Next Article in Journal
Decapod Crustacean Larval Communities in the South Adriatic: Spring Composition, Horizontal and Vertical Distribution Patterns
Previous Article in Journal
Integrating Convolutional Attention and Encoder–Decoder Long Short-Term Memory for Enhanced Soil Moisture Prediction
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa

by
Mulalo Mudau
1,*,
Renay Ngobeni-Nyambi
2 and
Maggy Ndombo Benteke Momba
1,*
1
Department of Environmental, Water and Earth Sciences, Tshwane University of Technology, Arcadia Campus, Private Bag X680, Pretoria 0001, South Africa
2
Department of Microbiology, Stellenbosch University, Private Bag X1, Stellenbosch 7602, South Africa
*
Authors to whom correspondence should be addressed.
Water 2024, 16(23), 3477; https://doi.org/10.3390/w16233477
Submission received: 23 September 2024 / Revised: 26 November 2024 / Accepted: 1 December 2024 / Published: 3 December 2024
(This article belongs to the Section Urban Water Management)

Abstract

It is critical to attribute faecal contamination to its original source in order to assess public health risks and implement effective interventions to mitigate future contamination. This study aimed to identify the primary sources of faecal contamination in water using microbial source tracking markers in water-stressed rural communities. A total of 1128 water samples were collected sequentially from the main source (river/borehole) to the households. Six host-specific genetic markers were used to detect faecal contamination in the water samples (BacHum and HF183, BacCow, Pig-2-Bac, Cytb and BacCan). Of the 564 water samples tested during the wet season, 37.94% (n = 214) were positive for human and animal-specific Bacteroidales marker genes, while 31.73% (n = 179) of the 564 tested during the dry season were also positive. During the wet season, animal faecal contamination was more prevalent among the positive samples (Cytb: 20.56%, n = 44; BacCan: 19.16%, n = 41). By contrast, human-origin faecal contamination was dominant during the dry season (BacHum: 23.46%, n = 42; HF183: 21.23%, n = 38). Identifying the origin of faecal contamination will assist in implementing targeted intervention strategies for the effective prevention of pathogen transmission in water-stressed rural communities in order to protect public health.

1. Introduction

Water is a fundamental human need, yet for many, access to clean and safe water remains an ongoing challenge, especially in developing countries [1]. In 2022, 27% of the global population—about 2.2 billion people—lacked access to “safely managed drinking water”, which is water that is safe, accessible at home, and available when needed. Of these, 1.5 billion had only “basic” water service, meaning that water was sometimes unsafe or not available at home. Additionally, 703 million had no basic water service at all, with 292 million needing to walk over 30 min for water, 296 million using unprotected sources, and 115 million relying on untreated surface water. These statistics highlight significant inequalities, particularly affecting the poorest and rural communities [2,3]. Public health is greatly endangered by the absence of access to clean drinking water and poor sanitation, mainly for the elderly, young children, and immunocompromised people. As a result, about 1 million people die from diseases related to water, sanitation and hygiene yearly [4]. The provision of adequate and potable drinking water and proper sanitation facilities can, therefore, be used as one of the strategies to eliminate or reduce the occurrence of waterborne diseases and alternatively reduce the number of deaths related to these diseases. It is also crucial to focus on the origin of microbial contamination of water sources, and develop strategies that aim at eradicating these sources of contamination, while prioritising the supply of adequate safe and clean water for all.
Reports have pointed out that both human and animal faecal matter introduce various harmful pathogens, including bacteria, protozoa and viruses [5,6]. Faecal indicator bacteria (FIB) are commonly used to detect faecal pollution; however, they are not always reliable indicators of the presence of pathogenic microorganisms or their concentration, as they may not correlate with specific pathogens that pose health risks, being present in the faeces of all warm-blooded animals [7]. These pathogens are adaptable and capable of surviving and multiplying both inside and outside their hosts, and they can thrive under diverse environmental and temporal conditions [6]. They also demonstrate a remarkable ability to endure a range of geographic and seasonal variations.
While faecal indicator bacteria provide a level of public health protection, in order to develop mitigation strategies for faecal contamination or to eradicate future contamination, it is crucial to identify the source of contamination [8]. By the end of the 20th century, numerous techniques had been developed to identify various sources of faecal contamination in environmental waters, among these microbial source tracking (MST) methods. Members of the order Bacteroidales are frequently used for MST. Although the species composition of the Bacteroidales population varies significantly, their prevalence in mammalian intestinal systems has been documented, making them suitable as markers of both human and animal faecal pollution [9]. Bacteroides spp. are obligate anaerobic microorganisms with significant host specificities that are prevalent in the gastrointestinal tract of warm-blooded animals, both humans and animals [8]. However, unlike FIB, Bacteroides spp. have limited survival capabilities in the environment as they are obligate anaerobic microorganisms [10]. Thus, these species have been established as indicators for identifying sources of faecal contamination since they are common among warm-blooded animals and exhibit host-dependent species diversity [9].
The primary objective of this study was to identify the sources of faecal contamination in water-stressed communities of the Vhembe District Municipality (VDM). For this study, MST was used to detect and identify predominant faecal contamination sources in water-stressed rural communities of the Vhembe District Municipality of the Limpopo Province in South Africa, by targeting the 16s rRNA genes of host-specific Bacteriodales associated with humans, chickens, pigs, dogs, and cows using real-time PCR, also known as quantitative PCR (qPCR).

2. Methodology

2.1. Ethical Clearance, Informed Consent and Criteria for Study Site Selection

The current study was conducted in rural areas of the Vhembe District Municipality (VDM) after obtaining the required ethics clearance from the Faculty Committee for Research Ethics (FCRE) at Tshwane University of Technology, where the study was registered. Prior to conducting the field study, further permission was granted by the VDM and community leaders after the presentation of the study aim and objectives. After receiving the necessary permissions, a frank collaboration was established between the research team and municipal water and sanitation officials of the VDM.
A site survey was conducted across the different villages of the VDM to identify water-stressed villages and locate the sampling points. In the context of this research, water-stressed villages are defined as communities that do not have sufficient water sources to meet the standard demand for water. This encompasses factors such as consistent water availability and compliance with South African guidelines for water quality [5]. Furthermore, the term “water stress” is used to describe a situation where a country or region has an annual water supply that falls below 1700 cubic metres per person per year. When the per capita water supply ranges from 1700 to 1000 cubic metres per year, it may result in periodic or limited water shortages. For this purpose, a structured questionnaire was used to identify different water sources used across various villages, the type of sanitation facilities used in the households, the type of animals owned in the households, the animals that are frequently spotted around the water sources, the hygiene practices of the study population and their wellbeing [5]. Randomly selected households were given informed consent forms to sign for their participation in the study.

2.2. Study Site and Population Description

The VDM is located in the northern part of the Limpopo Province in South Africa and has a population of around 1,393,948 people and a land area of 27,969,148 km2 [5]. The district is bordered by the province’s eastern and western districts, Mopani and Capricorn, respectively. The current study was carried out in five randomly selected villages (Lambani, Tshifudi, Njhakanjhaka, Makuleke and Gandlanani), in three local municipalities (Thulamela, Makhado and Collins Chabane) within the district that appeared to be water-stressed. Four of the villages are reliant on municipal water, defined as piped water delivered via water treatment plants to yard taps or communal faucets. The other village used borehole water as their primary source of water supply (Njhakanjhaka). Despite most receiving water from municipal treatment plants, the villages often experience prolonged periods without any water supply to their taps, forcing residents to store water in containers for extended periods.
The water treatment plants that serve the majority of the communities draw raw water from the Luvuvhu River. Activities along the river vary based on which village it flows through. Pouring bricks, washing clothing, bathing, grazing animals, and swimming are common activities on the section of the river connected to the villages under consideration for this study. Some of these activities are regarded to be the origins of faeces in the water.

2.3. Sample Collection

Figure 1 depicts the water sampling sites and their geographical locations. Water samples were only collected from villages that experienced challenges regarding their water demand, also called water-stressed villages. Using 1-L sterile sampling bottles, samples were collected from selected villages between March and August 2021, with each site visited eight times—four times during the dry season and four during the wet season. In total, 1128 water samples were collected across five communities. Sampling was performed according to established methods, including those outlined by APHA (2001) [11].
In four of these villages, the main water source was a river, with each village being supplied by a different water treatment plant. Water samples were collected sequentially along the supply chain to pinpoint contamination sources. Sampling began at the main source (river) and included additional samples from each village’s treatment plant, both pre-treatment and post-treatment. After treatment, samples were taken from household taps and finally from household storage containers. In the fifth village, water was sourced from a borehole, and samples were similarly collected from the borehole tap, household taps, and household storage. Sequential water sampling was conducted from the primary water source to the point of use at households. It is important to note that the drinking water treatment plants supplying the selected sampling sites used liquid sodium hypochlorite as their main disinfectant; when there was a shortage of sodium hypochlorite they alternatively used chlorine granules. Chlorinated water samples were collected in 1 L sterile bottles containing 120 mg of sodium thiosulphate (Na2S2O3) to neutralize the residual chlorine in the water [11]. After collection, all samples were transported to the Tshwane University of Technology’s water research laboratory in cooler boxes with ice (4 °C) to maintain sample integrity.

2.4. Sample Preparation by Membrane Filtration and DNA Extraction

All water distribution system samples (500 mL) were filtered within 24 h of collection using a vacuum manifold through specific filters (0.22 µm mixed cellulose ester with a diameter of 47 mm) (Merck Millipore, Billerica, MA, USA; Merck SA). In the case of river water samples, 2 L of water was filtered through a 0.45 µm mixed cellulose ester membrane with a diameter of 90 mm (Merck Millipore) as described by Haramoto and Osado [12]. To rule out cross-contamination of samples during processing, sterile deionised water was filtered (filter blank) alongside the samples (once per every five samples). The filter sheets were then rolled and inserted into a tube containing 5 mL PBS (phosphate-buffered saline). Each PBS tube received a drop of Tween® 20 and was vortexed to dislodge anything in the filter paper. The sample filters were centrifuged at 15,000 rpm for 10 min. Thereafter, the supernatant was discarded and 1 ml of PBS was added to the pellet to obtain a concentrated sample. DNA was extracted from the resultant pellet using the Zymo Research DNA isolation kit (Quick-DNA™ Faecal/Soil Microbe Miniprep Kit) according to the manufacturer’s instructions. To rule out contamination, extraction blanks (sample without analyte) were employed as negative controls during DNA extraction in each extraction batch. The resultant genomic DNA was stored in a freezer at −20 °C until further use.

2.5. Determination of the Best-Performing Assays for Microbial Source Tracking (MST) Markers

Using real-time PCR, the best-performing host-specific Bacteroidales qPCR assays were selected based on qualitative characteristics drawing on data from previously published assays [13,14], i.e., the sensitivity (the ability to recognise the target when it is present), specificity (the ability to rule out the target when absent), and accuracy of MST targets. It should be noted that when assessing the specificity of a marker, it is usually performed by examining faecal or sewage samples from animals that are not the intended host, while the sensitivity of a marker is generally defined as the proportion of samples that are known to be positive (i.e., positive control) and are correctly identified as true positives (non-target hosts).
The top-performing assays were selected using widely available DNA taken from faecal samples of people and target animals. The stool sample DNA was acquired from DNA held at the laboratory that had already been utilised in another study [5]. Three human-associated genetic markers (BacHum, HF183 and GyrB) were validated and tested for performance, as were two cow-associated (bovine-associated) markers (BacCow and BacR), two pig-associated markers (Pig-2-Bac and PF163), one chicken-associated marker (Cytb), and one dog-associated marker (BacCan). Table 1 depicts primers and probes used for the selection of the best-performing assays. The top-performing assays (highest accuracy values) were selected from the above examined markers and used to identify the major sources of faecal pollution in water.

2.6. Detection of Faecal Pollution from Source Samples and Water Utilized in the Communities Using Microbial Genetic Markers

The six best-performing Bacteroidales human marker genes and animal marker genes were used to track the source of faecal contamination to water used by the target villages. These included two human-specific assays (BacHum and HF183 assays), one cow-specific assay (BacCow), one chicken-specific assay (Cytb), one dog-specific assay (BacCan) and one pig-specific assay (Pig-2-Bac) [12,20,21]. Quantitative PCR (qPCR) was performed using the CFX96 Touch Real-Time PCR Detection System combined with the C1000™ Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA). The names and sequences of the primers, probes and cycling conditions of the host-specific assays that were used for qPCR are listed in Table 1. A reaction mixture (20 µL) containing 10 µL of power mix, 0.8 µL of each primer (forward and reverse), 0.4 µL of the probe, 6 µL of nuclease-free water and 2 µL of the DNA template was used. The thermal cycling conditions for each assay were 30 s at 95 °C, followed by 45 cycles of 5 s at 95 °C and 30 s at 60 °C.
The qPCR standard curves were created by preparing tenfold serial dilutions of the plasmid DNA containing the target sequences, while PCR-grade water was utilized as the negative control. A negative control was included in each run to rule out the cross-contamination of samples. The lowest cycle threshold (Ct) value obtained from the serially diluted samples was regarded as the limit of quantification and a cut-off value for each assay was determined by the highest Ct value obtained during the optimisation run.

2.7. Statistical Analysis

Data were subjected to analysis using Statistical Package for the Social Sciences (IBM SPSS Statistics 20) and Microsoft Excel 2010. To select the optimal host-specific assay, sensitivity, specificity and accuracy, the computation was carried out across assays and the results were compared. The paired sample t-test was utilized to compare concentrations across assays targeting the same host. The results were reported to be statistically significant if the p value was ≤0.05.

3. Results

3.1. Determination of Best-Perfoming Assays for Microbial Source Tracking Markers

It has been documented that the performance (sensitivity and specificity) of host-specific markers may vary geographically [10,22]. Consequently, the performance of the host-specific genetic markers in the target region was determined as can be seen in Table 2 and Table 3 below. Human-specific Bacteroidales assays (BacHum, HF183 and GyrB) were tested for specificity, sensitivity and accuracy. Of the three assays tested, BacHum was the only assay that amplified the target gene in all of the 10 samples tested; HF183 and GyrB amplified the target gene in eight and six samples, respectively. The specificities of BacHum, HF183 and GyrB were in the range of 97%, 86% and 52%, respectively. All the tested human markers showed a cross-reactivity with the dog marker BacCan; BacHum exhibited 12.5%, HF183 38% and GyrB 50%. The human markers were selected based on their accuracy, which ranged from 98% (BacHum) and 85% (HF183) to 67% (GyrB). The BacHum and HF183 markers were, therefore, selected as the best-performing human markers. The specificity of the selected assays was above 85% and the sensitivity ranged from 80% to 100%. The results are summarised in Table 2.
The performance of animal-specific molecular markers was examined to screen for sources of faecal pollution other than human in water. Two ruminant markers (BacCow and BacR), two pig markers (Pig-2-Bac and PF163), one chicken marker (Cytb) and one dog marker (BacCan) were tested for their effectiveness. Among the ruminant markers, BacCow demonstrated the highest performance, with a specificity of 92%, a sensitivity of 100% and an overall accuracy of 98%. Additionally, BacCow showed no cross-reactivity with other tests, making it the most reliable ruminant-specific marker. For pig-specific markers, Pig-2-Bac was selected as the top performer, achieving a specificity of 100%, a sensitivity of 71% and an overall accuracy of 94%. It also exhibited no cross-reactivity with other assays, making it the most accurate pig-specific marker compared to the others tested. Single assays for both chicken- and dog-specific markers were evaluated, showing 95% specificity and 93% accuracy for Cytb, and 25% cross-reactivity with the dog marker. The dog marker BacCan demonstrated 97% specificity and 93% accuracy. This marker also showed 8% cross-reactivity with the cow marker. As a result, BacHum, HF183, BacCow, Pig-2-Bac, Cytb and BacCan were selected as the top-performing markers for the purpose of this study; thus, they were used to track the sources of faecal contamination in water sources used by the target villages. The results are shown in Table 2 and Table 3.

3.2. Amplification Efficiency and the Limit of Detection of Each Assay

The lower limit of quantification (LLOQ), limit of detection (LOD), cut-off value, and amplification efficiency of each assay were determined using a standard curve. The slope of the standard curve, shown in Figure 2, was used to estimate the amplification efficiency (E) using the equation below previously reported by Harwood and colleagues [23]:
E = [10(−1/slope)] − 1
The amplification efficiency of the MST assays selected for the purpose of this study ranged from 85% to 94% as recorded in Table 4. The lowest concentration of the standard copies of the genes from all the samples tested was considered as the LLOQ. The LLOQ is the lowest amount of an analyte in a sample that can be quantitatively determined with suitable precision and accuracy. The LOD was obtained by converting the LLOQ to the nearest decimal. The y-intercept in the standard curve of each assay was considered as the cut-off value. The LOD values of all the tested assays were 26.17 and 31.65, while the cut-off values of the assays were 37.88 and 39.94. Based on the tested water samples, all the data falling within these ranges were considered positive, and those outside these ranges were regarded as negative. The number of copies for each gene obtained from the samples was calculated using Equation (2) [23]:
Quantity = 10(cqb)/m)
where cq is the average Ct value, b is the y-intercept of the standard curve, and m is the slope. Final results for the standard curve parameters are presented in Table 4.

3.3. The Prevalence of Sources of Faecal Contamination in Water

Real-time PCR for the six selected MST markers was utilised to detect the primary sources of faecal contamination in water sources used by different households for multiple purposes. Figure 2 and Figure 3 demonstrate the incidence of faecal pollution sources by season (wet vs. dry) in the study villages. From a total of 1128 samples collected across both seasons, 564 samples were examined during the wet season, of which 214 (37.94%) were positive for at least one of the six tested markers. Similarly, 564 samples were analyzed during the dry season, with 179 (31.73%) testing positive for at least one of the markers. A moderate negative correlation (r = −0.45) was observed between the occurrence of the tested host-specific markers. In addition, no link was established between the occurrence of marker averages between the dry and rainy seasons, according to the two-sample t-test statistic (p = 0.98).
The most frequently detected markers during the wet season were associated with chickens (Cytb) and dogs (BacCan), found in 44 (20.56%) and 41 (19.16%) samples, respectively. These were followed by the human (HF183) and ruminant (cows; BacCow) markers, detected in 35 samples (16.36%) each, followed by markers for pigs (Pig-2-Bac) in 31 samples (14.49%) and humans (BacHum) detected in 28 samples (13.08%). In the dry season, BacHum and HF183 were the most commonly observed markers, detected in 42 (23.46%) and 38 (21.23%) samples, respectively, followed by BacCow and Pig-2-Bac in 25 (13.97%) and 22 (12.29%) samples, respectively.
Further analysis was conducted to assess the frequency of markers across different villages during both seasons. Figure 3A,B present the prevalence of various sources of contamination in each village by season. The highest overall prevalence in the wet season was observed in Gandlanani village (46.42%), followed by Tshifudi (40.63%), Lambani (36.45%), Makuleke (29.03%) and Njhakanjhaka (13.09%). During the dry season, Tshifudi exhibited the highest prevalence (64.58%), followed by Gandlanani (35.72%), Lambani (27.08%), Makuleke (25.80%) and Njhakanjhaka (7.14%). Although a strong positive correlation (r = 0.79) was found between the occurrence of different contamination sources across villages, the result was statistically insignificant (p = 0.86).
Figure 3B shows the overall occurrence of MST markers by village. In Tshifudi, the most frequently detected markers were BacHum, BacCow and HF183, with a higher prevalence in the dry season (62.5%, 58.33% and 54.16%, respectively). In Lambani, the prevalence of HF183 and BacHum was also higher during the dry season, while in the wet season, contamination sources were most commonly linked to dogs and chickens, each showing a prevalence of 33.33%. At Gandlanani, cows were the most frequent contamination source (42.85%), while at Makuleke, chickens were the dominant contamination source (29.03%). Njhakanjhaka exhibited the lowest prevalence of MST markers, although chickens were still the most common (19.04%).

3.4. The Prevalence of Different Sources of Contamination in Water Sources During the Wet and Dry Seasons

The occurrence of MST markers was also evaluated in household water during both the wet and dry seasons (Table 5). In household storage containers and taps, chicken markers (Cytb, 23.91%) and dog markers (BacCan, 22.28%) were detected most frequently during the wet season, while human markers were most prevalent during the dry season, with BacHum occurring at 23.94% and HF183 at 21.83%. In river water samples, human (HF183) and cow markers (BacCow) were most prevalent during the wet season, at 43.75% and at 31.25%, respectively, while the cow marker (35.71%) was detected most frequently during the dry season. No markers were identified in the treated water samples from the water treatment plants. However, in the pre-treatment samples, the two human markers, BacHum and HF183, were the most prevalent during the wet season, each at 35.71%. During the dry season, the cow marker (BacCow) was detected most frequently, with a prevalence of 31.25%.

4. Discussion

In many parts of the world, water-related diseases are prevented and controlled in large part through sanitation and improved water supplies. However, many people living in rural areas have to rely on unimproved water sources due to a lack of access to treated drinking water and sanitation facilities, resulting in human health risks and economic costs. A majority of villages in the Vhembe District Municipality (VDM) lack access to safe and clean water, with a sizable portion of the population still relying on open defecation. The necessity of identifying the source of faecal contamination in water stems from the need to create strategies for controlling faecal contamination in water. In order to successfully manage faecal pollution in water and reduce the risk of waterborne infections, MST methods have been used [24]. The objective of this study was to identify the most prevalent faecal pollution sources in water-stressed rural communities of the Vhembe District Municipality using human-specific and animal MST markers.
Previous studies have pointed out that water supplies in low-income countries are commonly contaminated with both human and animal faeces due to poor sanitation standards and improper animal waste management practices [20,25]. This corroborates findings obtained in the rural communities of VDM during the study period. Extensive human activities were observed near water sources in the VDM, as well as a diversity of animals in and around households and water supplies. These might be related to the faecal contamination of the targeted water sources. Therefore, host-specific markers were used to ascertain the tangible sources of the contamination of water sources commonly used by VDM. Although the assays used in the present study had been validated in previous studies, the discrepancies in results conducted in different geographical regions using comparable assays revealed that the performance of MST assays can vary with geographic region [12,15,16,17,18,19]. As a result, it is critical to confirm assays before using them for MST in a new geographic region [26,27]. To the best of our knowledge, these host-specific markers have never been validated in the VDM, making it difficult to select the optimal assays. It was, therefore, critical to validate the use of these markers.
Three human markers (BacHum, HF183 and GyrB) were tested, and BacHum and HF183 were selected as the top-performing human-specific assays because they outperformed GyrB in terms of specificity, sensitivity and accuracy (Table 2). According to US EPA (2005) guidelines, a marker for MST is only considered credible when its specificity is over 80%, with the highest being 100% [28]. The specificities of BacHum and HF183 were 97% and 86%, respectively, and the sensitivity was found to be above 80%. The results of the present investigation are consistent with those published by Gawler and colleagues [10], who found that HF183 had excellent specificity (91–100%) and sensitivity (80–100%), and that it was a credible diagnostic of human faecal contamination. In a study by Malla and colleagues [29], it was also reported that the sensitivity of BacHum and HF183 was very high when compared to GyrB. Cross-reactivity between all of the human markers and the dog markers was observed, but BacHum and HF183 had a lower cross-reactivity (12.5% and 38%, respectively) than GyrB (50%). Human marker HF183 also had a low cross-reactivity with cow markers (17%). In a study by Malla and Haramoto [30], BacHum was also found to cross-react with dog markers. Due to their high sensitivity and specificity, BacHum and HF183 are generally utilised as the best-performing human markers in various regions, in contrast to GyrB [31].
Additionally, the performance of ruminant-specific markers was evaluated using two assays (BacCow and BacR). In this study, BacCow was selected as the best-performing marker for this investigation because it outperformed BacR in terms of specificity, sensitivity and accuracy (Table 3). The findings of the current study indicate that geographic differences indeed exist in the specificity of host-specific markers. According to studies by Gawler et al. and Malla et al. [11,20], BacR was more sensitive and specific than BacCow, and it was therefore deemed appropriate. However, a study by Haramoto and Osada [11] backs up the findings of the present investigation; it indicated that the BacCow marker was more sensitive than the BacR marker. In addition, compared to PF163, Pig-2-Bac was selected as the best host-specific pig marker. Pig-2-Bac was deemed to be the best-performing pig-specific assay in studies conducted by previous investigators [13,30], who validated these findings with their analysis, and showed that Pig-2-Bac was more sensitive, specific and accurate than PF163. Due to the specificity, sensitivity and accuracy of the BacCan and Cytb assays, they were identified as the top performers in the current investigation; furthermore, their specificity was above 80%, making them creditable MST markers.
Following the validation of the host-specific markers, six assays were selected as the best performers and employed in this study to identify the major sources of faecal contamination in water. The data revealed that 31.73% of the samples tested positive for one or more sources of contamination during the dry season and 37.94% of the water samples tested positive during the wet season. However, with a p-value of 0.98 (Figure 2), the seasonal fluctuation in the occurrence of the various sources of contamination in water was not statistically significant. A variation in the frequency of contamination was observed; however, the seasonal fluctuation was also insignificant. In the current study, all of the host-specific MST markers were detected in more than 10% of the water samples tested, indicating faecal contamination from various sources. As seen in the literature, an incidence rate of more than 10% indicates that the markers are widely distributed throughout the area [32].
Faecal contamination in water can occur from a number of sources and manifest in a variety of ways. Human-specific markers were found to be more frequent in water samples collected during the dry season (Figure 2). These findings are congruent with the study results of previous investigators [28,33,34]. During the rainy season, human activities are reduced near water sources because people use rainwater as an alternative source during this season, although water pollution by faeces can also occur in dwellings. Some households expose their water to a variety of contaminants by leaving their storage containers uncovered. Furthermore, water can be contaminated in homes by employing containers with big openings to store or collect water, transferring water from collecting vessels to storage vessels, and drawing water from storage vessels for drinking or other domestic needs. According to a study by Clasen and Bastable [35], dipping a hand-held utensil in water vessels contributes to faecal contamination when compared to utilising a tap or pouring the water into another container. The survival of bacteria following water contamination is dependent on the type of vessel and the length of time that the water is stored before consumption [33]. The findings of the current study clearly show that while water treatment plant processes are effective in achieving drinking water quality compliance, there is a need to extend water quality from the distribution system to the point of use. Furthermore, faecal contamination from cows, pigs, chickens and dogs was found to be more abundant during the wet season (Figure 3B). The presence of animal faeces in water during the rainy season is a sign that storm water runoff after rainfall events considerably contributes to faecal pollution in water [28,36].
Each village was found to have a unique distribution of markers, and certain sources of contamination were more prevalent than others (Figure 3A). This could be due to the different activities and hygiene standards observed in each community. BacHum, BacCow and HF183 were the most frequently detected host-specific markers in Tshifudi village (Figure 3A). Cows were detected near water sources in over 80% of the villages in the VDM [6], which explains why the cow maker is frequently detected in those samples. Cow markers were likewise the most highly detected (42.85%) in Gandlanani village, which was consistent with the findings in Tshifudi village. Human markers were more common in Lambani village during the dry season, whereas dog and chicken markers were the most common during the wet season (Figure 3B). Mudau and colleagues [37] found that most homes had dogs and chickens in their yards, and these domestic animals were commonly seen roaming the streets; this finding corroborates the qPCR results for both markers. Considering the qPCR results, chickens were the most common source of contamination in Makuleke village (29.03%). Similar observations were noted in Njhakanjhaka village, where data showed that chicken markers were most prevalent (19.04%), while dogs were the most frequently observed animals in households during the study, as opposed to chickens.
The prevalence of diverse types of contaminants varied according to the water source and season. Certain sources of contamination were more prevalent in homes than in rivers and treatment plants, and conversely (Table 5). During the wet season, chicken (Cytb, 23.91%) and dog (BacCan, 22.28%) faecal contamination was frequently observed in water storage containers in homes, while during the dry season, humans (BacHum, 23.94% and HF183, 21.83%) were the primary source of contamination in household water storage containers. Chicken and dog markers were most frequent in household storage containers because most household kept their animals in the houses where they store their water storage containers to protect these animals from rain, therefore increasing the risk of faecal contamination. Humans and cows were determined to be the most common sources of contamination in rivers, as well as the most prevalent in water treatment plants (Table 5). During the dry season, many activities were observed at the vicinity of rivers, including washing clothing and bathing in the river water. Due to a lack of flowing water in the taps, community members were compelled to do their laundry at the rivers, which can add to faecal pollution in water. Walking along rivers was reported when there is a need to defecate, a practice that usually occurs near the river. The findings of the current study show that anthropogenic activities near water sources greatly contribute to faecal pollution in water.

5. Conclusions

The study used faecal Bacteroidales MST tools to identify the sources of faecal contamination in water sources used by water-stressed communities in the Vhembe District Municipality. Six host-specific Bacteroidales markers were validated and detected in the water sources of several settlements, with human-specific faecal contamination being the most common source of contamination during the dry season. During the rainy season, chickens and dogs were found to be the most common sources of contamination.
The study emphasises the urgent need for water and sanitation safety plans, education and awareness campaigns, and adequate water and sanitation infrastructure to improve the quality of water in homes and minimise the risk of water-related diseases.

Author Contributions

The study concept and design were developed by M.N.B.M. All authors conceived, designed and performed the experiments. Water sample collection and analyses were performed by M.M. and R.N.-N. The data were initially analysed and interpreted by M.M., thereafter approved by all. All authors were involved in the drafting and revising of the article. M.N.B.M. approved the last version of the article for publication. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the South African Research Chairs Initiatives (SARChI) in Water Quality and Wastewater Management, funded by the Department of Science and Technology, as administrated by the National Research Foundation (UID87310). Additional funding was received from Tshwane University of Technology.

Data Availability Statement

All relevant data are included in the article.

Acknowledgments

Sample collection was performed with the assistance of Arinao Murei, Barbara Mogane, Dikeledi Prudence Mothiba, Opelo Tlotlo Wryl Mochware, Jeridah Matlhokha Sekgobela and Ndamulelo Musumuvhi.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Okafor, C.O.; Ude, U.I.; Okoh, F.N.; Eromonsele, B.O. Safe Drinking Water: The Need and Challenges in Developing Countries. In Water Quality-New Perspectives; IntechOpen: Rijeka, Croatia, 2024. [Google Scholar]
  2. World Health Organisation (WHO). Water Sanation and Health: Water Supply, Sanitation and Hygiene Monitoring; World Health Organization: Geneva, Switzerland, 2024; Available online: https://www.who.int/publications/i/item/9789240030848 (accessed on 22 September 2024).
  3. United Nations Children’s Fund and World Health Organization. Progress on Household Drinking Water, Sanitation and Hygiene 2000–2022: Special Focus on Gender; World Health Organization: Geneva, Switzerland, 2024. [Google Scholar]
  4. World Health Organization (WHO). Water, Sanitation, Hygiene and Health: A Primer for Health Professionals; (Document No. WHO/CED/PHE/WSH/19.149); World Health Organization: Geneva, Switzerland, 2019; Available online: https://apps.who.int/iris/handle/10665/330100 (accessed on 22 September 2024).
  5. Murei, A.; Mogane, B.; Mothiba, D.P.; Mochware, O.T.W.; Sekgobela, J.M.; Mudau, M.; Musumuvhi, N.; Khabo-Mmekoa, C.M.; Moropeng, R.C.; Momba, M.N.B. Barriers to water and sanitation safety plans in rural areas of South Africa-a case study in the Vhembe District, Limpopo Province. Water 2022, 14, 1244. [Google Scholar] [CrossRef]
  6. Seurinck, S.; Defoirdt, T.; Verstraete, W.; Siciliano, S.D. Detection and quantification of the human-specific HF183 Bacteroides 16S rRNA genetic marker with real-time PCR for assessment of human faecal pollution in freshwater. Environ. Microbiol. 2005, 7, 249–259. [Google Scholar] [CrossRef] [PubMed]
  7. Seurinck, S.; Verstraete, W.; Siciliano, S.D. Microbial source tracking for identification of faecal pollution. Rev. Environ. Sci. Bio/Technol. 2005, 4, 19–37. [Google Scholar] [CrossRef]
  8. Vadde, K.K.; McCarthy, A.J.; Rong, R.; Sekar, R. Quantification of microbial source tracking and pathogenic bacterial markers in water and sediments of Tiaoxi River (Taihu Watershed). Front. Microbiol. 2019, 10, 699. [Google Scholar] [CrossRef] [PubMed]
  9. Gawler, A.H.; Beecher, J.E.; Brandão, J.; Carroll, N.M.; Falcão, L.; Gourmelon, M.; Masterson, B.; Nunes, B.; Porter, J.; Rincé, A.; et al. Validation of host-specific Bacteriodales 16S rRNA genes as markers to determine the origin of faecal pollution in Atlantic Rim countries of the European Union. Water Res. 2007, 41, 3780–3784. [Google Scholar] [CrossRef]
  10. Ravaliya, K.; Gentry-Shields, J.; Garcia, S.; Heredia, N.; Fabiszewski de Aceituno, A.; Bartz, F.E.; Leon, J.S.; Jaykus, L.A. Use of Bacteroidales microbial source tracking to monitor faecal contamination in fresh produce production. Appl. Environ. Microbiol. 2014, 80, 612–617. [Google Scholar] [CrossRef]
  11. APHA. Standard Methods for the Examination of Water and Wastewater, 20th ed.; The American Public Health Association (APHA); Water Environment Federation (WEF); American Water Works Association (AWWA): Washington, DC, USA, 2001; pp. 254–278. [Google Scholar]
  12. Silva, N.D.; Taniwaki, M.; Junqueira, V.; Silveira, N.; Nascimento, M.; Gomes, R. Plate count method APHA 2001 for total coliforms in foods. Cell 2016, 17, 8–2020. [Google Scholar]
  13. Haramoto, E.; Osada, R. Assessment and application of host-specific Bacteroidales genetic markers for microbial source tracking of river water in Japan. PLoS ONE 2018, 13, e0207727. [Google Scholar] [CrossRef]
  14. Lee, O.H.; Lee, B.Y. Antioxidant and antimicrobial activities of individual and combined phenolics in Olea europaea leaf extract. Bioresour. Technol. 2010, 101, 3751–3754. [Google Scholar] [CrossRef]
  15. Stewart, J.R.; Boehm, A.B.; Dubinsky, E.A.; Fong, T.T.; Goodwin, K.D.; Griffith, J.F.; Noble, R.T.; Shanks, O.C.; Vijayavel, K.; Weisberg, S.B. Recommendations following a multi-laboratory comparison of microbial source tracking methods. Water Res. 2013, 47, 6829–6838. [Google Scholar] [CrossRef]
  16. Kildare, B.J.; Leutenegger, C.M.; McSwain, B.S.; Bambic, D.G.; Rajal, V.B.; Wuertz, S. 16S rRNA-based assays for quantitative detection of universal, human-, cow-, and dog-specific faecal Bacteroidales: A Bayesian approach. Water Res. 2007, 41, 3701–3715. [Google Scholar] [CrossRef] [PubMed]
  17. Schriewer, A.; Miller, W.A.; Byrne, B.A.; Miller, M.A.; Oates, S.; Conrad, P.A.; Hardin, D.; Yang, H.H.; Chouicha, N.; Melli, A.; et al. Presence of Bacteroidales as a predictor of pathogens in surface waters of the central California coast. Appl. Environ. Microbiol. 2010, 76, 5802–5814. [Google Scholar] [CrossRef] [PubMed]
  18. Ballesté, E.; Belanche-Muñoz, L.A.; Farnleitner, A.H.; Linke, R.; Sommer, R.; Santos, R.; Monteiro, S.; Maunula, L.; Oristo, S.; Tiehm, A.; et al. Improving the identification of the source of faecal pollution in water using a modelling approach: From multi-source to aged and diluted samples. Water Res. 2020, 171, 115392. [Google Scholar]
  19. Hinojosa, J.; Green, J.; Estrada, F.; Herrera, J.; Mata, T.; Phan, D.; Pasha, A.T.; Matta, A.; Johnson, D.; Kapoor, V. Determining the primary sources of faecal pollution using microbial source tracking assays combined with land-use information in the Edwards Aquifer. Water Res. 2020, 184, 116211. [Google Scholar] [CrossRef]
  20. Malla, B.; Ghaju Shrestha, R.; Tandukar, S.; Bhandari, D.; Inoue, D.; Sei, K.; Tanaka, Y.; Sherchand, J.B.; Haramoto, E. Identification of human and animal faecal contamination in drinking water sources in the Kathmandu Valley, Nepal, using host-associated Bacteroidales quantitative PCR assays. Water 2018, 10, 1796. [Google Scholar]
  21. Kobayashi, T.; Yagi, M.; Kawaguchi, T.; Hata, T.; Shimizu, K. Spatiotemporal variations of surface water microplastics near Kyushu, Japan: A quali-quantitative analysis. Mar. Pollut. Bull. 2021, 169, 112563. [Google Scholar] [CrossRef] [PubMed]
  22. Ballesté, E.; Demeter, K.; Masterson, B.; Timoneda, N.; Sala-Comorera, L.; Meijer, W.G. Implementation and integration of microbial source tracking in a river watershed monitoring plan. Sci. Total Environ. 2020, 736, 139573. [Google Scholar]
  23. Harwood, V.J.; Staley, C.; Badgley, B.D.; Borges, K.; Korajkic, A. Microbial source tracking markers for detection of faecal contamination in environmental waters: Relationships between pathogens and human health outcomes. FEMS Microbiol. Rev. 2014, 38, 1–40. [Google Scholar] [CrossRef]
  24. Sherchan, S.; Shahin, S.; Alarcon, J.; Brosky, H.; Potter, C.; Dada, A.C. Microbial source tracking of faecal contamination in stormwater runoff. J. Water Health 2022, 20, 1271–1283. [Google Scholar] [CrossRef]
  25. Schriewer, A.; Odagiri, M.; Wuertz, S.; Misra, P.R.; Panigrahi, P.; Clasen, T.; Jenkins, M.W. Human and animal faecal contamination of community water sources, stored drinking water and hands in rural India measured with validated microbial source tracking assays. Am. J. Trop. Med. Hyg. 2015, 93, 509. [Google Scholar] [CrossRef]
  26. Odagiri, M.; Schriewer, A.; Hanley, K.; Wuertz, S.; Misra, P.R.; Panigrahi, P.; Jenkins, M.W. Validation of Bacteroidales quantitative PCR assays targeting human and animal faecal contamination in the public and domestic domains in India. Sci. Total Environ. 2015, 502, 462–470. [Google Scholar] [CrossRef] [PubMed]
  27. Holcomb, D.A.; Knee, J.; Sumner, T.; Adriano, Z.; de Bruijn, E.; Nalá, R.; Cumming, O.; Brown, J.; Stewart, J.R. Human faecal contamination of water, soil, and surfaces in households sharing poor-quality sanitation facilities in Maputo, Mozambique. Int. J. Hyg. Environ. Health 2020, 226, 113496. [Google Scholar] [CrossRef] [PubMed]
  28. Liang, Z.; Xu, G.; Shi, J.; Yu, S.; Lu, Q.; Liang, D.; Sun, L.; Wang, S. Sludge digestibility and functionally active microorganisms in methanogenic sludge digesters revealed by E. coli-fed digestion and microbial source tracking. Environ. Res. 2021, 193, 110539. [Google Scholar] [CrossRef]
  29. Malla, B.; Ghaju Shrestha, R.; Tandukar, S.; Sherchand, J.B.; Haramoto, E. Performance evaluation of human-specific viral markers and application of pepper mild mottle virus and crAssphage to environmental water samples as faecal pollution markers in the Kathmandu Valley, Nepal. Food Environ. Virol. 2019, 11, 274–287. [Google Scholar] [CrossRef]
  30. Malla, B.; Haramoto, E. Host-specific mitochondrial DNA markers for tracking the sources of faecal pollution. Curr. Opin. Environ. Sci. Health 2020, 16, 34–46. [Google Scholar] [CrossRef]
  31. Schiaffino, F.; Pisanic, N.; Colston, J.M.; Rengifo, D.; Olortegui, M.P.; Shapiama, V.; Yori, P.P.; Heaney, C.D.; Davis, M.F.; Kosek, M.N. Validation of microbial source tracking markers for the attribution of faecal contamination in indoor-household environments of the Peruvian Amazon. Sci. Total Environ. 2020, 743, 140531. [Google Scholar] [CrossRef]
  32. Ko, H.Y.; Cho, K.; Park, S.; Kim, J.H.; Kang, J.H.; Jeong, Y.S.; Choi, J.D.; Sin, Y.; Lee, C.; Ko, G. Host-specific Bacteroides markers-based microbial source tracking in aquaculture areas. Microbes Environ. 2018, 33, 151–161. [Google Scholar] [CrossRef] [PubMed]
  33. Newton, R.J.; Bootsma, M.J.; Morrison, H.G.; Sogin, M.L.; McLellan, S.L. A microbial signature approach to identify faecal pollution in the waters off an urbanized coast of Lake Michigan. Microb. Ecol. 2013, 65, 1011–1023. [Google Scholar] [CrossRef]
  34. Ballesté, E.; Bonjoch, X.; Belanche, L.A.; Blanch, A.R. Molecular indicators used in the development of predictive models for microbial source tracking. Appl. Environ. Microbiol. 2010, 76, 1789–1795. [Google Scholar] [CrossRef]
  35. Clasen, T.F.; Bastable, A. Faecal contamination of drinking water during collection and household storage: The need to extend protection to the point of use. J. Water Health 2003, 1, 109–115. [Google Scholar] [CrossRef]
  36. Sidhu, J.P.; Ahmed, W.; Gernjak, W.; Aryal, R.; McCarthy, D.; Palmer, A.; Kolotelo, P.; Toze, S. Sewage pollution in urban stormwater runoff as evident from the widespread presence of multiple microbial and chemical source tracking markers. Sci. Total Environ. 2013, 463, 488–496. [Google Scholar] [CrossRef] [PubMed]
  37. Mudau, M.; Ngobeni-Nyambi, R.; Momba, M.N.B. The Fascinating Cross-Paths of Pathogenic Bacteria, Human and Animal Faecal Sources in Water-Stressed Communities of Vhembe District, South Africa. Pathogens 2023, 12, 1085. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Map representing villages selected in the Vhembe District Municipality, Limpopo Province.
Figure 1. Map representing villages selected in the Vhembe District Municipality, Limpopo Province.
Water 16 03477 g001
Figure 2. Prevalence of sources of faecal contamination in water per season (n = 564 per season).
Figure 2. Prevalence of sources of faecal contamination in water per season (n = 564 per season).
Water 16 03477 g002
Figure 3. (A) The overall prevalence of sources of contamination in different villages. (B) The prevalence of different sources of contamination in different villages during the wet and dry seasons.
Figure 3. (A) The overall prevalence of sources of contamination in different villages. (B) The prevalence of different sources of contamination in different villages during the wet and dry seasons.
Water 16 03477 g003aWater 16 03477 g003b
Table 1. Primers and probes for the selection of best-performing host-specific assays.
Table 1. Primers and probes for the selection of best-performing host-specific assays.
HostAssaySequenceCycling ConditionsReferences
Universal BacteroidalesBacUni-520CGTTATCCGGATTTATTGGGTTTA
CAATCGGAGTTCTTCGTGATATCTA
AATCGGAGTTCCTCGTGATATCTA
FAM-TGGTGTAGCGGTGAAATAMRA-MGB
95 °C for 30 s 95 °C for 5 s 45 cycles at
60 °C for 30 s
[15,16]
HumanBacHumF′ TGAGTTCACATGTCCGCATGA
R′ CGTTACCCCGCCTACTATCTAATG
FAM-TCCGGTAGACGATGGGGATGCGTT-TAMRA
[12,15,17,18,19]
HF183F′ ATCATGAGTTCACATGTCCG
R′ CGTAGGAGTTTGGACCGTGT
FAM-CTGAGAGGAAGGTCCCCCACATTGGA-TAMRA
GyrBF′ GGCGGTCTTCCGGGTAAA
R′ CACACTTCTGCGGGTCTTTGT
FAM-TGGCCGACTGCTC-NFQ-MGB
CowBacCowF′ CCAACYTTCCCGWTACTC
R′ GGACCGTGTCTCAGTTCCAGTG
FAM-TAGGGGTTCTGAGAGGAAGGTCCCCC-TAMRA
BacRF′ GGCGGTCTTCCGGGTAAA
R′ CACACTTCTGCGGGTCTTTGT
FAM-TGGCCGACTGCTC-NFQ-MGB
PigPig-2-BacF′ GCATGAATTTAGCTTGCTAAATTTGAT FAM-
R′ ACCTCATACGGTATTAATCCGC
FAM-TCCACGGGATAGCC-NFQ-MGB
Pf163F′ GCGGATTAATACCGTATGA
R′ CAATCGGAGTTCTTCGTG
ChickenCytbF′ AAATCCCACCCCCTACTAAAAATAAT
R′ CAGATGAAGAAGAATGAGGCG
ACAACTCCCTAATCGACCT
DogBacCanF′ CCAACYTTCCCGWTACTC
R′ GGACCGTGTCTCAGTTCCAGTG
TAGGGGTTCTGAGAGGAAGGTCCCCC
Table 2. Performance of human-specific markers.
Table 2. Performance of human-specific markers.
Universal MarkerHuman-Specific Markers
BacUniBacHumHF183GyrB
SourcesNo. of SamplesNo. of Positive SamplesConc.
(Mean ± SD)
No. of Positive SamplesConc.
(Mean ± SD)
No. of Positive SamplesConc.
(Mean ± SD)
No. of Positive SamplesConc.
(Mean ± SD)
Human1010 (100%)3.3 ±1.510 (100%)5.71 ± 3.788 (80%)6.22 ± 3.556 (80%)5.63 ± 3.91
Cow1212 (100%)5.4 ± 1.30 (0%)ND2 (17%)2.9 ± 1.24 (33.33%)1.74 ± 4.22
Pig77 (100%)2.0 ± 1.30 (0%)ND0 (0%)ND2 (28.57%)2.84 ± 4.07
Chicken55 (100%)3.3 ± 1.50 (0%)ND0 (0%)ND0 (0%)ND
Dog88 (100%)5.5 ± 1.51 (12.5%)5.5 ± 1.53 (38%)3.3 ± 1.54 (50.00%)5.04 ± 3.72
Specificity (%)100 97 86 52
Sensitivity (%)100 100 80 60
Accuracy (%)100 98 85 67
Note: ND—not detected.
Table 3. Performance of animal-specific markers.
Table 3. Performance of animal-specific markers.
Ruminant-Specific MarkersPig-Specific MarkersChicken-Specific MarkersDog-Specific Marker
BacCowBacRPig-2-BacPF163CytbBacCan
SourcesNo. of SampleNo. of Positive SamplesConc.
(Mean ± SD)
No. of Positive SamplesConc.
(Mean ± SD)
No. of Positive SamplesConc.
(Mean ± SD)
No. of Positive SamplesConc.
(Mean ± SD)
No. of Positive SamplesConc.
(Mean ± SD)
No. of Positive SamplesConc.
(Mean ± SD)
Human100 (0%)N/A4 (33.3%)3.78 ± 3.320 (0%)ND3 (42.8%)3.3 ± 1.30 (0%)ND0 (0%)ND
Cow1211 (92%)5.89 ± 4.909 (75%)3.51 ± 6.430 (0%)ND2 (28.5%)2.84 ± 4.070 (0%)ND1 (8%)4.89 ± 5.89
Pig70 (0%)ND2 (16.7%)4.89 ± 1.55 (71%)6.32 ± 2.684 (57.1%)1.74 ± 4.220 (0%)ND0 (0%)ND
Chicken50 (0%)ND1 (8.3%)2.84 ± 1.330 (0%)ND2 (28.5%)2.84 ± 4.074 (80%)6.20 ± 2.840 (0%)ND
Dog80 (0%)ND3 (25%)5.56 ± 1.60 (0%)ND1 (14.3%)5.5 ± 1.52 (25%)3.5 ±1.896 (75%)5.42 ± 5.56
Specificity (%)9267100779597
Sensitivity (%)1007571578075
Accuracy (%) 988394749393
Note: ND—not detected.
Table 4. Standard curve parameters for sources of contamination.
Table 4. Standard curve parameters for sources of contamination.
Standard Curve Parameters for Host-Specific Markers
Target SpeciesSpecific MarkerSlopey-InterceptEfficiency LLOQ
(Ct Value)
Gene Copy Number Per µLLog10 Gene Copies Per ng
HumanBacHum−3.4838.889428.585.63 × 103939.75
HumanHF183−3.4938.849331.111.74 × 104242.24
PigPig-2-Bac−3.5338.789229.472.84 × 104040.45
ChickenCytb−3.737.888631.051.93 × 104141.29
CowBacCow−3.6538.88827.075.04 × 103737.70
DogsBacCan−3.7439.948531.652.11 × 104242.33
Table 5. The occurrence of sources of contamination in different water sources.
Table 5. The occurrence of sources of contamination in different water sources.
Sources of ContaminationWater Source Categories
Wet Season
Household Drinking WaterRiverTreatment Plant
(Pre-Treatment)
Total
FrequencyPercentFrequencyPercentFrequencyPercentFrequencyPercent
BacHum2010.86318.75535.712813.08
HF1832312.5743.75535.713516.35
Cytb4423.9100004420.56
BacCow2614.13531.25428.573516.35
BacCan4122.2800004119.15
Pig-2-Bac3016.316.25003114.48
Total1841001610014100214100
Dry Season
Sources of ContaminationHousehold Drinking WaterRiverTreatment Plant
(Pre-Treatment)
Total
BacHum3423.94321.43318.754023.26
HF1833121.83321.43212.52620.93
Cytb2316.217.14212.52615.12
BacCow139.15535.71531.252313.37
BacCan2114.79214.29212.52514.53
Pig-2-Bac2014.0800212.52212.79
Total1421001410016100172100s
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mudau, M.; Ngobeni-Nyambi, R.; Momba, M.N.B. The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa. Water 2024, 16, 3477. https://doi.org/10.3390/w16233477

AMA Style

Mudau M, Ngobeni-Nyambi R, Momba MNB. The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa. Water. 2024; 16(23):3477. https://doi.org/10.3390/w16233477

Chicago/Turabian Style

Mudau, Mulalo, Renay Ngobeni-Nyambi, and Maggy Ndombo Benteke Momba. 2024. "The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa" Water 16, no. 23: 3477. https://doi.org/10.3390/w16233477

APA Style

Mudau, M., Ngobeni-Nyambi, R., & Momba, M. N. B. (2024). The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa. Water, 16(23), 3477. https://doi.org/10.3390/w16233477

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop