The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa
Abstract
1. Introduction
2. Methodology
2.1. Ethical Clearance, Informed Consent and Criteria for Study Site Selection
2.2. Study Site and Population Description
2.3. Sample Collection
2.4. Sample Preparation by Membrane Filtration and DNA Extraction
2.5. Determination of the Best-Performing Assays for Microbial Source Tracking (MST) Markers
2.6. Detection of Faecal Pollution from Source Samples and Water Utilized in the Communities Using Microbial Genetic Markers
2.7. Statistical Analysis
3. Results
3.1. Determination of Best-Perfoming Assays for Microbial Source Tracking Markers
3.2. Amplification Efficiency and the Limit of Detection of Each Assay
3.3. The Prevalence of Sources of Faecal Contamination in Water
3.4. The Prevalence of Different Sources of Contamination in Water Sources During the Wet and Dry Seasons
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Okafor, C.O.; Ude, U.I.; Okoh, F.N.; Eromonsele, B.O. Safe Drinking Water: The Need and Challenges in Developing Countries. In Water Quality-New Perspectives; IntechOpen: Rijeka, Croatia, 2024. [Google Scholar]
- World Health Organisation (WHO). Water Sanation and Health: Water Supply, Sanitation and Hygiene Monitoring; World Health Organization: Geneva, Switzerland, 2024; Available online: https://www.who.int/publications/i/item/9789240030848 (accessed on 22 September 2024).
- United Nations Children’s Fund and World Health Organization. Progress on Household Drinking Water, Sanitation and Hygiene 2000–2022: Special Focus on Gender; World Health Organization: Geneva, Switzerland, 2024. [Google Scholar]
- World Health Organization (WHO). Water, Sanitation, Hygiene and Health: A Primer for Health Professionals; (Document No. WHO/CED/PHE/WSH/19.149); World Health Organization: Geneva, Switzerland, 2019; Available online: https://apps.who.int/iris/handle/10665/330100 (accessed on 22 September 2024).
- Murei, A.; Mogane, B.; Mothiba, D.P.; Mochware, O.T.W.; Sekgobela, J.M.; Mudau, M.; Musumuvhi, N.; Khabo-Mmekoa, C.M.; Moropeng, R.C.; Momba, M.N.B. Barriers to water and sanitation safety plans in rural areas of South Africa-a case study in the Vhembe District, Limpopo Province. Water 2022, 14, 1244. [Google Scholar] [CrossRef]
- Seurinck, S.; Defoirdt, T.; Verstraete, W.; Siciliano, S.D. Detection and quantification of the human-specific HF183 Bacteroides 16S rRNA genetic marker with real-time PCR for assessment of human faecal pollution in freshwater. Environ. Microbiol. 2005, 7, 249–259. [Google Scholar] [CrossRef] [PubMed]
- Seurinck, S.; Verstraete, W.; Siciliano, S.D. Microbial source tracking for identification of faecal pollution. Rev. Environ. Sci. Bio/Technol. 2005, 4, 19–37. [Google Scholar] [CrossRef]
- Vadde, K.K.; McCarthy, A.J.; Rong, R.; Sekar, R. Quantification of microbial source tracking and pathogenic bacterial markers in water and sediments of Tiaoxi River (Taihu Watershed). Front. Microbiol. 2019, 10, 699. [Google Scholar] [CrossRef] [PubMed]
- Gawler, A.H.; Beecher, J.E.; Brandão, J.; Carroll, N.M.; Falcão, L.; Gourmelon, M.; Masterson, B.; Nunes, B.; Porter, J.; Rincé, A.; et al. Validation of host-specific Bacteriodales 16S rRNA genes as markers to determine the origin of faecal pollution in Atlantic Rim countries of the European Union. Water Res. 2007, 41, 3780–3784. [Google Scholar] [CrossRef]
- Ravaliya, K.; Gentry-Shields, J.; Garcia, S.; Heredia, N.; Fabiszewski de Aceituno, A.; Bartz, F.E.; Leon, J.S.; Jaykus, L.A. Use of Bacteroidales microbial source tracking to monitor faecal contamination in fresh produce production. Appl. Environ. Microbiol. 2014, 80, 612–617. [Google Scholar] [CrossRef]
- APHA. Standard Methods for the Examination of Water and Wastewater, 20th ed.; The American Public Health Association (APHA); Water Environment Federation (WEF); American Water Works Association (AWWA): Washington, DC, USA, 2001; pp. 254–278. [Google Scholar]
- Silva, N.D.; Taniwaki, M.; Junqueira, V.; Silveira, N.; Nascimento, M.; Gomes, R. Plate count method APHA 2001 for total coliforms in foods. Cell 2016, 17, 8–2020. [Google Scholar]
- Haramoto, E.; Osada, R. Assessment and application of host-specific Bacteroidales genetic markers for microbial source tracking of river water in Japan. PLoS ONE 2018, 13, e0207727. [Google Scholar] [CrossRef]
- Lee, O.H.; Lee, B.Y. Antioxidant and antimicrobial activities of individual and combined phenolics in Olea europaea leaf extract. Bioresour. Technol. 2010, 101, 3751–3754. [Google Scholar] [CrossRef]
- Stewart, J.R.; Boehm, A.B.; Dubinsky, E.A.; Fong, T.T.; Goodwin, K.D.; Griffith, J.F.; Noble, R.T.; Shanks, O.C.; Vijayavel, K.; Weisberg, S.B. Recommendations following a multi-laboratory comparison of microbial source tracking methods. Water Res. 2013, 47, 6829–6838. [Google Scholar] [CrossRef]
- Kildare, B.J.; Leutenegger, C.M.; McSwain, B.S.; Bambic, D.G.; Rajal, V.B.; Wuertz, S. 16S rRNA-based assays for quantitative detection of universal, human-, cow-, and dog-specific faecal Bacteroidales: A Bayesian approach. Water Res. 2007, 41, 3701–3715. [Google Scholar] [CrossRef] [PubMed]
- Schriewer, A.; Miller, W.A.; Byrne, B.A.; Miller, M.A.; Oates, S.; Conrad, P.A.; Hardin, D.; Yang, H.H.; Chouicha, N.; Melli, A.; et al. Presence of Bacteroidales as a predictor of pathogens in surface waters of the central California coast. Appl. Environ. Microbiol. 2010, 76, 5802–5814. [Google Scholar] [CrossRef] [PubMed]
- Ballesté, E.; Belanche-Muñoz, L.A.; Farnleitner, A.H.; Linke, R.; Sommer, R.; Santos, R.; Monteiro, S.; Maunula, L.; Oristo, S.; Tiehm, A.; et al. Improving the identification of the source of faecal pollution in water using a modelling approach: From multi-source to aged and diluted samples. Water Res. 2020, 171, 115392. [Google Scholar]
- Hinojosa, J.; Green, J.; Estrada, F.; Herrera, J.; Mata, T.; Phan, D.; Pasha, A.T.; Matta, A.; Johnson, D.; Kapoor, V. Determining the primary sources of faecal pollution using microbial source tracking assays combined with land-use information in the Edwards Aquifer. Water Res. 2020, 184, 116211. [Google Scholar] [CrossRef]
- Malla, B.; Ghaju Shrestha, R.; Tandukar, S.; Bhandari, D.; Inoue, D.; Sei, K.; Tanaka, Y.; Sherchand, J.B.; Haramoto, E. Identification of human and animal faecal contamination in drinking water sources in the Kathmandu Valley, Nepal, using host-associated Bacteroidales quantitative PCR assays. Water 2018, 10, 1796. [Google Scholar]
- Kobayashi, T.; Yagi, M.; Kawaguchi, T.; Hata, T.; Shimizu, K. Spatiotemporal variations of surface water microplastics near Kyushu, Japan: A quali-quantitative analysis. Mar. Pollut. Bull. 2021, 169, 112563. [Google Scholar] [CrossRef] [PubMed]
- Ballesté, E.; Demeter, K.; Masterson, B.; Timoneda, N.; Sala-Comorera, L.; Meijer, W.G. Implementation and integration of microbial source tracking in a river watershed monitoring plan. Sci. Total Environ. 2020, 736, 139573. [Google Scholar]
- Harwood, V.J.; Staley, C.; Badgley, B.D.; Borges, K.; Korajkic, A. Microbial source tracking markers for detection of faecal contamination in environmental waters: Relationships between pathogens and human health outcomes. FEMS Microbiol. Rev. 2014, 38, 1–40. [Google Scholar] [CrossRef]
- Sherchan, S.; Shahin, S.; Alarcon, J.; Brosky, H.; Potter, C.; Dada, A.C. Microbial source tracking of faecal contamination in stormwater runoff. J. Water Health 2022, 20, 1271–1283. [Google Scholar] [CrossRef]
- Schriewer, A.; Odagiri, M.; Wuertz, S.; Misra, P.R.; Panigrahi, P.; Clasen, T.; Jenkins, M.W. Human and animal faecal contamination of community water sources, stored drinking water and hands in rural India measured with validated microbial source tracking assays. Am. J. Trop. Med. Hyg. 2015, 93, 509. [Google Scholar] [CrossRef]
- Odagiri, M.; Schriewer, A.; Hanley, K.; Wuertz, S.; Misra, P.R.; Panigrahi, P.; Jenkins, M.W. Validation of Bacteroidales quantitative PCR assays targeting human and animal faecal contamination in the public and domestic domains in India. Sci. Total Environ. 2015, 502, 462–470. [Google Scholar] [CrossRef] [PubMed]
- Holcomb, D.A.; Knee, J.; Sumner, T.; Adriano, Z.; de Bruijn, E.; Nalá, R.; Cumming, O.; Brown, J.; Stewart, J.R. Human faecal contamination of water, soil, and surfaces in households sharing poor-quality sanitation facilities in Maputo, Mozambique. Int. J. Hyg. Environ. Health 2020, 226, 113496. [Google Scholar] [CrossRef] [PubMed]
- Liang, Z.; Xu, G.; Shi, J.; Yu, S.; Lu, Q.; Liang, D.; Sun, L.; Wang, S. Sludge digestibility and functionally active microorganisms in methanogenic sludge digesters revealed by E. coli-fed digestion and microbial source tracking. Environ. Res. 2021, 193, 110539. [Google Scholar] [CrossRef]
- Malla, B.; Ghaju Shrestha, R.; Tandukar, S.; Sherchand, J.B.; Haramoto, E. Performance evaluation of human-specific viral markers and application of pepper mild mottle virus and crAssphage to environmental water samples as faecal pollution markers in the Kathmandu Valley, Nepal. Food Environ. Virol. 2019, 11, 274–287. [Google Scholar] [CrossRef]
- Malla, B.; Haramoto, E. Host-specific mitochondrial DNA markers for tracking the sources of faecal pollution. Curr. Opin. Environ. Sci. Health 2020, 16, 34–46. [Google Scholar] [CrossRef]
- Schiaffino, F.; Pisanic, N.; Colston, J.M.; Rengifo, D.; Olortegui, M.P.; Shapiama, V.; Yori, P.P.; Heaney, C.D.; Davis, M.F.; Kosek, M.N. Validation of microbial source tracking markers for the attribution of faecal contamination in indoor-household environments of the Peruvian Amazon. Sci. Total Environ. 2020, 743, 140531. [Google Scholar] [CrossRef]
- Ko, H.Y.; Cho, K.; Park, S.; Kim, J.H.; Kang, J.H.; Jeong, Y.S.; Choi, J.D.; Sin, Y.; Lee, C.; Ko, G. Host-specific Bacteroides markers-based microbial source tracking in aquaculture areas. Microbes Environ. 2018, 33, 151–161. [Google Scholar] [CrossRef] [PubMed]
- Newton, R.J.; Bootsma, M.J.; Morrison, H.G.; Sogin, M.L.; McLellan, S.L. A microbial signature approach to identify faecal pollution in the waters off an urbanized coast of Lake Michigan. Microb. Ecol. 2013, 65, 1011–1023. [Google Scholar] [CrossRef]
- Ballesté, E.; Bonjoch, X.; Belanche, L.A.; Blanch, A.R. Molecular indicators used in the development of predictive models for microbial source tracking. Appl. Environ. Microbiol. 2010, 76, 1789–1795. [Google Scholar] [CrossRef]
- Clasen, T.F.; Bastable, A. Faecal contamination of drinking water during collection and household storage: The need to extend protection to the point of use. J. Water Health 2003, 1, 109–115. [Google Scholar] [CrossRef]
- Sidhu, J.P.; Ahmed, W.; Gernjak, W.; Aryal, R.; McCarthy, D.; Palmer, A.; Kolotelo, P.; Toze, S. Sewage pollution in urban stormwater runoff as evident from the widespread presence of multiple microbial and chemical source tracking markers. Sci. Total Environ. 2013, 463, 488–496. [Google Scholar] [CrossRef] [PubMed]
- Mudau, M.; Ngobeni-Nyambi, R.; Momba, M.N.B. The Fascinating Cross-Paths of Pathogenic Bacteria, Human and Animal Faecal Sources in Water-Stressed Communities of Vhembe District, South Africa. Pathogens 2023, 12, 1085. [Google Scholar] [CrossRef] [PubMed]
Host | Assay | Sequence | Cycling Conditions | References |
---|---|---|---|---|
Universal Bacteroidales | BacUni-520 | CGTTATCCGGATTTATTGGGTTTA CAATCGGAGTTCTTCGTGATATCTA AATCGGAGTTCCTCGTGATATCTA FAM-TGGTGTAGCGGTGAAATAMRA-MGB | 95 °C for 30 s 95 °C for 5 s 45 cycles at 60 °C for 30 s | [15,16] |
Human | BacHum | F′ TGAGTTCACATGTCCGCATGA R′ CGTTACCCCGCCTACTATCTAATG FAM-TCCGGTAGACGATGGGGATGCGTT-TAMRA | [12,15,17,18,19] | |
HF183 | F′ ATCATGAGTTCACATGTCCG R′ CGTAGGAGTTTGGACCGTGT FAM-CTGAGAGGAAGGTCCCCCACATTGGA-TAMRA | |||
GyrB | F′ GGCGGTCTTCCGGGTAAA R′ CACACTTCTGCGGGTCTTTGT FAM-TGGCCGACTGCTC-NFQ-MGB | |||
Cow | BacCow | F′ CCAACYTTCCCGWTACTC R′ GGACCGTGTCTCAGTTCCAGTG FAM-TAGGGGTTCTGAGAGGAAGGTCCCCC-TAMRA | ||
BacR | F′ GGCGGTCTTCCGGGTAAA R′ CACACTTCTGCGGGTCTTTGT FAM-TGGCCGACTGCTC-NFQ-MGB | |||
Pig | Pig-2-Bac | F′ GCATGAATTTAGCTTGCTAAATTTGAT FAM- R′ ACCTCATACGGTATTAATCCGC FAM-TCCACGGGATAGCC-NFQ-MGB | ||
Pf163 | F′ GCGGATTAATACCGTATGA R′ CAATCGGAGTTCTTCGTG | |||
Chicken | Cytb | F′ AAATCCCACCCCCTACTAAAAATAAT R′ CAGATGAAGAAGAATGAGGCG ACAACTCCCTAATCGACCT | ||
Dog | BacCan | F′ CCAACYTTCCCGWTACTC R′ GGACCGTGTCTCAGTTCCAGTG TAGGGGTTCTGAGAGGAAGGTCCCCC |
Universal Marker | Human-Specific Markers | ||||||||
---|---|---|---|---|---|---|---|---|---|
BacUni | BacHum | HF183 | GyrB | ||||||
Sources | No. of Samples | No. of Positive Samples | Conc. (Mean ± SD) | No. of Positive Samples | Conc. (Mean ± SD) | No. of Positive Samples | Conc. (Mean ± SD) | No. of Positive Samples | Conc. (Mean ± SD) |
Human | 10 | 10 (100%) | 3.3 ±1.5 | 10 (100%) | 5.71 ± 3.78 | 8 (80%) | 6.22 ± 3.55 | 6 (80%) | 5.63 ± 3.91 |
Cow | 12 | 12 (100%) | 5.4 ± 1.3 | 0 (0%) | ND | 2 (17%) | 2.9 ± 1.2 | 4 (33.33%) | 1.74 ± 4.22 |
Pig | 7 | 7 (100%) | 2.0 ± 1.3 | 0 (0%) | ND | 0 (0%) | ND | 2 (28.57%) | 2.84 ± 4.07 |
Chicken | 5 | 5 (100%) | 3.3 ± 1.5 | 0 (0%) | ND | 0 (0%) | ND | 0 (0%) | ND |
Dog | 8 | 8 (100%) | 5.5 ± 1.5 | 1 (12.5%) | 5.5 ± 1.5 | 3 (38%) | 3.3 ± 1.5 | 4 (50.00%) | 5.04 ± 3.72 |
Specificity (%) | 100 | 97 | 86 | 52 | |||||
Sensitivity (%) | 100 | 100 | 80 | 60 | |||||
Accuracy (%) | 100 | 98 | 85 | 67 |
Ruminant-Specific Markers | Pig-Specific Markers | Chicken-Specific Markers | Dog-Specific Marker | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BacCow | BacR | Pig-2-Bac | PF163 | Cytb | BacCan | ||||||||
Sources | No. of Sample | No. of Positive Samples | Conc. (Mean ± SD) | No. of Positive Samples | Conc. (Mean ± SD) | No. of Positive Samples | Conc. (Mean ± SD) | No. of Positive Samples | Conc. (Mean ± SD) | No. of Positive Samples | Conc. (Mean ± SD) | No. of Positive Samples | Conc. (Mean ± SD) |
Human | 10 | 0 (0%) | N/A | 4 (33.3%) | 3.78 ± 3.32 | 0 (0%) | ND | 3 (42.8%) | 3.3 ± 1.3 | 0 (0%) | ND | 0 (0%) | ND |
Cow | 12 | 11 (92%) | 5.89 ± 4.90 | 9 (75%) | 3.51 ± 6.43 | 0 (0%) | ND | 2 (28.5%) | 2.84 ± 4.07 | 0 (0%) | ND | 1 (8%) | 4.89 ± 5.89 |
Pig | 7 | 0 (0%) | ND | 2 (16.7%) | 4.89 ± 1.5 | 5 (71%) | 6.32 ± 2.68 | 4 (57.1%) | 1.74 ± 4.22 | 0 (0%) | ND | 0 (0%) | ND |
Chicken | 5 | 0 (0%) | ND | 1 (8.3%) | 2.84 ± 1.33 | 0 (0%) | ND | 2 (28.5%) | 2.84 ± 4.07 | 4 (80%) | 6.20 ± 2.84 | 0 (0%) | ND |
Dog | 8 | 0 (0%) | ND | 3 (25%) | 5.56 ± 1.6 | 0 (0%) | ND | 1 (14.3%) | 5.5 ± 1.5 | 2 (25%) | 3.5 ±1.89 | 6 (75%) | 5.42 ± 5.56 |
Specificity (%) | 92 | 67 | 100 | 77 | 95 | 97 | |||||||
Sensitivity (%) | 100 | 75 | 71 | 57 | 80 | 75 | |||||||
Accuracy (%) | 98 | 83 | 94 | 74 | 93 | 93 |
Standard Curve Parameters for Host-Specific Markers | |||||||
---|---|---|---|---|---|---|---|
Target Species | Specific Marker | Slope | y-Intercept | Efficiency | LLOQ (Ct Value) | Gene Copy Number Per µL | Log10 Gene Copies Per ng |
Human | BacHum | −3.48 | 38.88 | 94 | 28.58 | 5.63 × 1039 | 39.75 |
Human | HF183 | −3.49 | 38.84 | 93 | 31.11 | 1.74 × 1042 | 42.24 |
Pig | Pig-2-Bac | −3.53 | 38.78 | 92 | 29.47 | 2.84 × 1040 | 40.45 |
Chicken | Cytb | −3.7 | 37.88 | 86 | 31.05 | 1.93 × 1041 | 41.29 |
Cow | BacCow | −3.65 | 38.8 | 88 | 27.07 | 5.04 × 1037 | 37.70 |
Dogs | BacCan | −3.74 | 39.94 | 85 | 31.65 | 2.11 × 1042 | 42.33 |
Sources of Contamination | Water Source Categories | |||||||
---|---|---|---|---|---|---|---|---|
Wet Season | ||||||||
Household Drinking Water | River | Treatment Plant (Pre-Treatment) | Total | |||||
Frequency | Percent | Frequency | Percent | Frequency | Percent | Frequency | Percent | |
BacHum | 20 | 10.86 | 3 | 18.75 | 5 | 35.71 | 28 | 13.08 |
HF183 | 23 | 12.5 | 7 | 43.75 | 5 | 35.71 | 35 | 16.35 |
Cytb | 44 | 23.91 | 0 | 0 | 0 | 0 | 44 | 20.56 |
BacCow | 26 | 14.13 | 5 | 31.25 | 4 | 28.57 | 35 | 16.35 |
BacCan | 41 | 22.28 | 0 | 0 | 0 | 0 | 41 | 19.15 |
Pig-2-Bac | 30 | 16.3 | 1 | 6.25 | 0 | 0 | 31 | 14.48 |
Total | 184 | 100 | 16 | 100 | 14 | 100 | 214 | 100 |
Dry Season | ||||||||
Sources of Contamination | Household Drinking Water | River | Treatment Plant (Pre-Treatment) | Total | ||||
BacHum | 34 | 23.94 | 3 | 21.43 | 3 | 18.75 | 40 | 23.26 |
HF183 | 31 | 21.83 | 3 | 21.43 | 2 | 12.5 | 26 | 20.93 |
Cytb | 23 | 16.2 | 1 | 7.14 | 2 | 12.5 | 26 | 15.12 |
BacCow | 13 | 9.15 | 5 | 35.71 | 5 | 31.25 | 23 | 13.37 |
BacCan | 21 | 14.79 | 2 | 14.29 | 2 | 12.5 | 25 | 14.53 |
Pig-2-Bac | 20 | 14.08 | 0 | 0 | 2 | 12.5 | 22 | 12.79 |
Total | 142 | 100 | 14 | 100 | 16 | 100 | 172 | 100s |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mudau, M.; Ngobeni-Nyambi, R.; Momba, M.N.B. The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa. Water 2024, 16, 3477. https://doi.org/10.3390/w16233477
Mudau M, Ngobeni-Nyambi R, Momba MNB. The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa. Water. 2024; 16(23):3477. https://doi.org/10.3390/w16233477
Chicago/Turabian StyleMudau, Mulalo, Renay Ngobeni-Nyambi, and Maggy Ndombo Benteke Momba. 2024. "The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa" Water 16, no. 23: 3477. https://doi.org/10.3390/w16233477
APA StyleMudau, M., Ngobeni-Nyambi, R., & Momba, M. N. B. (2024). The Identification of Predominant Faecal Contamination Sources in Water Using Host-Specific Genetic Markers in Water-Stressed Rural Communities of Vhembe District Municipality, South Africa. Water, 16(23), 3477. https://doi.org/10.3390/w16233477