Correlation Analysis of CXCL10, FOS, HOXC13, and WNT4 Gene Polymorphisms with Key Economic Traits—Initial Population Screening for Jiangnan Cashmere Goats
Abstract
1. Introduction
2. Materials and Methods
2.1. Selection of Experimental Animals
2.2. Collection and Measurement of Phenotypic Data
2.3. Sample Collection
2.4. SNP Genotyping
2.5. Quality Control of Sequencing Data
2.6. Statistical Analysis
3. Results
3.1. Descriptive Statistics on Key Economic Traits
3.2. Annotation of Typing Results
3.3. Analysis of Population Genetic Polymorphism
3.4. The Significance Analysis of SNPs and Key Economic Traits
4. Discussion
4.1. Association Analysis Between CXCL10 Gene SNPs and Key Economic Traits
4.2. Association Analysis Between FOS Gene SNPs and Key Economic Traits
4.3. Association Analysis Between HOXC13 Gene SNPs and Key Economic Traits
4.4. Association Analysis Between WNT4 Gene SNPs and Key Economic Traits
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BW | Birth Weight |
| YW | Yearling Weight |
| FW | Fleece Weight |
| PDW | Post-Defleecing Weight |
| MFD | Mean Fiber Diameter |
| FDSD | Fiber Diameter Standard Deviation |
| CVFD | Fiber Diameter Variation Coefficient |
References
- Tian, K.; Xiao, H.; Tian, Y. Current situation, future development trend, and suggestions of China’s down-producing sheep industry in 2020. Chin. J. Anim. Sci. 2021, 57, 229–234. [Google Scholar]
- Jia, Y.; Li, F.; Qin, C.; Zhang, X.; Zhang, F. Precautions for Cashmere Combing of Jiangnan cashmere goats Veterinary Orientation. Veterinary Guide J. 2019, 11, 67. [Google Scholar]
- Qin, C.; Du, J.; Li, B. Investigation on the Industrial Development of Jiangnan cashmere goats in Aksu Region. Agric. Eng. Technol. 2023, 43, 13+15. [Google Scholar] [CrossRef]
- Wu, C.; Ma, S.; Zhao, B.; Qin, C.; Wu, Y.; Di, J.; Suo, L.; Fu, X. Drivers of plateau adaptability in cashmere goats revealed by genomic and transcriptomic analyses. BMC Genom. 2023, 24, 428. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Li, J.; Xu, X.; Xu, Q.; Qin, C.; Liu, G.; Wei, C.; Zhang, G.; Tian, K.; Fu, X. Effect of the FA2H Gene on cashmere fineness of Jiangnan cashmere goats based on transcriptome sequencing. BMC Genom. 2022, 23, 527. [Google Scholar] [CrossRef]
- Zhao, B.; Suo, L.; Wu, Y.; Chen, T.; Tulafu, H.; Lu, Q.; Liu, W.; Sammad, A.; Wu, C.; Fu, X. Stress adaptation in Tibetan cashmere goats is governed by inherent metabolic differences and manifested through variable cashmere phenotypes. Genomics 2024, 116, 110801. [Google Scholar] [CrossRef]
- Fu, X. Screening of Regulatory Factors Related to Cashmere Fiber Diameter Traits in Tibetan Cashmere Goats Based on Transcriptome and Proteomics Data. Ph.D. Thesis, Gansu Agricultural University, Lanzhou, China, 2021. [Google Scholar] [CrossRef]
- Zeremski, M.; Petrovic, L.M.; Chiriboga, L.; Brown, Q.B.; Yee, H.T.; Kinkhabwala, M.; Jacobson, I.M.; Dimova, R.; Markatou, M.; Talal, A.H. Intrahepatic levels of CXCR3-associated chemokines correlate with liver inflammation and fibrosis in chronic hepatitis C. Hepatology 2008, 48, 1440–1450. [Google Scholar] [CrossRef] [PubMed]
- Korbecki, J.; Kojder, K.; Kapczuk, P.; Kupnicka, P.; Gawrońska-Szklarz, B.; Gutowska, I.; Chlubek, D.; Baranowska-Bosiacka, I. The Effect of Hypoxia on the Expression of CXC Chemokines and CXC Chemokine Receptors-A Review of Literature. Int. J. Mol. Sci. 2021, 22, 843. [Google Scholar] [CrossRef]
- Sui, Y.; Potula, R.; Dhillon, N.; Pinson, D.; Li, S.; Nath, A.; Anderson, C.; Turchan, J.; Kolson, D.; Narayan, O.; et al. Neuronal apoptosis is mediated by CXCL10 overexpression in simian human immunodeficiency virus encephalitis. Am. J. Pathol. 2004, 164, 1557–1566. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Li, J.; Liu, H.; Xi, Y.; Xue, M.; Liu, W.; Zhuang, Z.; Lei, M. Dynamic transcriptome profiles of skeletal muscle tissue across 11 developmental stages for both Tongcheng and Yorkshire pigs. BMC Genom. 2015, 16, 377. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Zhao, Y.; Meng, J.; Wu, Z.; An, Q. In silico cloning and bioinformatics analysis of goat pro-to-oncogene c-fos. Jiangsu Agric. Sci. 2022, 50, 68–73. [Google Scholar]
- Briso, E.M.; Guinea-Viniegra, J.; Bakiri, L.; Rogon, Z.; Petzelbauer, P.; Eils, R.; Wolf, R.; Rincón, M.; Angel, P.; Wagner, E.F. Inflammation-mediated skin tumorigenesis induced by epidermal c-Fos. Genes Dev. 2013, 27, 1959–1973. [Google Scholar] [CrossRef]
- Kwack, M.H.; Ahn, J.S.; Kim, M.K.; Kim, J.C.; Sung, Y.K. Dihydrotestosterone-inducible IL-6 inhibits elongation of human hair shafts by suppressing matrix cell proliferation and promotes regression of hair follicles in mice. J. Investig. Dermatol. 2012, 132, 43–49. [Google Scholar] [CrossRef]
- Sander, G.; Bawden, C.S.; Hynd, P.I.; Nesci, A.; Rogers, G.; Powell, B.C. Expression of the homeobox gene, Barx2, in wool follicle development. J. Investig. Dermatol. 2000, 115, 753–756. [Google Scholar] [CrossRef]
- Qiu, W.; Lei, M.; Tang, H.; Yan, H.; Wen, X.; Zhang, W.; Tan, R.; Wang, D.; Wu, J. Hoxc13 is a crucial regulator of murine hair cycle. Cell Tissue Res. 2016, 364, 149–158. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Lu, B.; Zamponi, R.; Yang, Z.; Wetzel, K.; Loureiro, J.; Mohammadi, S.; Beibel, M.; Bergling, S.; Reece-Hoyes, J.; et al. mTORC1 signaling suppresses Wnt/β-catenin signaling through DVL-dependent regulation of Wnt receptor FZD level. Proc. Natl. Acad. Sci. USA 2018, 115, e10362–e10369. [Google Scholar] [CrossRef] [PubMed]
- Tripurani, S.K.; Wang, Y.; Fan, Y.X.; Rahimi, M.; Wong, L.; Lee, M.H.; Starost, M.F.; Rubin, J.S.; Johnson, G.R. Suppression of Wnt/β-catenin signaling by EGF receptor is required for hair follicle development. Mol. Biol. Cell 2018, 29, 2784–2799. [Google Scholar] [CrossRef] [PubMed]
- Wua, C.; Qin, C.; Fu, X.; Zhao, B.; Wu, Y.; He, J.; Mao, J.; Liu, J.; Huang, X.; Tian, K. Correlation analysis of four KRTAP gene polymorphisms and cashmere fiber diameters in two cashmere goat breeds. Can. J. Anim. Sci. 2022, 102, 561–570. [Google Scholar] [CrossRef]
- Vignal, A.; Milan, D.; SanCristobal, M.; Eggen, A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet Sel. Evol. 2002, 34, 275–305. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y. A brief history of the development of molecular markers. Mod. Agric. Sci. Technol. 2009, 264–270. [Google Scholar]
- Kang, Y.; Ye, S.; Zhao, Q.; Pu, Y.; Guan, W.; Ma, Y. Research progress on protection methods of livestock and poultry genetic resources. China Anim. Husb. Vet. Med. 2013, 40, 208–212. [Google Scholar]
- Zhao, Q.; Kim, T.; Pang, J.; Sun, W.; Yang, X.; Wang, J.; Song, Y.; Zhang, H.; Sun, H.; Rangan, V.; et al. A novel function of CXCL10 in mediating monocyte production of proinflammatory cytokines. J. Leukoc. Biol. 2017, 102, 1271–1280. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.; Yu, C.; Huang, J.; Rong, Y.; Chen, J.; Chen, M. Bioinformatics analysis of vascular RNA-seq data revealed hub genes and pathways in a novel Tibetan minipig atherosclerosis model induced by a high-fat/cholesterol diet. Lipids Health Dis. 2020, 19, 54. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Fu, X.; Suolangda; Ba, G.; Deji; Cirendeji; Song, T.; Tian, K. Genetic effect analysis of WNT4 and HOXC13 genes on down fiber diameter traits in Tibetan cashmere goats. China Anim. Husb. Vet. Med. 2020, 47, 497–505. [Google Scholar]
- Ito, T.; Hashizume, H.; Shimauchi, T.; Funakoshi, A.; Ito, N.; Fukamizu, H.; Takigawa, M.; Tokura, Y. CXCL10 produced from hair follicles induces Th1 and Tc1 cell infiltration in the acute phase of alopecia areata, followed by sustained Tc1 accumulation in the chronic phase. J. Dermatol. Sci. 2013, 69, 140–147. [Google Scholar] [CrossRef] [PubMed]
- Zainodini, N.; Hassanshahi, G.; Arababadi, M.K.; Khorramdelazad, H.; Mirzaei, A. Differential expression of CXCL1, CXCL9, CXCL10 and CXCL12 chemokines in alopecia areata. Iran J. Immunol. 2013, 10, 40–46. [Google Scholar]
- Lefebvre, S.; Fliniaux, I.; Schneider, P.; Mikkola, M.L. Identification of ectodysplasin target genes reveals the involvement of chemokines in hair development. J. Investig. Dermatol. 2012, 132, 1094–1102. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Li, J.; Liu, R.; Zhang, Y.; Luo, W.; Cai, H. Study on polymorphism of CXCL10 gene in three goat breeds using DNA pool. Heilongjiang Anim. Sci. Vet. Med. 2012, 44–46. [Google Scholar]
- Feng, S. Screening and Verification of Key Genes and lncRNA Related to Cashmere Shedding in Cashmere Goats. Master’s Thesis, Shenyang Agricultural University, Shenyang, China, 2023. [Google Scholar]
- Morris, B.J. Stimulation of immediate early gene expression in striatal neurons by nitric oxide. J. Biol. Chem. 1995, 270, 24740–24744. [Google Scholar] [CrossRef]
- Song, P.S.; Kong, K.M.; Niu, C.Y.; Qi, W.L.; Wu, L.F.; Wang, X.J.; Han, W.; Huang, K.; Chen, Z.F. Expression of c-fos in gastric myenteric plexus and spinal cord of rats with cervical spondylosis. World J. Gastroenterol. 2005, 11, 529–533. [Google Scholar] [CrossRef]
- Ahlawat, S.; Arora, R.; Sharma, R.; Sharma, U.; Kaur, M.; Kumar, A.; Singh, K.V.; Singh, M.K.; Vijh, R.K. Skin transcriptome profiling of Changthangi goats highlights the relevance of genes involved in Pashmina production. Sci. Rep. 2020, 10, 6050. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Reiner, G.; Heinricy, L.; Brenig, B.; Geldermann, H.; Dzapo, V. Cloning, structural organization, and chromosomal assignment of the porcine c-fos proto-oncogene, FOS. Cytogenet. Cell Genet. 2000, 89, 59–61. [Google Scholar] [CrossRef]
- Krumlauf, R. HOX genes in vertebrate development. Cell 1994, 78, 191–201. [Google Scholar] [CrossRef] [PubMed]
- Capecchi, M.R. HOX genes and mammalian development. Cold Spring Harb. Symp. Quant. Biol. 1997, 62, 273–281. [Google Scholar] [PubMed]
- Daftary, G.S.; Taylor, H.S. Endocrine regulation of HOX genes. Endocr. Rev. 2006, 27, 331–355. [Google Scholar] [CrossRef] [PubMed]
- Minguillon, C.; Nishimoto, S.; Wood, S.; Vendrell, E.; Gibson-Brown, J.J.; Logan, M.P. HOX genes regulate the onset of Tbx5 expression in the forelimb. Development 2012, 139, 3180–3188. [Google Scholar] [CrossRef] [PubMed]
- Morgan, B.A. HOX genes and embryonic development. Poult. Sci. 1997, 76, 96–104. [Google Scholar] [CrossRef]
- Jave-Suarez, L.F.; Winter, H.; Langbein, L.; Rogers, M.A.; Schweizer, J. HOXC13 is involved in the regulation of human hair keratin gene expression. J. Biol. Chem. 2002, 277, 3718–3726. [Google Scholar] [CrossRef] [PubMed]
- Godwin, A.R.; Capecchi, M.R. Hoxc13 mutant mice lack external hair. Genes Dev. 1998, 12, 11–20. [Google Scholar] [CrossRef]
- Shang, L.; Pruett, N.D.; Awgulewitsch, A. Hoxc12 expression pattern in developing and cycling murine hair follicles. Mech. Dev. 2002, 113, 207–210. [Google Scholar] [CrossRef]
- Farooq, M.; Kurban, M.; Fujimoto, A.; Fujikawa, H.; Abbas, O.; Nemer, G.; Saliba, J.; Sleiman, R.; Tofaili, M.; Kibbi, A.G.; et al. A homozygous frameshift mutation in the HOXC13 gene underlies pure hair and nail ectodermal dysplasia in a Syrian family. Hum. Mutat. 2013, 34, 578–581. [Google Scholar]
- Lin, Z.; Chen, Q.; Shi, L.; Lee, M.; Giehl, K.A.; Tang, Z.; Wang, H.; Zhang, J.; Yin, J.; Wu, L.; et al. Loss-of-function mutations in HOXC13 cause pure hair and nail ectodermal dysplasia. Am. J. Hum. Genet. 2012, 91, 906–911. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Orseth, M.L.; Smith, J.M.; Brehm, M.A.; Agim, N.G.; Glass, D.A., 2nd. A Novel Homozygous Missense Mutation in HOXC13 Leads to Autosomal Recessive Pure Hair and Nail Ectodermal Dysplasia. Pediatr. Dermatol. 2017, 34, 172–175. [Google Scholar] [CrossRef] [PubMed]
- Yu, H. Genetic Variations of KAP Gene Family and Hoxc13 Gene in Cashmere Goats and Their Effects on Cashmere Production Traits. Master’s Thesis, Northwest A&F University, Xianyang, China, 2009. [Google Scholar]
- Zhang, D. Cloning, Genetic Diversity and Expression Analysis of Hoxc13, KAP9.2, TGF-βI and TGF-βRI Genes in Tibetan Cashmere Goats. Master’s Thesis, Sichuan Agricultural University, Chengdu, China, 2018. [Google Scholar]
- Gao, Y.; Wang, X.; Yan, H.; Zeng, J.; Ma, S.; Niu, Y.; Zhou, G.; Jiang, Y.; Chen, Y. Comparative Transcriptome Analysis of Fetal Skin Reveals Key Genes Related to Hair Follicle Morphogenesis in Cashmere Goats. PLoS ONE 2016, 11, e0151118. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Frank, J.; Pignata, C.; Panteleyev, A.A.; Prowse, D.M.; Baden, H.; Weiner, L.; Gaetaniello, L.; Ahmad, W.; Pozzi, N.; Cserhalmi-Friedman, P.B.; et al. Exposing the human nude phenotype. Nature 1999, 398, 473–474. [Google Scholar] [CrossRef]
- Feng, S.S. Preliminary Study on Epigenetics of Hair Follicle Development in Cashmere Goats Based on Methylation and lncRNA. Master’s Thesis, Northwest A&F University, Xianyang, China, 2016. [Google Scholar]
- Cheng, W.Z.; Tang, C.G.; Song, X.F. Expression of Wnt4 protein in rat kidney development. Tianjin Med. J. 2015, 43, 1125–1127+1221. [Google Scholar]
- Wei, T.L.; Zhu, X.K. Wnt signaling pathway and thymus development. Curr. Immunol. 2012, 32, 523–526+518.49. [Google Scholar]
- Wang, P.; Li, W.; Liu, Z.; He, X.; Hong, Q.; Lan, R.; Liu, Y.; Chu, M. Identification of WNT4 alternative splicing patterns and effects on proliferation of granulosa cells in goat. Int. J. Biol. Macromol. 2022, 223 Pt A, 1230–1242. [Google Scholar] [CrossRef]
| Gene Name | Length/bp | Primer |
|---|---|---|
| CXCL10 | 420 | F: TTTGTCTTACATAGCCTGCAGAACA |
| R: CTTCTTCCCCTTTCCAATCTTTCTA | ||
| FOS | 432 | F: ACACAGATCCCTTATGTCTGGTCTC |
| R: TGATAGTCTCACCCTAAGAAATGCC | ||
| HOXC13 | 311 | F: CACGACAGTGAAAACAAATTAGTGG |
| R: CTCTAATCTTAGGTTCTTGAGGCCC | ||
| WNT4 | 382 | F: ACAGCCACACTTCTCCAGCTC |
| R: GAAAATGGGGATGACAGTTGTACTT |
| Trait | N | Min | Max | Mean | SD | CV |
|---|---|---|---|---|---|---|
| BW, kg | 346 | 1.2 | 4.2 | 2.74 | 0.77 | 28.10 |
| YW, kg | 347 | 13 | 33 | 21.68 | 3.53 | 16.28 |
| FW, g | 344 | 160 | 675 | 411.84 | 101.76 | 24.71 |
| PDW, kg | 351 | 16 | 36 | 26.01 | 3.42 | 13.15 |
| MFD, | 351 | 11.7 | 18.9 | 15.67 | 1.17 | 7.46 |
| FDSD | 353 | 2.4 | 4 | 3.26 | 0.25 | 7.67 |
| CVFD | 353 | 16.9 | 25.2 | 20.85 | 1.44 | - |
| Gene | SNP | Position | Nucleotide Variation | Amino Acid Variation |
|---|---|---|---|---|
| CXCL10 | SNP1 | 6:91399380 | A → G | - |
| SNP2 | 6:91399532 | C → T | - | |
| SNP3 | 6:91399379 | C → T | - | |
| SNP4 | 6:91399401 | A → G | - | |
| SNP5 | 6:91399473 | T → C | - | |
| FOS | SNP6 | 10:16633885 | G → T | - |
| SNP7 | 10:16633856 | A → ins_A | - | |
| SNP8 | 10:16633782 | G → A | - | |
| HOXC13 | SNP9 | 5:25823773 | A → T | - |
| SNP10 | 5:25823481 | G → A | - | |
| SNP11 | 5:25823671 | C → T | - | |
| WNT4 | SNP12 | 2:5248863 | C → T | - |
| SNP13 | 2:5248500 | C → T | - | |
| SNP14 | 2:5248554 | T → C | S |
| Gene | SNPs | Genotype | Freq | Allele_P | Allele_Q | He | Ne | HWE p-Value |
|---|---|---|---|---|---|---|---|---|
| CXCL10 | SNP1 | AA (129) | 0.4510 | 0.5052 | 0.4948 | 0.4999 | 1.9998 | 0.0000 |
| AG (31) | 0.4406 | |||||||
| GG (126) | 0.1084 | |||||||
| SNP2 | CC (200) | 0.7168 | 0.7294 | 0.2706 | 0.3948 | 1.6522 | 0.0000 | |
| CT (7) | 0.2581 | |||||||
| TT (72) | 0.0251 | |||||||
| SNP3 | CC (180) | 0.6383 | 0.7996 | 0.2004 | 0.3204 | 1.4715 | 0.9053 | |
| CT (91) | 0.0390 | |||||||
| TT (11) | 0.3227 | |||||||
| SNP4 | AA (266) | 0.9301 | 0.9633 | 0.0367 | 0.0707 | 1.0761 | 0.3042 | |
| AG (19) | 0.0035 | |||||||
| GG (1) | 0.0664 | |||||||
| SNP5 | CC (1) | 0.0031 | 0.0109 | 0.9891 | 0.0216 | 1.0220 | 0.0000 | |
| CT (5) | 0.9813 | |||||||
| TT (315) | 0.0156 | |||||||
| FOS | SNP6 | TT (0) | 0.0000 | 0.0417 | 0.9583 | 0.0799 | 1.0868 | 0.7942 |
| GT (3) | 0.9167 | |||||||
| GG (33) | 0.0833 | |||||||
| SNP7 | AA (260) | 0.7365 | 0.7365 | 0.2635 | 0.3881 | 1.6342 | 0.0000 | |
| Ains_A (93) | 0.2635 | |||||||
| 0.0000 | ||||||||
| SNP8 | AA (87) | 0.2465 | 0.5340 | 0.4660 | 0.4977 | 1.9908 | 0.0035 | |
| AG (203) | 0.1785 | |||||||
| GG (63) | 0.5751 | |||||||
| HOXC13 | SNP9 | AA (205) | 0.8613 | 0.8613 | 0.1387 | 0.2389 | 1.3138 | 0.0000 |
| AT (33) | 0.0000 | |||||||
| TT (0) | 0.1387 | |||||||
| SNP10 | AA (0) | 0.0000 | 0.0938 | 0.9062 | 0.1699 | 1.2047 | 0.0642 | |
| AG (60) | 0.8125 | |||||||
| GG (260) | 0.1875 | |||||||
| SNP11 | CC (146) | 0.4136 | 0.6487 | 0.3513 | 0.4558 | 1.8374 | 0.5502 | |
| CT (166) | 0.1161 | |||||||
| TT (41) | 0.4703 | |||||||
| WNT4 | SNP12 | CC (335) | 0.9824 | 0.9912 | 0.0088 | 0.0174 | 1.0178 | 0.8698 |
| CT (6) | 0.0000 | |||||||
| TT (0) | 0.0176 | |||||||
| SNP13 | CC (301) | 0.9495 | 0.9748 | 0.0252 | 0.0492 | 1.0517 | 0.6448 | |
| CT (16) | 0.0000 | |||||||
| TT (0) | 0.0505 | |||||||
| SNP14 | CC (87) | 0.2465 | 0.5000 | 0.5000 | 0.5000 | 2.0000 | 0.7901 | |
| CT (179) | 0.2465 | |||||||
| TT (87) | 0.5071 |
| Gene | SNPs | Genotype | BW/kg | YW/kg | FW/g | PDW/kg | MFD/μm | FDSD | CVFD |
|---|---|---|---|---|---|---|---|---|---|
| CXCL10 | SNP1 | AA | 2.72 ± 0.08 | 21.77 ± 0.4 | 427.07 ± 10.53 | 26.18 ± 0.35 | 15.65 ± 0.10 | 3.24 ± 0.02 | 20.78 ± 0.13 |
| AG | 2.66 ± 0.08 | 21.20 ± 0.4 | 407.18 ± 10.53 | 26.12 ± 0.35 | 15.74 ± 0.10 | 3.28 ± 0.02 | 20.88 ± 0.13 | ||
| GG | 2.84 ± 0.15 | 20.88 ± 0.81 | 391.52 ± 21.32 | 24.97 ± 0.71 | 15.91 ± 0.21 | 3.30 ± 0.05 | 20.74 ± 0.26 | ||
| SNP2 | CC | 2.73 ± 0.06 | 21.44 ± 0.32 | 419.72 ± 8.46 | 25.90 ± 0.28 | 15.77 ± 0.08 | 3.28 ± 0.02 | 20.86 ± 0.10 | |
| CT | 2.70 ± 0.10 | 21.29 ± 0.53 | 402.17 ± 13.96 | 26.42 ± 0.46 | 15.66 ± 0.14 | 3.23 ± 0.03 | 20.70 ± 0.17 | ||
| TT | 2.47 ± 0.33 | 22.64 ± 1.71 | 462.46 ± 44.84 | 26.82 ± 1.49 | 15.44 ± 0.44 | 3.22 ± 0.10 | 20.70 ± 0.54 | ||
| SNP3 | CC | 2.76 ± 0.06 | 21.61 ± 0.34 | 410.62 ± 8.94 | 26.32 ± 0.30 | 15.63 ± 0.09 | 3.25 ± 0.02 | 20.87 ± 0.11 | |
| CT | 2.59 ± 0.09 | 21.14 ± 0.47 | 428.81 ± 12.40 | 25.69 ± 0.41 | 15.87 ± 0.12 | 3.28 ± 0.02 | 20.77 ± 0.15 | ||
| TT | 2.69 ± 0.26 | 19.94 ± 1.36 | 379.63 ± 35.75 | 23.99 ± 1.18 | 15.83 ± 0.35 | 3.27 ± 0.08 | 20.66 ± 0.43 | ||
| SNP4 | AA | 2.71 ± 0.05 | 21.37 ± 0.28 | 416.64 ± 7.36 | 25.97 ± 0.24 | 15.71 ± 0.07 | 3.26 ± 0.02 | 20.83 ± 0.09 | |
| AG | 2.66 ± 0.20 | 22.02 ± 1.04 | 379.95 ± 27.29 | 26.73 ± 0.90 | 15.72 ± 0.27 | 3.22 ± 0.06 | 20.52 ± 0.33 | ||
| GG | 2.07 ± 0.86 | 24.03 ± 4.51 | 384.17 ± 118.34 | 31.39 ± 3.92 | 14.63 ± 1.18 | 3.39 ± 0.25 | 23.22 ± 1.42 | ||
| FOS | SNP7 | AA | 2.67 ± 0.05 | 21.14 ± 0.28 | 414.63 ± 7.43 | 26.05 ± 0.25 | 15.64 ± 0.07 | 3.25 ± 0.02 | 20.83 ± 0.09 |
| Ains_A | 2.79 ± 0.09 | 21.67 ± 0.47 | 415.66 ± 12.28 | 25.60 ± 0.41 | 15.71 ± 0.12 | 3.29 ± 0.03 | 21.00 ± 0.15 | ||
| SNP8 | AA | 2.83 ± 0.09 | 20.89 ± 0.48 | 436.33 ± 12.64 | 25.80 ± 0.42 | 15.70 ± 0.13 | 3.24 ± 0.03 | 20.71 ± 0.15 | |
| GA | 2.65 ± 0.06 | 21.55 ± 0.32 | 406.87 ± 8.34 | 25.73 ± 0.28 | 15.64 ± 0.08 | 3.26 ± 0.02 | 20.88 ± 0.10 | ||
| GG | 2.62 ± 0.10 | 20.97 ± 0.57 | 411.00 ± 14.86 | 26.74 ± 0.49 | 15.64 ± 0.15 | 3.29 ± 0.03 | 21.07 ± 0.18 | ||
| HOXC13 | SNP9 | AA | 2.59 ± 0.06 a | 20.95 ± 0.31 | 412.13 ± 8.29 | 25.59 ± 0.27 | 15.62 ± 0.08 a | 3.24 ± 0.02 | 20.80 ± 0.10 |
| AT | 2.92 ± 0.15 b | 20.98 ± 0.78 | 433.99 ± 20.54 | 26.98 ± 0.67 | 16.06 ± 0.20 b | 3.30 ± 0.04 | 20.70 ± 0.25 | ||
| SNP10 | GG | 2.64 ± 0.05 | 20.94 ± 0.28 a | 419.59 ± 7.41 | 26.91 ± 0.25 | 15.66 ± 0.07 | 3.26 ± 0.05 | 20.89 ± 0.26 | |
| AG | 2.80 ± 0.11 | 22.33 ± 0.58 b | 407.86 ± 15.21 | 25.54 ± 0.51 | 15.66 ± 0.15 | 3.26 ± 0.03 | 20.87 ± 0.18 | ||
| SNP11 | CC | 2.72 ± 0.07 | 21.46 ± 0.38 | 413.57 ± 9.87 | 26.11 ± 0.33 | 15.68 ± 0.10 | 3.26 ± 0.02 | 20.84 ± 0.12 | |
| CT | 2.67 ± 0.07 | 21.20 ± 0.35 | 419.03 ± 9.24 | 25.74 ± 0.31 | 15.69 ± 0.09 | 3.28 ± 0.02 | 20.93 ± 0.11 | ||
| TT | 2.64 ± 0.13 | 20.98 ± 0.71 | 403.03 ± 18.49 | 26.06 ± 0.61 | 15.42 ± 0.18 | 3.19 ± 0.04 | 20.73 ± 0.22 | ||
| WNT4 | SNP14 | CC | 2.87 ± 0.09 Aa | 21.42 ± 0.48 | 425.08 ± 12.66 | 25.68 ± 0.42 | 15.69 ± 0.13 | 3.29 ± 0.03 | 21.00 ± 0.15 |
| CT | 2.58 ± 0.06 Bb | 21.15 ± 0.34 | 415.53 ± 8.88 | 26.07 ± 0.30 | 15.62 ± 0.09 | 3.25 ± 0.02 | 20.88 ± 0.11 | ||
| TT | 2.72 ± 0.09 Aa | 21.42 ± 0.49 | 403.02 ± 12.78 | 25.89 ± 0.43 | 15.69 ± 0.13 | 3.24 ± 0.03 | 20.70 ± 0.15 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Amar, G.; Lu, Q.; Anwar, A.; Tang, S.; Yan, Q.; Wu, C.; Fu, X. Correlation Analysis of CXCL10, FOS, HOXC13, and WNT4 Gene Polymorphisms with Key Economic Traits—Initial Population Screening for Jiangnan Cashmere Goats. Genes 2025, 16, 1097. https://doi.org/10.3390/genes16091097
Amar G, Lu Q, Anwar A, Tang S, Yan Q, Wu C, Fu X. Correlation Analysis of CXCL10, FOS, HOXC13, and WNT4 Gene Polymorphisms with Key Economic Traits—Initial Population Screening for Jiangnan Cashmere Goats. Genes. 2025; 16(9):1097. https://doi.org/10.3390/genes16091097
Chicago/Turabian StyleAmar, Gvlnigar, Qingwei Lu, Asma Anwar, Sen Tang, Qingfa Yan, Cuiling Wu, and Xuefeng Fu. 2025. "Correlation Analysis of CXCL10, FOS, HOXC13, and WNT4 Gene Polymorphisms with Key Economic Traits—Initial Population Screening for Jiangnan Cashmere Goats" Genes 16, no. 9: 1097. https://doi.org/10.3390/genes16091097
APA StyleAmar, G., Lu, Q., Anwar, A., Tang, S., Yan, Q., Wu, C., & Fu, X. (2025). Correlation Analysis of CXCL10, FOS, HOXC13, and WNT4 Gene Polymorphisms with Key Economic Traits—Initial Population Screening for Jiangnan Cashmere Goats. Genes, 16(9), 1097. https://doi.org/10.3390/genes16091097

