Whole-Transcriptome Analysis Sheds Light on the Biological Contexts of Intramuscular Fat Deposition in Ningxiang Pigs
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Separation
2.2. Indicator Determination
2.3. RNA Preparation
2.4. Data Analysis
2.5. Enrichment Analysis
2.6. CeRNA Network Construction
2.7. RT-qPCR (Real-Time Quantitative PCR)
2.8. Statistical Analysis
3. Results
3.1. Phenotypic Data of the LDM in Different Intramuscular Fat Content Groups
3.2. Data of Sequencing
3.3. Differentially Expression Genes
3.4. Differentially Expressed miRNAs
3.5. Differentially Expressed LncRNAs and CircRNAs
3.6. CeRNA
3.7. RT-qPCR Validation of Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lorenzo, J.M.; Pateiro, M.; Franco, D. Influence of muscle type on physicochemical and sensory properties of foal meat. Meat Sci. 2013, 94, 77–83. [Google Scholar] [CrossRef] [PubMed]
- Alfaia, C.M.; Lopes, P.A.; Madeira, M.S.; Pestana, J.M.; Coelho, D.; Toldrá, F.; Prates, J.A.M. Current feeding strategies to improve pork intramuscular fat content and its nutritional quality. Adv. Food Nutr. Res. 2019, 89, 53–94. [Google Scholar] [PubMed]
- Wang, H.; Zhong, J.C.; Zhang, C.F.; Chai, Z.X.; Cao, H.W.; Wang, J.K.; Zhu, J.J.; Wang, J.B.; Ji, Q.M. The whole-transcriptome landscape of muscle and adipose tissues reveals the ceRNA regulation network related to intramuscular fat deposition in yak. BMC Genom. 2020, 21, 347. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Huang, J.; Wang, X.; Ma, Y. Transcription factors regulate adipocyte differentiation in beef cattle. Anim. Genet. 2020, 51, 351–357. [Google Scholar] [CrossRef] [PubMed]
- Cheng, F.; Liang, J.; Yang, L.; Lan, G.; Wang, L.; Wang, L. Systematic Identification and Comparison of the Expressed Profiles of lncRNAs, miRNAs, circRNAs, and mRNAs with Associated Co-Expression Networks in Pigs with Low and High Intramuscular Fat. Animals 2021, 11, 3212. [Google Scholar] [CrossRef]
- Hu, W.; Ding, Y.; Wang, S.; Xu, L.; Yu, H. The Construction and Analysis of the Aberrant lncRNA-miRNA-mRNA Network in Adipose Tissue from Type 2 Diabetes Individuals with Obesity. J. Diabetes Res. 2020, 2020, 3980742. [Google Scholar] [CrossRef]
- Wang, J.; Ren, Q.; Hua, L.; Chen, J.; Zhang, J.; Bai, H.; Li, H.; Xu, B.; Shi, Z.; Cao, H.; et al. Comprehensive Analysis of Differentially Expressed mRNA, lncRNA and circRNA and Their ceRNA Networks in the Longissimus Dorsi Muscle of Two Different Pig Breeds. Int. J. Mol. Sci. 2019, 20, 1107. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.-M.; Qin, J.; Liu, S.-G.; Cai, R.; Chen, X.-C.; Wang, X.-M.; Pang, W.-J. PDGFRα Regulated by miR-34a and FoxO1 Promotes Adipogenesis in Porcine Intramuscular Preadipocytes through Erk Signaling Pathway. Int. J. Mol. Sci. 2017, 18, 2424. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Li, F.; Sun, J.W.; Li, D.H.; Li, W.T.; Jiang, R.R.; Li, Z.J.; Liu, X.J.; Han, R.L.; Li, G.X.; et al. LncRNA IMFNCR Promotes Intramuscular Adipocyte Differentiation by Sponging miR-128-3p and miR-27b-3p. Front. Genet. 2019, 10, 42. [Google Scholar] [CrossRef]
- Feng, H.; Yousuf, S.; Liu, T.Y.; Zhang, X.X.; Huang, W.L.; Li, A.; Xie, L.L.; Miao, X.Y. The comprehensive detection of miRNA and circRNA in the regulation of intramuscular and subcutaneous adipose tissue of Laiwu pig. Sci. Rep. 2022, 12, 16542. [Google Scholar] [CrossRef]
- Wang, L.; Xie, Y.; Chen, W.; Zhang, Y.; Zeng, Y. Identification and functional prediction of long noncoding RNAs related to intramuscular fat content in Laiwu pigs. Anim. Biosci. 2022, 35, 115–125. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Hou, Y.; Ling, Z.; Chen, Q.; Xu, T.; Liu, L.; Yu, N.; Ni, W.; Ding, X.; Zhang, X.; et al. Identification of Candidate Genes and Regulatory Competitive Endogenous RNA (ceRNA) Networks Underlying Intramuscular Fat Content in Yorkshire Pigs with Extreme Fat Deposition Phenotypes. Int. J. Mol. Sci. 2022, 23, 2596. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Q.; Li, C.; Yu, Y.; Xing, Y.; Xiao, D.; Zhang, B. Comparison of fatty acid profile of three adipose tissues in Ningxiang pigs. Anim. Nutr. (Zhongguo Xu Mu Shou Yi Xue Hui) 2018, 4, 256–259. [Google Scholar] [CrossRef] [PubMed]
- Folch, J.; Ascoli, I.; Lees, M.; Meath, J.A.; Lebaron, F.N. Preparation of Lipide Extracts from Brain Tissue. J. Biol. Chem. 1951, 191, 833–841. [Google Scholar] [CrossRef] [PubMed]
- Folch, J.; Lees, M.; Stanley, G.H.S. A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zhang, Y.; Tan, Z.; Wang, J.; Hu, Y.; Sun, J.; Bao, M.; Huang, P.; Ge, M.; Chai, Y.J.; et al. Lysyl oxidase promotes anaplastic thyroid carcinoma cell proliferation and metastasis mediated via BMP1. Gland. Surg. 2022, 11, 245–257. [Google Scholar] [CrossRef] [PubMed]
- He, B.; Zhang, Y.; Zhou, Z.; Wang, B.; Liang, Y.; Lang, J.; Lin, H.; Bing, P.; Yu, L.; Sun, D.; et al. A Neural Network Framework for Predicting the Tissue-of-Origin of 15 Common Cancer Types Based on RNA-Seq Data. Front. Bioeng. Biotechnol. 2020, 8, 737. [Google Scholar] [CrossRef] [PubMed]
- Yu, T.; Xu, B.; Bao, M.; Gao, Y.; Zhang, Q.; Zhang, X.; Liu, R. Identification of potential biomarkers and pathways associated with carotid atherosclerotic plaques in type 2 diabetes mellitus: A transcriptomics study. Front. Endocrinol. 2022, 13, 981100. [Google Scholar] [CrossRef] [PubMed]
- Bao, M.H.; Li, J.M.; Zhou, Q.L.; Li, G.Y.; Zeng, J.; Zhao, J.; Zhang, Y.W. Effects of miR-590 on oxLDL-induced endothelial cell apoptosis: Roles of p53 and NF-κB. Mol. Med. Rep. 2016, 13, 867–873. [Google Scholar] [CrossRef]
- Wen, L.; Cheng, F.; Zhou, Y.; Yin, C. MiR-26a enhances the sensitivity of gastric cancer cells to cisplatin by targeting NRAS and E2F2. Saudi J. Gastroenterol. Off. J. Saudi Gastroenterol. Assoc. 2015, 21, 313–319. [Google Scholar]
- Gong, Y.; He, J.; Li, B.A.; Xiao, Y.; Zeng, Q.H.; Xu, K.; Duan, Y.H.; He, J.H.; Ma, H.M. Integrated Analysis of lncRNA and mRNA in Subcutaneous Adipose Tissue of Ningxiang Pig. Biology 2021, 10, 726. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Fang, X.B.; Lu, X.; Liu, Y.; Li, G.H.; Zhao, Z.H.; Li, J.Y.; Yang, R.J. Function Identification of Bovine Gene and Its Association with Lipid Metabolism Traits in Beef Cattle. Front. Vet. Sci. 2022, 8, 766765. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Chen, S.H.; Jin, X.; Li, Y.M. Analysis of differentially expressed genes and microRNAs in alcoholic liver disease. Int. J. Mol. Med. 2013, 31, 547–554. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Hu, H.; Tian, Y.; Li, J.; Scheben, A.; Zhang, C.; Li, Y.; Wu, J.; Yang, L.; Fan, X.; et al. The Chicken Pan-Genome Reveals Gene Content Variation and a Promoter Region Deletion in IGF2BP1 Affecting Body Size. Mol. Biol. Evol. 2021, 38, 5066–5081. [Google Scholar] [CrossRef]
- Wang, K.; Hua, G.; Li, J.; Yang, Y.; Zhang, C.; Yang, L.; Hu, X.; Scheben, A.; Wu, Y.; Gong, P.; et al. Duck pan-genome reveals two transposon insertions caused bodyweight enlarging and white plumage phenotype formation during evolution. iMeta 2024, 3, e154. [Google Scholar] [CrossRef]
- Teng, A.C.T.; Adamo, K.; Tesson, F.; Stewart, A.F.R. Functional characterization of a promoter polymorphism that drives ACSL5 gene expression in skeletal muscle and associates with diet-induced weight loss. Faseb J. 2009, 23, 1705–1709. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.M.; Xia, H.L.; Jiang, H.R.; Mao, Y.J.; Qu, K.X.; Huang, B.Z.; Gong, Y.C.; Yang, Z.P. Longissimus dorsi muscle transcriptomic analysis of Yunling and Chinese simmental cattle differing in intramuscular fat content and fatty acid composition. Genome 2018, 61, 549–558. [Google Scholar] [CrossRef]
- Piórkowska, K.; Małopolska, M.; Ropka-Molik, K.; Szyndler-Nędza, M.; Wiechniak, A.; Żukowski, K.; Lambert, B.; Tyra, M. Evaluation of SCD, ACACA and FASN Mutations: Effects on Pork Quality and Other Production Traits in Pigs Selected Based on RNA-Seq Results. Animals 2020, 10, 123. [Google Scholar] [CrossRef]
- Luo, Q.; Das, A.; Oldoni, F.; Wu, P.Y.; Wang, J.G.; Luo, F.; Fang, Z.F. Role of ACSL5 in fatty acid metabolism. Heliyon 2023, 9, e13316. [Google Scholar] [CrossRef]
- Wang, J.; Qin, L.; Feng, Y.P.; Zheng, R.; Deng, C.Y.; Xiong, Y.Z.; Zuo, B. Molecular Characterization, Expression Profile, and Association Study with Meat Quality Traits of Porcine Gene. Appl. Biochem. Biotechnol. 2014, 173, 1640–1651. [Google Scholar] [CrossRef]
- Luo, B.; Regier, D.S.; Prescott, S.M.; Topham, M.K. Diacylglycerol kinases. Cell. Signal. 2004, 16, 983–989. [Google Scholar] [CrossRef] [PubMed]
- Jia, D.-J.-C.; Wang, Q.-W.; Hu, Y.-Y.; He, J.-M.; Ge, Q.-W.; Qi, Y.-D.; Chen, L.-Y.; Zhang, Y.; Fan, L.-N.; Lin, Y.-F.; et al. Lactobacillus johnsonii alleviates colitis by TLR1/2-STAT3 mediated CD206+ macrophagesIL-10 activation. Gut Microbes 2022, 14, 2145843. [Google Scholar] [CrossRef] [PubMed]
- Hardie, D.G.; Schaffer, B.E.; Brunet, A. AMPK: An Energy-Sensing Pathway with Multiple Inputs and Outputs. Trends Cell Biol. 2016, 26, 190–201. [Google Scholar] [CrossRef] [PubMed]
- Randrianarisoa, E.; Lehn-Stefan, A.; Krier, J.; Böhm, A.; Heni, M.; Hrabě De Angelis, M.; Fritsche, A.; Häring, H.-U.; Stefan, N.; Staiger, H. AMPK Subunits Harbor Largely Nonoverlapping Genetic Determinants for Body Fat Mass, Glucose Metabolism, and Cholesterol Metabolism. J. Clin. Endocrinol. Metab. 2019, 105, 14–25. [Google Scholar] [CrossRef]
- Cui, H.X.; Yang, S.Y.; Zheng, M.Q.; Liu, R.R.; Zhao, G.P.; Wen, J. High-salt intake negatively regulates fat deposition in mouse. Sci. Rep. 2017, 7, 2053. [Google Scholar] [CrossRef] [PubMed]
- Bridges, M.C.; Daulagala, A.C.; Kourtidis, A. LNCcation: lncRNA localization and function. J. Cell Biol. 2021, 220, e202009045. [Google Scholar] [CrossRef] [PubMed]
- Nedergaard, J.; Petrovic, N.; Lindgren, E.M.; Jacobsson, A.; Cannon, B. PPARγ in the control of brown adipocyte differentiation. Biochim. Et Biophys. Acta (BBA)-Mol. Basis Dis. 2005, 1740, 293–304. [Google Scholar] [CrossRef] [PubMed]
- Ren, H.Y.; Zhang, H.Y.; Hua, Z.D.; Zhu, Z.; Tao, J.S.; Xiao, H.W.; Zhang, L.P.; Bi, Y.Z.; Wang, H. ACSL4 Directs Intramuscular Adipogenesis and Fatty Acid Composition in Pigs. Animals 2022, 12, 119. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.L.; Zheng, M.; Zhang, J.; Ye, Y.R.; Duan, M.Q.; Chamba, Y.; Wang, Z.B.; Shang, P. Transcriptomics-Based Study of Differentially Expressed Genes Related to Fat Deposition in Tibetan and Yorkshire Pigs. Front. Vet. Sci. 2022, 9, 919904. [Google Scholar] [CrossRef]
- Huang, W.L.; Zhang, X.X.; Li, A.; Xie, L.L.; Miao, X.Y. Genome-Wide Analysis of mRNAs and lncRNAs of Intramuscular Fat Related to Lipid Metabolism in Two Pig Breeds. Cell. Physiol. Biochem. 2018, 50, 2406–2422. [Google Scholar] [CrossRef]
- Yang, M.; Zhang, R.; Liu, X.; Shi, G.; Liu, H.; Wang, L.; Hou, X.; Shi, L.; Wang, L.; Zhang, L. Integrating genome-wide association study with RNA-seq revealed DBI as a good candidate gene for intramuscular fat content in Beijing black pigs. Anim. Genet. 2022, 54, 24–34. [Google Scholar] [CrossRef] [PubMed]
- Sieczkowska, H.; Zybert, A.; Krzecio, E.; Antosik, K.; Kocwin-Podsiadla, M.; Pierzchala, M.; Urbanski, P. The expression of genes and in the muscle tissue of pigs differentiated by glycolytic potential and drip loss, with reference to the genetic group. Meat Sci. 2010, 84, 137–142. [Google Scholar] [CrossRef] [PubMed]
- Xing, K.; Zhao, X.T.; Liu, Y.B.; Zhang, F.X.; Tan, Z.; Qi, X.L.; Wang, X.G.; Ni, H.M.; Guo, Y.; Sheng, X.H.; et al. Identification of Differentially Expressed MicroRNAs and Their Potential Target Genes in Adipose Tissue from Pigs with Highly Divergent Backfat Thickness. Animals 2020, 10, 624. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.J.; Li, W.T.; Bai, Y.; Yang, W.J.; Ling, Y.; Fang, M.Y. ssc-miR-7134-3p regulates fat accumulation in castrated male pigs by targeting gene. Int. J. Biol. Sci. 2017, 13, 189–197. [Google Scholar] [CrossRef] [PubMed]
- Zang, J.K.; Lu, D.; Xu, A.D. The interaction of circRNAs and RNA binding proteins: An important part of circRNA maintenance and function. J. Neurosci. Res. 2020, 98, 87–97. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.K.; Dou, Y.Q.; Qi, K.L.; Li, C.L.; Song, C.L.; Li, X.J.; Li, X.L.; Qiao, R.M.; Wang, K.J.; Han, X.L. CircSETBP1 Acts as a MiR-149-5p Sponge to Promote Intramuscular Fat Deposition by Regulating CRTCs. J. Agric. Food Chem. 2022, 70, 12841–12851. [Google Scholar] [CrossRef] [PubMed]
- Li, B.J.; He, Y.; Wu, W.J.; Tan, X.F.; Wang, Z.C.H.; Irwin, D.M.; Wang, Z.; Zhang, S.Y. Circular RNA Profiling Identifies Novel circPPARA that Promotes Intramuscular Fat Deposition in Pigs. J. Agric. Food Chem. 2022, 70, 4123–4137. [Google Scholar] [CrossRef] [PubMed]
- Krycer, J.R.; Quek, L.E.; Francis, D.; Zadoorian, A.; Weiss, F.C.; Cooke, K.C.; Nelson, M.E.; Diaz-Vegas, A.; Humphrey, S.J.; Scalzo, R.; et al. Insulin signaling requires glucose to promote lipid anabolism in adipocytes. J. Biol. Chem. 2020, 295, 13250–13266. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Dong, H.H. FoxO integration of insulin signaling with glucose and lipid metabolism. J. Endocrinol. 2017, 233, R67–R79. [Google Scholar] [CrossRef]
- Liu, X.Y.; Yang, Z.H.; Li, H.X.; Luo, W.; Duan, W.T.; Zhang, J.M.; Zhu, Z.Z.; Liu, M.; Li, S.M.; Xin, X.Y.; et al. Chrysophanol Alleviates Metabolic Syndrome by Activating the SIRT6/AMPK Signaling Pathway in Brown Adipocytes. Oxidative Med. Cell. Longev. 2020, 2020, 7374086. [Google Scholar] [CrossRef]
- Lim, S.H.; Lee, H.S.; Han, H.K.; Choi, C.I. Saikosaponin A and D Inhibit Adipogenesis via the AMPK and MAPK Signaling Pathways in 3T3-L1 Adipocytes. Int. J. Mol. Sci. 2021, 22, 11409. [Google Scholar] [CrossRef] [PubMed]
- Abdolahi, A.; Vahabzadeh, Z.; Izadpanah, E.; Moloudi, M.R. Vaspin attenuates steatosis-induced fibrosis via GRP78 receptor by targeting AMPK signaling pathway. J. Physiol. Biochem. 2022, 78, 185–197. [Google Scholar] [CrossRef] [PubMed]
- Yan, L.S.; Zhang, S.F.; Luo, G.; Cheng, B.C.Y.; Zhang, C.; Wang, Y.W.; Qiu, X.Y.; Zhou, X.H.; Wang, Q.G.; Song, X.L.; et al. Schisandrin B mitigates hepatic steatosis and promotes fatty acid oxidation by inducing autophagy through AMPK/mTOR signaling pathway. Metab.-Clin. Exp. 2022, 131, 155200. [Google Scholar] [CrossRef] [PubMed]
- Yazıcı, D.; Sezer, H. Insulin Resistance, Obesity and Lipotoxicity. Adv. Exp. Med. Biol. 2017, 960, 277–304. [Google Scholar] [PubMed]
- Ahn, B.; Wan, S.B.; Jaiswal, N.; Vega, R.B.; Ayer, D.E.; Titchenell, P.M.; Han, X.L.; Won, K.J.; Kelly, D.P. MondoA drives muscle lipid accumulation and insulin resistance. JCI Insight 2019, 4, e129119. [Google Scholar] [CrossRef] [PubMed]
- Dong, L.; Li, H.M.; Wang, S.N.; Wang, T.L.; Yu, L.H.; Wang, H.R. Meishan neonatal piglets tend to have higher intestinal barrier function than crossbred neonatal piglets. Animal 2021, 15, 100037. [Google Scholar] [CrossRef] [PubMed]
- Shen, Q.; Chen, Y.E.; Shi, J.X.; Pei, C.Y.; Chen, S.X.; Huang, S.; Li, W.R.; Shi, X.G.; Liang, J.; Hou, S.Z. Asperuloside alleviates lipid accumulation and inflammation in HFD-induced NAFLD AMPK signaling pathway and NLRP3 inflammasome. Eur. J. Pharmacol. 2023, 942, 175504. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Liu, J.L.; Liu, H.T.; Zhang, W.; Li, X.J.; Liu, L.Q.; Zhou, M.; Wang, J.R.; Su, S.G.; Ding, X.D.; et al. Inhibits Intramuscular Fat Deposition through Targeting by ceRNA Regulatory Network. Biology 2022, 11, 1497. [Google Scholar] [CrossRef] [PubMed]
- Yi, X.D.; He, Z.Z.; Tian, T.T.; Kou, Z.Y.; Pang, W.J. LncIMF2 promotes adipogenesis in porcine intramuscular preadipocyte through sponging MiR-217. Anim. Biotechnol. 2023, 34, 268–279. [Google Scholar] [CrossRef]
- Murakami, M.; Nakatani, Y.; Atsumi, G.; Inoue, K.; Kudo, L. Regulatory Functions of Phospholipase A. Crit. Rev. Immunol. 2017, 37, 121–179. [Google Scholar] [CrossRef]
- Chiu, C.H.; Jackowski, S. Role of calcium-independent phospholipases (iPLA2) in phosphatidylcholine metabolism. Biochem. Biophys. Res. Commun. 2001, 287, 600–606. [Google Scholar] [CrossRef] [PubMed]
- Peng, H.; Li, J.; Xu, H.; Wang, X.; He, L.; McCauley, N.; Zhang, K.K.; Xie, L. Offspring NAFLD liver phospholipid profiles are differentially programmed by maternal high-fat diet and maternal one carbon supplement. J. Nutr. Biochem. 2023, 111, 109187. [Google Scholar] [CrossRef] [PubMed]
- Xiao, L.M.; Xu, Q.; Liu, X.M.; Chan, S.H.; Luo, Y.B.; He, S.H.; Fang, M.Y. The Novel-miR-659/Interaction Regulates Fat Deposition in Castrated Male Pigs. Animals 2022, 12, 944. [Google Scholar] [CrossRef] [PubMed]
- Frey, J.L.; Li, Z.; Ellis, J.M.; Zhang, Q.; Farber, C.R.; Aja, S.; Wolfgang, M.J.; Clemens, T.L.; Riddle, R.C. Wnt-Lrp5 Signaling Regulates Fatty Acid Metabolism in the Osteoblast. Mol. Cell. Biol. 2015, 35, 1979–1991. [Google Scholar] [CrossRef] [PubMed]
- Borrell-Pagès, M.; Romero, J.C.; Juan-Babot, O.; Badimon, L. Wnt pathway activation, cell migration, and lipid uptake is regulated by low-density lipoprotein receptor-related protein 5 in human macrophages. Eur. Heart J. 2011, 32, 2841–2850. [Google Scholar] [CrossRef]
- Srivastava, S.; Srikanth, K.; Won, S.; Son, J.-H.; Park, J.-E.; Park, W.; Chai, H.-H.; Lim, D. Haplotype-Based Genome-Wide Association Study and Identification of Candidate Genes Associated with Carcass Traits in Hanwoo Cattle. Genes 2020, 11, 551. [Google Scholar] [CrossRef]
RNA | Primer Sequence (5′-3′) | Tm | Product Length (bp) | Genbank ID | |
---|---|---|---|---|---|
mRNA | BAD | F: CTACCAGGCCAGACTCAACC | 60 | 77 | XM_021082883.1 |
R: AACATGCTCTGGGCTCCAA | |||||
GADD45G | F: TACGGTTCCAGAAAGCACGG | 60 | 139 | NM_001185129.1 | |
R: GTTGTCGGGGTCCACATTCA | |||||
SMPD4 | F: CTGCTTCTGTTCCAGGTTT | 60 | 92 | XM_013981435.2 | |
R: GATTCCTTGGCATGAGGG | |||||
LRP5 | F: GACCCCTCCCTCTACAACCT | 60 | 83 | XM_021082721.1 | |
R: CGGATGATGTAGGGCCTGTAG | |||||
miRNA | ssc-miR-7314-3P | RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGTAT | 60 | 65 | |
F: CAGATGCGGAACCTGCGG | |||||
R: AGTGCAGGGTCCGAGGTATT | |||||
ssc-miR-190a | RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAAGA | 60 | 69 | ||
F: ACGCGTCTGACTTCCATTCCTT | |||||
R: AGTGCAGGGTCCGAGGTATT | |||||
ssc-miR-122-5P | RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAAAC | 60 | 71 | ||
F: AACACGCTGGAGTGTGACAA | |||||
R: CAGTGCAGGGTCCGAGGT | |||||
2_4068 | RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAAGA | 60 | 72 | ||
F: AACACGTGTCTGACTTCCATTC | |||||
R: CAGTGCAGGGTCCGAGGT | |||||
lncRNA | MSTRG.7983.2 | F: ACTCGGCGTTGCTTCTACAG | 60 | 116 | |
R: TGAGCTGTGGTGTAGGTTGC | |||||
MSTRG.4269.1 | F: CCAGGCCAAACAACAATCCAG | 60 | 79 | ||
R: TGTGCCTGAGGGGGTCTTTA | |||||
MSTRG.1466.4 | F: GCTGCACCAGAAGAGGAGTT | 60 | 256 | ||
R: CGATTCCGAAGGAAGGCAGT | |||||
MSTRG.12137.1 | F: GCCTAGGAACCATGAGGTCG | 60 | 184 | ||
R: CGGCATATGGAGGTTCCCAG | |||||
CircRNA | sus-USP47_0017 | F: ACAGCCAGAGATCCTAGACG | 60 | 79 | |
R: AAGACCCTTTCGTGCATCACA | |||||
sus-DCUNAD2_0003 | F: CCTTGCTTCCCAGAGCGTAA | 60 | 83 | ||
R: CTCTTGCCAGCCCGAGTAAA | |||||
sus-ATP6V0A2-0002 | F: TACACCATCGTGACCTACGC | 60 | 149 | ||
R: TCCTGCACCAAGTATGCCAA | |||||
sus-MTUS1_0004 | F: ACATCGATGGGATTAGCCCTG | 60 | 108 | ||
R: AACCGCAGTCAAAGGTCTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jin, Z.; Gao, H.; Fu, Y.; Ren, R.; Deng, X.; Chen, Y.; Hou, X.; Wang, Q.; Song, G.; Fan, N.; et al. Whole-Transcriptome Analysis Sheds Light on the Biological Contexts of Intramuscular Fat Deposition in Ningxiang Pigs. Genes 2024, 15, 642. https://doi.org/10.3390/genes15050642
Jin Z, Gao H, Fu Y, Ren R, Deng X, Chen Y, Hou X, Wang Q, Song G, Fan N, et al. Whole-Transcriptome Analysis Sheds Light on the Biological Contexts of Intramuscular Fat Deposition in Ningxiang Pigs. Genes. 2024; 15(5):642. https://doi.org/10.3390/genes15050642
Chicago/Turabian StyleJin, Zhao, Hu Gao, Yawei Fu, Ruimin Ren, Xiaoxiao Deng, Yue Chen, Xiaohong Hou, Qian Wang, Gang Song, Ningyu Fan, and et al. 2024. "Whole-Transcriptome Analysis Sheds Light on the Biological Contexts of Intramuscular Fat Deposition in Ningxiang Pigs" Genes 15, no. 5: 642. https://doi.org/10.3390/genes15050642
APA StyleJin, Z., Gao, H., Fu, Y., Ren, R., Deng, X., Chen, Y., Hou, X., Wang, Q., Song, G., Fan, N., Ma, H., Yin, Y., & Xu, K. (2024). Whole-Transcriptome Analysis Sheds Light on the Biological Contexts of Intramuscular Fat Deposition in Ningxiang Pigs. Genes, 15(5), 642. https://doi.org/10.3390/genes15050642