Type 1 Diabetes Risk Variants Reduce Beta Cell Function
Abstract
1. Introduction
2. Methods
2.1. Cell Culture and Treatment
2.2. CRISPR/Cas9 Construct Generation and Transfection
2.3. Verification of CRISPR/Cas9 Efficiency
2.4. Cell Treatments
2.5. Assessment of Viability, Cytotoxicity and Apoptosis
2.6. Measurement of Glucose-Induced Insulin Secretion
2.7. Quantitative Real Time PCR (qPCR)
2.8. Determination of Cytokine Concentration
2.9. Silencing of HNF1A
2.10. Analysis of Participant Data
2.11. Data Analysis
3. Results
3.1. rs1534422 Increases β Cell Apoptosis
3.2. rs10517086 and rs1534422 Reduce Glucose-Stimulated Insulin Secretion
3.3. rs10517086 and rs1534422 Alter β Cell Transcriptional Profiles
3.4. rs10517086 and rs1534422 Alter the Concentration of Secreted Inflammatory Cytokines
3.5. Silencing of HNF1A in rs10517086 and rs1534422 Expressing BRIN-BD11 Cells Alleviates Apoptosis
3.6. Silencing of HNF1A in rs10517086 and rs1534422 Expressing BRIN-BD11 Cells Normalises β Cell Gene Expression
3.7. rs10517086 and rs1534422 Increase Expression of Encoded lncRNAs
3.8. Impact of T1D Risk Variants in Individuals from the DARE Study
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Burrack, A.L.; Martinov, T.; Fife, B.T. T Cell-Mediated Beta Cell Destruction: Autoimmunity and Alloimmunity in the Context of Type 1 Diabetes. Front. Endocrinol. 2017, 8, 343. [Google Scholar] [CrossRef] [PubMed]
- Cnop, M.; Welsh, N.; Jonas, J.-C.; Jörns, A.; Lenzen, S.; Eizirik, D.L. Mechanisms of pancreatic β-cell death in type 1 and type 2 diabetes: Many differences, few similarities. Diabetes 2005, 54 (Suppl. S2), S97–S107. [Google Scholar] [CrossRef] [PubMed]
- Moin, A.S.M.; Butler, A.E. Alterations in β Cell Identity in Type 1 and Type 2 Diabetes. Curr. Diabetes Rep. 2019, 19, 83. [Google Scholar] [CrossRef]
- Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in Inflammatory Disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef]
- Atkinson, M.A.; Eisenbarth, G.S.; Michels, A.W. Type 1 diabetes. Lancet 2014, 383, 69–82. [Google Scholar] [CrossRef]
- DiMeglio, L.A.; Evans-Molina, C.; Oram, R.A. Type 1 diabetes. Lancet 2018, 391, 2449–2462. [Google Scholar] [CrossRef]
- Pociot, F.; Akolkar, B.; Concannon, P.; Erlich, H.A.; Julier, C.; Morahan, G.; Nierras, C.R.; Todd, J.A.; Rich, S.S.; Nerup, J. Genetics of Type 1 Diabetes: What’s Next? Diabetes 2010, 59, 1561–1571. [Google Scholar] [CrossRef]
- Krischer, J.P.; Lynch, K.F.; Lernmark, A.; Hagopian, W.A.; Rewers, M.J.; She, J.-X.; Toppari, J.; Ziegler, A.-G.; Akolkar, B.; the TEDDY Study Group. Genetic and Environmental Interactions Modify the Risk of Diabetes-Related Autoimmunity by 6 Years of Age: The TEDDY Study. Diabetes Care 2017, 40, 1194–1202. [Google Scholar] [CrossRef]
- Krischer, J.P.; Liu, X.; Vehik, K.; Akolkar, B.; Hagopian, W.A.; Rewers, M.J.; She, J.-X.; Toppari, J.; Ziegler, A.-G.; Lernmark, Å. Predicting Islet Cell Autoimmunity and Type 1 Diabetes: An 8-Year TEDDY Study Progress Report. Diabetes Care 2019, 42, 1051–1060. [Google Scholar] [CrossRef]
- Frederiksen, B.N.; Steck, A.K.; Kroehl, M.; Lamb, M.M.; Wong, R.; Rewers, M.; Norris, J.M. Evidence of stage- and age-related heterogeneity of non-HLA SNPS and risk of islet autoimmunity and type 1 diabetes: The diabetes autoimmunity study in the young. J. Immunol. Res. 2013, 2013, 417657. [Google Scholar] [CrossRef]
- Cooper, J.D.; Simmonds, M.J.; Walker, N.M.; Burren, O.; Brand, O.J.; Guo, H.; Wallace, C.; Stevens, H.; Coleman, G.; Wellcome Trust Case Control Consortium; et al. Seven newly identified loci for autoimmune thyroid disease. Hum. Mol. Genet. 2012, 21, 5202–5208. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Vehik, K.; Huang, Y.; Larsson, H.E.; Toppari, J.; Ziegler, A.G.; She, J.-X.; Rewers, M.; Hagopian, W.A.; Akolkar, B.; et al. Distinct Growth Phases in Early Life Associated with the Risk of Type 1 Diabetes: The TEDDY Study. Diabetes Care 2020, 43, 556–562. [Google Scholar] [CrossRef] [PubMed]
- Törn, C.; Hadley, D.; Lee, H.-S.; Hagopian, W.; Lernmark, Å.; Simell, O.; Rewers, M.; Ziegler, A.; Schatz, D.; Akolkar, B.; et al. Role of Type 1 Diabetes–Associated SNPs on Risk of Autoantibody Positivity in the TEDDY Study. Diabetes 2015, 64, 1818–1829. [Google Scholar] [CrossRef]
- Steck, A.K.; Xu, P.; Geyer, S.; Redondo, M.J.; Antinozzi, P.; Wentworth, J.M.; Sosenko, J.; Onengut-Gumuscu, S.; Chen, W.-M.; Rich, S.S.; et al. Can Non-HLA Single Nucleotide Polymorphisms Help Stratify Risk in TrialNet Relatives at Risk for Type 1 Diabetes? J. Clin. Endocrinol. Metab. 2017, 102, 2873–2880. [Google Scholar] [CrossRef]
- Ratajczak, W.; Atkinson, S.D.; Kelly, C. A20 controls expression of β-cell regulatory genes and transcription factors. J. Mol. Endocrinol. 2021, 67, 189–201. [Google Scholar] [CrossRef]
- Thomas, N.J.; Lynam, A.L.; Hill, A.V.; Weedon, M.N.; Shields, B.M.; Oram, R.A.; McDonald, T.J.; Hattersley, A.T.; Jones, A.G. Type 1 diabetes defined by severe insulin deficiency occurs after 30 years of age and is commonly treated as type 2 diabetes. Diabetologia 2019, 62, 1167–1172. [Google Scholar] [CrossRef]
- Luco, R.F.; Maestro, M.A.; del Pozo, N.; Philbrick, W.M.; de la Ossa, P.P.; Ferrer, J. A conditional model reveals that induction of hepatocyte nuclear factor-1α in Hnf1α-null mutant β-cells can activate silenced genes postnatally, whereas overexpression is deleterious. Diabetes 2006, 55, 2202–2211. [Google Scholar] [CrossRef]
- Chandran, S.; Verma, D.; Rajadurai, V.S.; Yap, F. Case report: A novel HNF1A variant linked to gestational diabetes, congenital hyperinsulinism, and diazoxide hypersensitivity. Front. Endocrinol. 2024, 15, 1471596. [Google Scholar] [CrossRef]
- Dziewulska, A.; Dobosz, A.M.; Dobrzyn, A. High-Throughput Approaches onto Uncover (Epi)Genomic Architecture of Type 2 Diabetes. Genes 2018, 9, 374. [Google Scholar] [CrossRef]
- Misra, S.; Owen, K.R. Genetics of Monogenic Diabetes: Present Clinical Challenges. Curr. Diabetes Rep. 2018, 18, 141. [Google Scholar] [CrossRef]
- Xia, R.; Hu, C.; Ye, Y.; Zhang, X.; Li, T.; He, R.; Zheng, S.; Wen, X.; Chen, R. HNF1A regulates oxaliplatin resistance in pancreatic cancer by targeting 53BP1. Int. J. Oncol. 2023, 62, 45. [Google Scholar] [CrossRef] [PubMed]
- Gomes, A.S.; Ramos, H.; Soares, J.; Saraiva, L. p53 and glucose metabolism: An orchestra to be directed in cancer therapy. Pharmacol. Res. 2018, 131, 75–86. [Google Scholar] [CrossRef] [PubMed]
- Abukwaik, R.; Vera-Siguenza, E.; Tennant, D.; Spill, F. p53 Orchestrates Cancer Metabolism: Unveiling Strategies to Reverse the Warburg Effect. Bull. Math. Biol. 2024, 86, 124. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Leung, A.; Natarajan, R. Long Noncoding RNAs in Diabetes and Diabetic Complications. Antioxid. Redox Signal. 2018, 29, 1064–1073. [Google Scholar] [CrossRef]
- Castle, J.C. SNPs Occur in Regions with Less Genomic Sequence Conservation. PLoS ONE 2011, 6, e20660. [Google Scholar] [CrossRef]
Variant ID | gRNA Sequence | ssOligo Donor (5′-3′) Sequence |
---|---|---|
rs1534422 | AGTAACATCTGACGGTGTAT | ‘TZZGTCATTAAGTTTGATCGCCTCTTCTTTCAGCACCTGAGACTGTCTCCTTTCCACCCATACACTGTCAGATGTTACTTGGCATTAATGGAGTTTTGFET’ |
rs10517086 | TGGAAGGTTGTCATAAACTC | AEZCTCAGTCCCTGAAATATAACAATGAGACGGAACTCCTGTGTCCCTGAGTTTATGACAACTTTCCAAGACCATCCTTTTTGTAAAAAATATATATFZA |
Target Gene | Probe Assay ID | Manufacturer |
---|---|---|
18S | 502300 | Roche |
TNFAIP3 | Rn01766081_m1 | Invitrogen (Waltham, MA, USA) |
ABCC8 | 506195 | Roche |
KCNJ11 | 506200 | Roche |
KCNQ1 | 506506 | Roche |
GCK | Rn00561265_m1 | Invitrogen |
SCL2A2 | 506188 | Roche |
HNF1A | 500240 | Roche |
Pdx1 | 506832 | Roche |
Nkx6.1 | 506820 | Roche |
Ngn3 | Rn00572583_s1 | Invitrogen |
NFKB1 | 500911 | Roche |
RELA | 500723 | Roche |
Primer | Sequence |
---|---|
Glyceraldehyde-3-phospahate dehydrogenase | 5′ CATGTTCGTCATGGGTGTGAACCA 3′ 3′ ATGGCATGGACTGTGGTCATGCGT 5′ |
MIR3681HG | 5′ CAGAGAGCATGGGTCAGCTT 3′ 3′ TCTCTTCAATGCCCCGTGAG 5′ |
LINC02357 | 5′ TTCCTGAAGCCTCCTGGTTTG 3′ 3′ CTCCATGGTTTCAGCTGTCC 5′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ratajczak, W.; Jones, A.G.; Atkinson, S.D.; Kelly, C. Type 1 Diabetes Risk Variants Reduce Beta Cell Function. Genes 2025, 16, 172. https://doi.org/10.3390/genes16020172
Ratajczak W, Jones AG, Atkinson SD, Kelly C. Type 1 Diabetes Risk Variants Reduce Beta Cell Function. Genes. 2025; 16(2):172. https://doi.org/10.3390/genes16020172
Chicago/Turabian StyleRatajczak, Wiktoria, Angus G. Jones, Sarah D. Atkinson, and Catriona Kelly. 2025. "Type 1 Diabetes Risk Variants Reduce Beta Cell Function" Genes 16, no. 2: 172. https://doi.org/10.3390/genes16020172
APA StyleRatajczak, W., Jones, A. G., Atkinson, S. D., & Kelly, C. (2025). Type 1 Diabetes Risk Variants Reduce Beta Cell Function. Genes, 16(2), 172. https://doi.org/10.3390/genes16020172