Samet, A.; Krawczyk, B.; Międzobrodzki, J.; Michalik, M. May Staphylococcus lugdunensis Be an Etiological Factor of Chronic Maxillary Sinuses Infection? Int. J. Mol. Sci. 2022, 23, 6450. [Google Scholar] [CrossRef] [PubMed]
- Ravaioli, S.; De Donno, A.; Bottau, G.; Campoccia, D.; Maso, A.; Dolzani, P.; Balaji, P.; Pegreffi, F.; Daglia, M.; Arciola, C.R. The Opportunistic Pathogen Staphylococcus warneri: Virulence and Antibiotic Resistance, Clinical Features, Association with Orthopedic Implants and Other Medical Devices, and a Glance at Industrial Applications. Antibiotics 2024, 13, 972. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Lu, Q.; Cheng, Y.; Wen, G.; Luo, Q.; Shao, H.; Zhang, T. High Concentration of Coagulase-Negative Staphylococci Carriage among Bioaerosols of Henhouses in Central China. BMC Microbiol. 2020, 20, 21. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Ripa, L.; Gómez, P.; Alonso, C.A.; Camacho, M.C.; Ramiro, Y.; de la Puente, J.; Fernández-Fernández, R.; Quevedo, M.Á.; Blanco, J.M.; Báguena, G.; et al. Frequency and Characterization of Antimicrobial Resistance and Virulence Genes of Coagulase-Negative Staphylococci from Wild Birds in Spain. Detection of Tst-Carrying S. sciuri Isolates. Microorganisms 2020, 8, 1317. [Google Scholar] [CrossRef]
- Nahaei, M.R.; Shahmohammadi, M.R.; Ebrahimi, S.; Milani, M. Detection of Methicillin-Resistant Coagulase-Negative Staphylococci and Surveillance of Antibacterial Resistance in a Multi-Center Study from Iran. Jundishapur J. Microbiol. 2015, 8, e19945. [Google Scholar] [CrossRef]
- Lenart-Boroń, A.; Wolny-Koładka, K.; Juraszek, K.; Kasprowicz, A. Phenotypic and Molecular Assessment of Antimicrobial Resistance Profile of Airborne Staphylococcus spp. Isolated from Flats in Kraków. Aerobiologia 2017, 33, 435–444. [Google Scholar] [CrossRef]
- Nor Amdan, N.A.; Shahrulzamri, N.A.; Hashim, R.; Mohamad Jamil, N. Understanding the Evolution of Macrolides Resistance: A Mini Review. J. Glob. Antimicrob. Resist. 2024, 38, 368–375. [Google Scholar] [CrossRef]
- Yeamans, S.; Gil-de-Miguel, Á.; Hernández-Barrera, V.; Carrasco-Garrido, P. Self-Medication among General Population in the European Union: Prevalence and Associated Factors. Eur. J. Epidemiol. 2024, 39, 977–990. [Google Scholar] [CrossRef]
- OECD. Fighting Antimicrobial Resistance in EU and EEA Countries; OECD: Paris, France, 2023. [Google Scholar]
- European Centre for Disease Prevention and Control. Antimicrobial Consumption in the EU/EEA (ESAC-Net)—Annual Epidemiological Report for 2022; European Centre for Disease Prevention and Control: Stockholm, Sweden, 2023; pp. 1–27. [Google Scholar]
- ECDC. Country Summaries—Antimicrobial Resistance in the EU/EEA 2022; European Centre for Disease Prevention and Control: Stockholm, Sweden, 2023. [Google Scholar]
- Stankiewicz, K.; Boroń, P.; Prajsnar, J.; Lenart-Boroń, A. Is our winter experience safe? Micropollutant risks for artificial snowing. Sci. Tot. Environ. 2024. submitted. [Google Scholar]
- Nava, A.R.; Daneshian, L.; Sarma, H. Antibiotic Resistant Genes in the Environment-Exploring Surveillance Methods and Sustainable Remediation Strategies of Antibiotics and ARGs. Environ. Res. 2022, 215, 114212. [Google Scholar] [CrossRef]
- Baloh, P.; Els, N.; David, R.O.; Larose, C.; Whitmore, K.; Sattler, B.; Grothe, H. Assessment of Artificial and Natural Transport Mechanisms of Ice Nucleating Particles in an Alpine Ski Resort in Obergurgl, Austria. Front. Microbiol. 2019, 10, 2278. [Google Scholar] [CrossRef]
Gene | Mode of Action | Primer Sequence (5′-3′) | Amplicon Size (bp) | Annealing Temperature (°C) | Reference |
---|---|---|---|---|---|
mecA | alternative penicillin-binding protein, PBP 2a | F: GTAGAAAATGACTGAACGTCCGATAA R: CCAATTCCACATTGTTTCGGTCTAA | 310 | 55 | [16] |
msrA | macrolide efflux protein | F: GGCACAATAAGAGTGTTTAAAGG R: AAGTTATATCATGAATAGATTGTCCTGTT | 940 | 50 | [17] |
ereA | macrolide lactone esterase | F: AACACCCTGAACCCAAGGGACG R: CTTCACATCCGGATTCGCTCGA | 420 | 57 | [18] |
mphA | macrolide-active phosphotransferase | F: AACTGTACGCACTTGC R: GGTACTCTTCGTTACC | 837 | 50 | [18] |
lnuA | lincosamide nucleotidyltransferase | F: GGTGGCTGGGGGGTAGATGTATTAACTGG R: GCTTCTTTTGAAATACATGGTATTTTTCGATC | 323 | 57 | [17] |
vga | ABC-F subfamily protein conferring resistance to streptogramin A | F: CCAGAACTGCTATTAGCAGATGAA R: AAGTTCGTTTCTCTTTTCGACG | 470 | 54 | [17] |
No. | Species | River Catchment * | Type of Sample ** | Antibiotic Resistance Phenotype *** | Antibiotic Resistance Genes |
---|---|---|---|---|---|
1 | S. epidermidis n = 10 | B (4), BD (0) R (0), W (0) S (6) | W (7) R (0) S (3) | FOX (1), E (8), DA (0), TE (0), CIP (2), SXT (1), CN (0), TOB (0), MSB (8), cMLSB (0), iMLSB (0), MDR (0) | mecA (7), msrA (8), ereA (0), mphA (0), lnuA (0), vga (0) |
2 | S. haemolyticus n = 13 | B (1), BD (3) R (8), W (1) S (0) | W (1) R (0) S (12) | FOX (2), E (11), DA (1), TE (7), CIP (1), SXT (0), CN (4), TOB (3), MSB (1), cMLSB (1), iMLSB (9), MDR (2) | mecA (1), msrA (6), ereA (0), mphA (0), lnuA (5), vga (3) |
3 | S. lugdunensis n = 2 | B (0), BD (1) R (1), W (0) S (0) | W (0) R (0) S (2) | FOX (0), E (1), DA (1), TE (0), CIP (0), SXT (0), CN (1), TOB (1), MSB (0), cMLSB (1), iMLSB (0), MDR (1) | mecA (0), msrA (1), ereA (0), mphA (0), lnuA (1), vga (1) |
4 | S. warneri n = 19 | B (2), BD (6) R (7), W (0) S (4) | W (6) R (3) S (10) | FOX (0), E (9), DA (1), TE (0), CIP (1), SXT (1), CN (0), TOB (1), MSB (7), cMLSB (0), iMLSB (0), MDR (0) | mecA (0), msrA (12), ereA (0), mphA (0), lnuA (0), vga (2) |
5 | S. pasteuri n = 4 | B (0), BD (3) R (0), W (1) S (0) | W (0) R (3) S (1) | FOX (0), E (3), DA (0), TE (1), CIP (0), SXT (0), CN (0), TOB (0), MSB (3), cMLSB (0), iMLSB (0), MDR (0) | mecA (0), msrA (1), ereA (0), mphA (0), lnuA (0), vga (0) |
6 | S. equorum n= 8 | B (0), BD (7) R (1), W (0) S (0) | W (5) R (2) S (1) | FOX (1), E (1), DA (0), TE (0), CIP (0), SXT (0), CN (0), TOB (0), MSB (1), cMLSB (0), iMLSB (0), MDR (0) | mecA (0), msrA (3), ereA (0), mphA (1), lnuA (0), vga (0) |
7 | S. xylosus n = 3 | B (0), BD (2) R (1), W (0) S (0) | W (2) R (0) S (1) | FOX (0), E (1), DA (0), TE (0), CIP (0), SXT (0), CN (0), TOB (0), MSB (0), cMLSB (0), iMLSB (1), MDR (0) | mecA (0), msrA (0), ereA (0), mphA (0), lnuA (0), vga (0) |
8 | S. hominis n = 1 | B (0), BD (1) R (0), W (0) S (0) | W (0) R (0) S (1) | FOX (0), E (1), DA (0), TE (0), CIP (0), SXT (0), CN (0), TOB (0), MSB (0), cMLSB (0), iMLSB (1), MDR (0) | mecA (0), msrA (0), ereA (0), mphA (0), lnuA (0), vga (0) |
9 | S. cohnii n = 2 | B (0), BD (0) R (1), W (0) S (1) | W (1) R (0) S (1) | FOX (0), E (1), DA (1), TE (0), CIP (0), SXT (0), CN (0), TOB (0), MSB (0), cMLSB (1), iMLSB (0), MDR (0) | mecA (1), msrA (2), ereA (0), mphA (0), lnuA (0), vga (1) |
10 | S. capitis n = 1 | B (0), BD (0) R (0), W (1) S (0) | W (0) R (0) S (1) | FOX (0), E (1), DA (0), TE (0), CIP (0), SXT (0), CN (0), TOB (0), MSB (1), cMLSB (0), iMLSB (0), MDR (0) | mecA (0), msrA (1), ereA (0), mphA (0), lnuA (0), vga (0) |
11 | Staphylococcus sp. n = 12 | B (8), BD (1) R (1), W (2) S (0) | W (3) R (0) S (9) | FOX (1), E (6), DA (0), TE (0), CIP (0), SXT (0), CN (0), TOB (1), MSB (6), cMLSB (0), iMLSB (0), MDR (0) | mecA (0), msrA (10), ereA (0), mphA (0), lnuA (1), vga (3) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stankiewicz, K.; Lenart-Boroń, A. First Report of Antibiotic-Resistant Coagulase-Negative Staphylococcus Strains Isolated from Technical Snow on Ski Slopes in Mountain Areas. Water 2025, 17, 185. https://doi.org/10.3390/w17020185
Stankiewicz K, Lenart-Boroń A. First Report of Antibiotic-Resistant Coagulase-Negative Staphylococcus Strains Isolated from Technical Snow on Ski Slopes in Mountain Areas. Water. 2025; 17(2):185. https://doi.org/10.3390/w17020185
Chicago/Turabian StyleStankiewicz, Klaudia, and Anna Lenart-Boroń. 2025. "First Report of Antibiotic-Resistant Coagulase-Negative Staphylococcus Strains Isolated from Technical Snow on Ski Slopes in Mountain Areas" Water 17, no. 2: 185. https://doi.org/10.3390/w17020185
APA StyleStankiewicz, K., & Lenart-Boroń, A. (2025). First Report of Antibiotic-Resistant Coagulase-Negative Staphylococcus Strains Isolated from Technical Snow on Ski Slopes in Mountain Areas. Water, 17(2), 185. https://doi.org/10.3390/w17020185