Swertianin Suppresses M1 Macrophage Polarization and Inflammation in Metabolic Dysfunction-Associated Fatty Liver Disease via PPARG Activation
Abstract
1. Introduction
2. Materials and Methods
2.1. Swertia Davidi Franch Acquisition
2.2. Chemical Composition Analysis of Swertia Davidi Franch Using UPLC-Q/TOF-MS
2.3. Bioinformatics Analysis of Traditional Chinese Medicine
2.4. Public Data Download
2.5. Analysis of DEGs and GO/KEGG Pathway Enrichment Analysis
2.6. Validation of Molecular Docking with AutoDock
2.7. Macrophage Culture and Treatment
2.8. CCK-8 Cytotoxicity Assay
2.9. siRNA Transfection
2.10. Western Blot Analysis
2.11. RT-qPCR Detection
2.12. Oil Red O Staining
2.13. ELISA Detection
2.14. Construction of Animal Models
2.15. NAS Score
2.16. Biochemical Analysis
2.17. H&E Staining
2.18. Immunofluorescence
2.19. Flow Cytometry to Assess M1 Polarization (CD86, iNOS, TNF-a)
2.20. Statistical Analysis
3. Results
3.1. Screening Key Chemical Components in Swertia Davidi Franch Using UPLC-Q/TOF-MS
3.2. Network Pharmacology Combined with Bioinformatics Analysis Reveals That the Key Component Swertianin from Swertia Davidi Franch May Regulate PPARG Expression
3.3. Swertianin Activates PPARG Expression to Inhibit M1-Type Macrophage Polarization
3.4. Swertianin Activates PPARG Expression to Suppress M1-Type Macrophage Polarization and Improve MASLD Lipid Deposition
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Powell, E.E.; Wong, V.W.-S.; Rinella, M. Non-Alcoholic Fatty Liver Disease. Lancet 2021, 397, 2212–2224. [Google Scholar] [CrossRef]
- Pouwels, S.; Sakran, N.; Graham, Y.; Leal, A.; Pintar, T.; Yang, W.; Kassir, R.; Singhal, R.; Mahawar, K.; Ramnarain, D. Non-Alcoholic Fatty Liver Disease (NAFLD): A Review of Pathophysiology, Clinical Management and Effects of Weight Loss. BMC Endocr. Disord. 2022, 22, 63. [Google Scholar] [CrossRef]
- Rong, L.; Zou, J.; Ran, W.; Qi, X.; Chen, Y.; Cui, H.; Guo, J. Advancements in the Treatment of Non-Alcoholic Fatty Liver Disease (NAFLD). Front. Endocrinol. 2023, 13, 1087260. [Google Scholar] [CrossRef]
- Valtuille, R. Cardiovascular Risk Related to Glomerular Hyperfiltration in Nondiabetic: Increasing Visibility Is Crucial. Curr. Hypertens. Rev. 2023, 19, 139–148. [Google Scholar] [CrossRef] [PubMed]
- Stefan, N.; Schick, F.; Birkenfeld, A.L.; Häring, H.-U.; White, M.F. The Role of Hepatokines in NAFLD. Cell Metab. 2023, 35, 236–252. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.; Pan, J.; Zhou, W.; Ji, G.; Dang, Y. Recent Advances in Lean NAFLD. Biomed. Pharmacother. 2022, 153, 113331. [Google Scholar] [CrossRef]
- Ning, D.; Jin, J.; Fang, Y.; Du, P.; Yuan, C.; Chen, J.; Huang, Q.; Cheng, K.; Mo, J.; Xu, L.; et al. DEAD-Box Helicase 17 Exacerbates Non-alcoholic Steatohepatitis via Transcriptional Repression of Cyp2c29, Inducing Hepatic Lipid Metabolism Disorder and Eliciting the Activation of M1 Macrophages. Clin. Transl. Med. 2024, 14, e1529. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Jia, X.; Qu, M.; Yang, X.; Fang, Y.; Ying, X.; Zhang, M.; Wei, J.; Pan, Y. Exploring the Potential of Treating Chronic Liver Disease Targeting the PI3K/Akt Pathway and Polarization Mechanism of Macrophages. Heliyon 2023, 9, e17116. [Google Scholar] [CrossRef] [PubMed]
- Cusi, K.; Isaacs, S.; Barb, D.; Basu, R.; Caprio, S.; Garvey, W.T.; Kashyap, S.; Mechanick, J.I.; Mouzaki, M.; Nadolsky, K.; et al. American Association of Clinical Endocrinology Clinical Practice Guideline for the Diagnosis and Management of Nonalcoholic Fatty Liver Disease in Primary Care and Endocrinology Clinical Settings. Endocr. Pract. 2022, 28, 528–562. [Google Scholar] [CrossRef]
- Ferguson, D.; Finck, B.N. Emerging Therapeutic Approaches for the Treatment of NAFLD and Type 2 Diabetes Mellitus. Nat. Rev. Endocrinol. 2021, 17, 484–495. [Google Scholar] [CrossRef]
- Foerster, F.; Gairing, S.J.; Müller, L.; Galle, P.R. NAFLD-Driven HCC: Safety and Efficacy of Current and Emerging Treatment Options. J. Hepatol. 2022, 76, 446–457. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Poulsen, K.L.; Wu, L.; Liu, S.; Miyata, T.; Song, Q.; Wei, Q.; Zhao, C.; Lin, C.; Yang, J. Targeted Therapeutics and Novel Signaling Pathways in Non-Alcohol-Associated Fatty Liver/Steatohepatitis (NAFL/NASH). Signal Transduct. Target. Ther. 2022, 7, 287. [Google Scholar] [CrossRef] [PubMed]
- Grander, C.; Grabherr, F.; Tilg, H. Non-Alcoholic Fatty Liver Disease: Pathophysiological Concepts and Treatment Options. Cardiovasc. Res. 2023, 119, 1787–1798. [Google Scholar] [CrossRef] [PubMed]
- Vancells Lujan, P.; Viñas Esmel, E.; Sacanella Meseguer, E. Overview of Non-Alcoholic Fatty Liver Disease (NAFLD) and the Role of Sugary Food Consumption and Other Dietary Components in Its Development. Nutrients 2021, 13, 1442. [Google Scholar] [CrossRef]
- Fang, T.; Wang, H.; Pan, X.; Little, P.J.; Xu, S.; Weng, J. Mouse Models of Nonalcoholic Fatty Liver Disease (NAFLD): Pathomechanisms and Pharmacotherapies. Int. J. Biol. Sci. 2022, 18, 5681–5697. [Google Scholar] [CrossRef]
- Fraile, J.M.; Palliyil, S.; Barelle, C.J.; Porter, A.J.; Kovaleva, M. Non-Alcoholic Steatohepatitis (NASH)—A Review of a Crowded Clinical Landscape, Driven by a Complex Disease. Drug Des. Dev. Ther. 2021, 15, 3997–4009. [Google Scholar] [CrossRef]
- Su, Z.Z.; He, Y.Y.; Chen, G. Clinical and Experimental Study on Effects of Man-Shen-Ling Oral Liquid in the Treatment of 100 Cases of Chronic Nephritis. Zhongguo Zhong Xi Yi Jie He Za Zhi. 1993, 13, 269–272, 259–260. [Google Scholar]
- Kumar, V.; Van Staden, J. A Review of Swertia Chirayita (Gentianaceae) as a Traditional Medicinal Plant. Front. Pharmacol. 2016, 6, 308. [Google Scholar] [CrossRef]
- Titus, C.; Hoque, M.T.; Bendayan, R. PPAR Agonists for the Treatment of Neuroinflammatory Diseases. Trends Pharmacol. Sci. 2024, 45, 9–23. [Google Scholar] [CrossRef]
- Tahri-Joutey, M.; Andreoletti, P.; Surapureddi, S.; Nasser, B.; Cherkaoui-Malki, M.; Latruffe, N. Mechanisms Mediating the Regulation of Peroxisomal Fatty Acid β-Oxidation by PPARα. Int. J. Mol. Sci. 2021, 22, 8969. [Google Scholar] [CrossRef]
- Lin, R.-T.; Sun, Q.-M.; Xin, X.; Ng, C.H.; Valenti, L.; Hu, Y.-Y.; Zheng, M.-H.; Feng, Q. Comparative Efficacy of THR-β Agonists, FGF-21 Analogues, GLP-1R Agonists, GLP-1-Based Polyagonists, and Pan-PPAR Agonists for MASLD: A Systematic Review and Network Meta-Analysis. Metabolism 2024, 161, 156043. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.; Liu, Q.; Ma, L.; Yan, C.; Zhang, H.; Zhou, Z.; Yi, W. Identification of Novel Organo-Se BTSA-Based Derivatives as Potent, Reversible, and Selective PPARγ Covalent Modulators for Antidiabetic Drug Discovery. J. Med. Chem. 2024, 68, 819–831. [Google Scholar] [CrossRef]
- Liu, S.; Zhang, H.; Li, Y.; Zhang, Y.; Bian, Y.; Zeng, Y.; Yao, X.; Wan, J.; Chen, X.; Li, J.; et al. S100A4 Enhances Protumor Macrophage Polarization by Control of PPAR-γ-Dependent Induction of Fatty Acid Oxidation. J. Immunother. Cancer 2021, 9, e002548. [Google Scholar] [CrossRef]
- Jia, W.; Lin, X.; Chen, X.; Li, H.; Zhang, X.; Zhang, Y.; Chen, Y.; Wang, B.; Chen, X.; Chen, J.; et al. Rujifang Inhibits Triple-Negative Breast Cancer Growth via the PI3K/AKT Pathway. J. Ethnopharmacol. 2024, 327, 118011. [Google Scholar] [CrossRef]
- Li, Z.; Dai, Y.; Wu, Z.; Li, G.; Pu, P.; Hu, C.; Zhou, L.; Zhu, K.; Shu, B.; Wang, Y.-J.; et al. Network Pharmacology Analysis and Animal Experiment Validation of Neuroinflammation Inhibition by Total Ginsenoside in Treating CSM. Phytomedicine 2024, 126, 155073. [Google Scholar] [CrossRef] [PubMed]
- Miao, Z.; Wang, W.; Miao, Z.; Cao, Q.; Xu, S. Role of Selenoprotein W in Participating in the Progression of Non-Alcoholic Fatty Liver Disease. Redox Biol. 2024, 71, 103114. [Google Scholar] [CrossRef]
- Wang, H.; Cheng, W.; Hu, P.; Ling, T.; Hu, C.; Chen, Y.; Zheng, Y.; Wang, J.; Zhao, T.; You, Q. Integrative Analysis Identifies Oxidative Stress Biomarkers in Non-Alcoholic Fatty Liver Disease via Machine Learning and Weighted Gene Co-Expression Network Analysis. Front. Immunol. 2024, 15, 1335112. [Google Scholar] [CrossRef]
- Gao, S.; Hu, J.; Wu, X.; Liang, Z. PMA Treated THP-1-Derived-IL-6 Promotes EMT of SW48 through STAT3/ERK-Dependent Activation of Wnt/β-Catenin Signaling Pathway. Biomed. Pharmacother. 2018, 108, 618–624. [Google Scholar] [CrossRef] [PubMed]
- Tedesco, S.; De Majo, F.; Kim, J.; Trenti, A.; Trevisi, L.; Fadini, G.P.; Bolego, C.; Zandstra, P.W.; Cignarella, A.; Vitiello, L. Convenience versus Biological Significance: Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived Macrophages When Studying in Vitro Polarization? Front. Pharmacol. 2018, 9, 71. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Hou, L.; Feng, X.; Zhu, Z.; Mi, Y.; He, Q.; Yin, K.; Zhao, G. IGFBPL1 Inhibits Macrophage Lipid Accumulation by Enhancing the Activation of IGR1R/LXRα/ABCG1 Pathway. Aging 2023, 15, 14791–14802. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Guo, H.; Song, A.; Huang, J.; Zhang, Y.; Jin, S.; Li, S.; Zhang, L.; Yang, C.; Yang, P. Progranulin Inhibits LPS-Induced Macrophage M1 Polarization via NF-KB and MAPK Pathways. BMC Immunol. 2020, 21, 32. [Google Scholar] [CrossRef]
- Ma, G.-G.; Shi, B.; Zhang, X.-P.; Qiu, Y.; Tu, G.-W.; Luo, Z. The Pathways and Mechanisms of Muramyl Dipeptide Transcellular Transport Mediated by PepT1 in Enterogenous Infection. Ann. Transl. Med. 2019, 7, 473. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Niimi, M.; Yang, D.; Liang, J.; Xu, J.; Kimura, T.; Mathew, A.V.; Guo, Y.; Fan, Y.; Zhu, T.; et al. Deficiency of Cholesteryl Ester Transfer Protein Protects Against Atherosclerosis in Rabbits. Arterioscler. Thromb. Vasc. Biol. 2017, 37, 1068–1075. [Google Scholar] [CrossRef]
- Flessa, C.-M.; Nasiri-Ansari, N.; Kyrou, I.; Leca, B.M.; Lianou, M.; Chatzigeorgiou, A.; Kaltsas, G.; Kassi, E.; Randeva, H.S. Genetic and Diet-Induced Animal Models for Non-Alcoholic Fatty Liver Disease (NAFLD) Research. Int. J. Mol. Sci. 2022, 23, 15791. [Google Scholar] [CrossRef] [PubMed]
- Si, M.D.; Wu, M.; Cheng, X.Z.; Ma, Z.H.; Zheng, Y.G.; Li, J.; Li, S.; Song, Y.X.; Ma, D. Swertia Mussotii Prevents High-Fat Diet-Induced Non-Alcoholic Fatty Liver Disease in Rats by Inhibiting Expression the TLR4/MyD88 and the Phosphorylation of NF-ΚB. Pharm. Biol. 2022, 60, 1960–1968. [Google Scholar] [CrossRef]
- Brunt, E.M.; Kleiner, D.E.; Wilson, L.A.; Belt, P.; Neuschwander-Tetri, B.A. Nonalcoholic Fatty Liver Disease (NAFLD) Activity Score and the Histopathologic Diagnosis in NAFLD: Distinct Clinicopathologic Meanings §Δ. Hepatology 2011, 53, 810–820. [Google Scholar] [CrossRef]
- He, S.; Jiang, X.; Yang, J.; Wu, Y.; Shi, J.; Wu, X.; Du, S.; Zhang, Y.; Gong, L.; Dong, S.; et al. Nicotinamide Mononucleotide Alleviates Endotoxin-Induced Acute Lung Injury by Modulating Macrophage Polarization via the SIRT1/NF-ΚB Pathway. Pharm. Biol. 2023, 62, 22–32. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.-C.; Zhu, W.; Li, S.-J.; Hu, W.; Zhang, J.; Zhuo, Y.; Zhang, H.; Wang, J.; Zhang, Y.; Huang, S.-X.; et al. FOXC1-Mediated LINC00301 Facilitates Tumor Progression and Triggers an Immune-Suppressing Microenvironment in Non-Small Cell Lung Cancer by Regulating the HIF1α Pathway. Genome Med. 2020, 12, 77. [Google Scholar] [CrossRef]
- Maeda, T.; Hiraki, M.; Jin, C.; Rajabi, H.; Tagde, A.; Alam, M.; Bouillez, A.; Hu, X.; Suzuki, Y.; Miyo, M.; et al. MUC1-C Induces PD-L1 and Immune Evasion in Triple-Negative Breast Cancer. Cancer Res. 2018, 78, 205–215. [Google Scholar] [CrossRef]
- Ji, D.; Song, C.; Li, Y.; Xia, J.; Wu, Y.; Jia, J.; Cui, X.; Yu, S.; Gu, J. Combination of Radiotherapy and Suppression of Tregs Enhances Abscopal Antitumor Effect and Inhibits Metastasis in Rectal Cancer. J. Immunother. Cancer 2020, 8, e000826. [Google Scholar] [CrossRef] [PubMed]
- Singh, P.P.; Ambika; Chauhan, S.M.S. Activity-Guided Isolation of Antioxidant Xanthones from Swertia Chirayita (Roxb.) H. Karsten (Gentianaceae). Nat. Prod. Res. 2011, 26, 1682–1686. [Google Scholar] [CrossRef]
- Cao, C.; Hu, B.; Wang, J.; Li, W.; Guo, L.; Sheng, J.; Zhang, C. Swertianin Promotes Anti-Tumor Activity by Facilitating Macrophage M1 Polarization via STING Signaling. Int. Immunopharmacol. 2024, 142, 113182. [Google Scholar] [CrossRef]
- Wang, L.; Jiang, Y.; Yu, Q.; Xiao, C.; Sun, J.; Weng, L.; Qiu, Y. Gentiopicroside Improves High-Fat Diet-Induced NAFLD in Association with Modulation of Host Serum Metabolome and Gut Microbiome in Mice. Front. Microbiol. 2023, 14, 1145430. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhu, Y.-Y.; Wang, L.; Teng, T.; Zhou, M.; Wang, S.-G.; Tian, Y.-Z.; Du, L.; Yin, X.-X.; Sun, Y. Mangiferin Ameliorates Fatty Liver via Modulation of Autophagy and Inflammation in High-Fat-Diet Induced Mice. Biomed. Pharmacother. 2017, 96, 328–335. [Google Scholar] [CrossRef]
- Besse-Patin, A.; Léveillé, M.; Oropeza, D.; Nguyen, B.N.; Prat, A.; Estall, J.L. Estrogen Signals Through Peroxisome Proliferator-Activated Receptor−γ Coactivator 1α to Reduce Oxidative Damage Associated With Diet-Induced Fatty Liver Disease. Gastroenterology 2017, 152, 243–256. [Google Scholar] [CrossRef] [PubMed]
- Park, H.-S.; Song, J.-W.; Park, J.-H.; Lim, B.-K.; Moon, O.-S.; Son, H.-Y.; Lee, J.-H.; Gao, B.; Won, Y.-S.; Kwon, H.-J. TXNIP/VDUP1 Attenuates Steatohepatitis via Autophagy and Fatty Acid Oxidation. Autophagy 2020, 17, 2549–2564. [Google Scholar] [CrossRef]
- Vujkovic, M.; Ramdas, S.; Lorenz, K.M.; Guo, X.; Darlay, R.; Cordell, H.J.; He, J.; Gindin, Y.; Chung, C.; Myers, R.P.; et al. A Multiancestry Genome-Wide Association Study of Unexplained Chronic ALT Elevation as a Proxy for Nonalcoholic Fatty Liver Disease with Histological and Radiological Validation. Nat. Genet. 2022, 54, 761–771. [Google Scholar] [CrossRef]
- Wang, C.; Ma, C.; Gong, L.; Guo, Y.; Fu, K.; Zhang, Y.; Zhou, H.; Li, Y. Macrophage Polarization and Its Role in Liver Disease. Front. Immunol. 2021, 12, 803037. [Google Scholar] [CrossRef]
- Fan, N.; Zhang, X.; Zhao, W.; Zhao, J.; Luo, D.; Sun, Y.; Li, D.; Zhao, C.; Wang, Y.; Zhang, H.; et al. Covalent Inhibition of Pyruvate Kinase M2 Reprograms Metabolic and Inflammatory Pathways in Hepatic Macrophages against Non-Alcoholic Fatty Liver Disease. Int. J. Biol. Sci. 2022, 18, 5260–5275. [Google Scholar] [CrossRef]
- Dong, X.C. Sirtuin 6—A Key Regulator of Hepatic Lipid Metabolism and Liver Health. Cells 2023, 12, 663. [Google Scholar] [CrossRef] [PubMed]
- Kökény, G.; Calvier, L.; Hansmann, G. PPARγ and TGFβ—Major Regulators of Metabolism, Inflammation, and Fibrosis in the Lungs and Kidneys. Int. J. Mol. Sci. 2021, 22, 10431. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Jiang, L.; Chen, H.; Wei, S.; Yao, K.; Sun, X.; Yang, G.; Jiang, L.; Zhang, C.; Wang, N.; et al. Resveratrol Protected Acrolein-Induced Ferroptosis and Insulin Secretion Dysfunction via ER-Stress- Related PERK Pathway in MIN6 Cells. Toxicology 2022, 465, 153048. [Google Scholar] [CrossRef]
- He, Y.; Zhang, R.; Yu, L.; Zahr, T.; Li, X.; Kim, T.-W.; Qiang, L. PPARγ Acetylation in Adipocytes Exacerbates BAT Whitening and Worsens Age-Associated Metabolic Dysfunction. Cells 2023, 12, 1424. [Google Scholar] [CrossRef]
- Chen, H.; Tan, H.; Wan, J.; Zeng, Y.; Wang, J.; Wang, H.; Lu, X. PPAR-γ Signaling in Nonalcoholic Fatty Liver Disease: Pathogenesis and Therapeutic Targets. Pharmacol. Ther. 2023, 245, 108391. [Google Scholar] [CrossRef]
- Qiao, Y.; Li, X.; Zhang, X.; Xiao, F.; Zhu, Y.; Fang, Z.; Sun, J. Hepatocellular INOS Protects Liver from NASH through Nrf2-Dependent Activation of HO-1. Biochem. Biophys. Res. Commun. 2019, 514, 372–378. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.-M.; Wang, Q.-M.; Huang, B.-Y.; Mai, C.-T.; Wang, C.-L.; Wang, T.-T.; Zhang, X.-J. Dioscin Ameliorates Murine Ulcerative Colitis by Regulating Macrophage Polarization. Pharmacol. Res. 2021, 172, 105796. [Google Scholar] [CrossRef]
- Stark, J.M.; Coquet, J.M.; Tibbitt, C.A. The Role of PPAR-γ in Allergic Disease. Curr. Allergy Asthma Rep. 2021, 21, 45. [Google Scholar] [CrossRef]
- Huang, X.; Li, Y.; Fu, M.; Xin, H.-B. Polarizing Macrophages In Vitro. Methods Mol. Biol. 2018, 1784, 119–126. [Google Scholar]
- Wang, K.; Brems, J.J.; Gamelli, R.L.; Holterman, A.-X. INOS/NO Signaling Regulates Apoptosis Induced by Glycochenodeoxycholate in Hepatocytes. Cell Signal. 2011, 23, 1677–1685. [Google Scholar] [CrossRef]
- Bonnardel, J.; T’Jonck, W.; Gaublomme, D.; Browaeys, R.; Scott, C.L.; Martens, L.; Vanneste, B.; De Prijck, S.; Nedospasov, S.A.; Kremer, A.; et al. Stellate Cells, Hepatocytes, and Endothelial Cells Imprint the Kupffer Cell Identity on Monocytes Colonizing the Liver Macrophage Niche. Immunity 2019, 51, 638–654.e9. [Google Scholar] [CrossRef] [PubMed]





| Genes | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
|---|---|---|
| GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
| TNF-α | CCTCTCTCTAATCAGCCCTCTG | GAGGACCTGGGAGTAGATGAG |
| iNOS | AGGGACAAGCCTACCCCTC | CTCATCTCCCGTCAGTTGGT |
| PPARG | GGGATCAGCTCCGTGGATCT | TGCACTTTGGTACTCTTGAAGTT |
| Genes | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
|---|---|---|
| GAPDH | AGGTCGGTGTGAACGGATTTG | GGGGTCGTTGATGGCAACA |
| TNF-α | CTGAACTTCGGGGTGATCGG | GGCTTGTCACTCGAATTTTGAGA |
| iNOS | ACATCGACCCGTCCACAGTAT | CAGAGGGGTAGGCTTGTCTC |
| PPARG | CTCCAAGAATACCAAAGTGCGA | GCCTGATGCTTTATCCCCACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xia, J.; Xiong, W.; Yang, C.; Tan, Y.; Peng, X.; Wang, W. Swertianin Suppresses M1 Macrophage Polarization and Inflammation in Metabolic Dysfunction-Associated Fatty Liver Disease via PPARG Activation. Genes 2025, 16, 693. https://doi.org/10.3390/genes16060693
Xia J, Xiong W, Yang C, Tan Y, Peng X, Wang W. Swertianin Suppresses M1 Macrophage Polarization and Inflammation in Metabolic Dysfunction-Associated Fatty Liver Disease via PPARG Activation. Genes. 2025; 16(6):693. https://doi.org/10.3390/genes16060693
Chicago/Turabian StyleXia, Jing, Wei Xiong, Ce Yang, Ying Tan, Xiaoyuan Peng, and Wenxiang Wang. 2025. "Swertianin Suppresses M1 Macrophage Polarization and Inflammation in Metabolic Dysfunction-Associated Fatty Liver Disease via PPARG Activation" Genes 16, no. 6: 693. https://doi.org/10.3390/genes16060693
APA StyleXia, J., Xiong, W., Yang, C., Tan, Y., Peng, X., & Wang, W. (2025). Swertianin Suppresses M1 Macrophage Polarization and Inflammation in Metabolic Dysfunction-Associated Fatty Liver Disease via PPARG Activation. Genes, 16(6), 693. https://doi.org/10.3390/genes16060693

