Identification of SNPs Associated with Drought Resistance in Hybrid Populations of Picea abies (L.) H. Karst.–P. obovata (Ledeb.)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and DNA Extraction
2.2. Amplification and Sequencing
2.3. Locus Selection and Primer Development for Highly Polymorphic Regions of Adaptively Significant Genes
2.4. Determination of Polymorphism of Adaptively Significant Genes
3. Results
3.1. Locus Selection and the Development of the Primer for Highly Polymorphic Regions of Adaptively Significant Genes
3.2. SNP Position Detection and Their Analysis
3.3. Use of Developed Primers for Detection of Nucleotide Polymorphism of Spruce Trees
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zamolodchikov, D.; Kraev, G. Influence of Climate Change on Russian Forests: Recorded Impacts and Forecast Estimates. Contemp. Probl. Ecol. 2016, 48, 23–31. [Google Scholar]
- Nakvasina, E.N.; Prozherina, N.A. Assessment of response to climate change in experiments with the origins of Picea abies (L.) Karst. × P. obovata (Ledeb.) in the North Russian Plain. Lesn. Zhurnal (For. J.) 2023, 1, 22–37. [Google Scholar] [CrossRef]
- Prozherina, N.A.; Nakvasina, E.N. Climate change and its impact on adaptation and intraspecific variability of conifer species of the European North of Russia. Lesn. Zhurnal (For. J.) 2022, 2, 9–25. [Google Scholar] [CrossRef]
- Aitken, S.N.; Yeaman, S.; Holliday, J.A.; Wang, T.; Curtis-McLane, S. Adaptation, migration or extirpation: Climate change outcomes for tree populations. Evol. Appl. 2008, 1, 95–111. [Google Scholar] [CrossRef] [PubMed]
- Kijowska-Oberc, J.; Staszak, A.M.; Kamiński, J.; Ratajczak, E. Adaptation of forest trees to rapidly changing climate. Forests 2020, 11, 123. [Google Scholar] [CrossRef]
- Levkoev, E.; Mehtätalo, L.; Luostarinen, K.; Pulkkinen, P.; Zhigunov, A.; Peltola, H. Development of height growth and frost hardiness for one-year-old Norway spruce seedlings in greenhouse conditions in response to elevated temperature and atmospheric CO2 concentration. Silva Fenn. 2018, 52, 15. [Google Scholar] [CrossRef]
- Kramer, R.D.; Ishii, H.R.; Carter, K.R.; Miyazaki, Y.; Cavaleri, M.A.; Araki, M.G.; Azuma, W.A.; Inoue, Y.; Hara, C. Predicting effects of climate change on productivity and persistence of forest trees. Ecol. Res. 2020, 35, 562–574. [Google Scholar] [CrossRef]
- Chuyko, V.; Klinov, M.; Kulikova, E.; Lobovikov, M. The Russian Federation Forest Sector Outlook Study to 2030; FAO: Rome, Italy, 2012; Available online: https://www.fao.org/3/i3020e/i3020e00.pdf (accessed on 1 August 2024).
- Farjon, A. World Checklist and Bibliography of Conifers; Royal Botanic Gardens Kew: Richmond, UK, 2001; Volume 3, p. 309. Available online: https://books.google.kz/books?id=2XXwAAAAMAAJ (accessed on 1 September 2024).
- Popov, P.P. Structure and differentiation of spruce populations in the Komi Republic. Russ. J. Ecol. 2013, 44, 193–198. [Google Scholar] [CrossRef]
- Pravdin, L.P. European Spruce and Siberian Spruce in the USSR; Nauka: Moscow, Russia, 1975; Volume 1, p. 176. [Google Scholar]
- Tsuda, Y.; Chen, J.; Stocks, M.; Kallman, T.; Sonstebo, J.H.; Parducci, L.; Semerikov, V.; Sperisen, C.; Politov, D.; Ronkainen, T.; et al. The extent and meaning of hybridization and introgression between Siberian spruce (Picea obovata) and Norway spruce (Picea abies): Cryptic refugia as stepping stones to the west? Mol. Ecol. 2016, 25, 2773–2789. [Google Scholar] [CrossRef]
- Chen, J.; Li, L.; Milesi, P.; Jansson, G.; Berlin, M.; Karlsson, B.; Aleksic, J.; Vendramin, G.G.; Lascoux, M. Genomic data provide new insights on the demographic history and the extent of recent material transfers in Norway spruce. Evol. Appl. 2019, 12, 1539–1551. [Google Scholar] [CrossRef]
- Li, L.; Milesi, P.; Tiret, M.; Chen, J.; Sendrowski, J.; Baison, J.; Chen, Z.Q.; Zhou, L.; Karlsson, B.; Berlin, M.; et al. Teasing apart the joint effect of demography and natural selection in the birth of a contact zone. New Phytol. 2022, 236, 1976–1987. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Q.; Karunarathne, P.; Andersson-Li, L.; Chen, C.; Opgenoorth, L.; Heer, K.; Piotti, A.; Vendramin, G.G.; Nakvasina, E.; Lascoux, M.; et al. Recurrent hybridization and gene flow shaped Norway and Siberian spruce evolutionary history over multiple glacial cycles. Mol. Ecol. 2024, 33, e17495. [Google Scholar] [CrossRef]
- Karunarathne, P.; Zhou, Q.; Lascoux, M.; Milesi, P. Hybridization mediated range expansion and climate change resilience in two keystone tree species of boreal forests. Glob. Chang. Biol. 2024, 30, e17262. [Google Scholar] [CrossRef]
- Skrøppa, T.; Tollefsrud, M.M.; Sperisen, C.; Johnsen, Ø. Rapid change in adaptive performance from one generation to the next in Picea abies—Central European trees in a Nordic environment. Tree Genet. Genomes 2009, 6, 93–99. [Google Scholar] [CrossRef]
- Politov, D.V.; Belokon, M.M.; Mudrik, E.A.; Polyakova, T.A.; Sullivan, A.; Krutovsky, K.V. Adaptive genetic structure in spruce populations. In Proceedings of the International Forum “Biotechnology: State of the Art and Perspectives”, Moscow, Russia, 23–25 May 2018; pp. 762–763. [Google Scholar]
- Kalendar, R.; Boronnikova, S.; Seppanen, M. Isolation and purification of DNA from complicated biological samples. Methods Mol. Biol. 2021, 2222, 57–67. [Google Scholar] [CrossRef]
- Kalendar, R.; Ivanov, K.I.; Akhmetollayev, I.; Kairov, U.; Samuilova, O.; Burster, T.; Zamyatnin, A.A., Jr. An improved method and device for nucleic acid isolation using a high-salt gel electroelution trap. Anal. Chem. 2024, 96, 15526–15530. [Google Scholar] [CrossRef] [PubMed]
- Rose, R.; Golosova, O.; Sukhomlinov, D.; Tiunov, A.; Prosperi, M. Flexible design of multiple metagenomics classification pipelines with UGENE. Bioinformatics 2019, 35, 1963–1965. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [PubMed]
- Azaiez, H.; Booth, K.T.; Ephraim, S.S.; Crone, B.; Black-Ziegelbein, E.A.; Marini, R.J.; Shearer, A.E.; Sloan-Heggen, C.M.; Kolbe, D.; Casavant, T.; et al. Genomic landscape and mutational signatures of deafness-associated genes. Am. J. Hum. Genet. 2018, 103, 484–497. [Google Scholar] [CrossRef] [PubMed]
- Kalendar, R.; Khassenov, B.; Ramankulov, Y.; Samuilova, O.; Ivanov, K.I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics 2017, 109, 312–319. [Google Scholar] [CrossRef] [PubMed]
- Kalendar, R.; Shevtsov, A.; Otarbay, Z.; Ismailova, A. In silico PCR analysis: A comprehensive bioinformatics tool for enhancing nucleic acid amplification assays. Front. Bioinform. 2024, 4, 1464197. [Google Scholar] [CrossRef] [PubMed]
- Nystedt, B.; Street, N.R.; Wetterbom, A.; Zuccolo, A.; Lin, Y.C.; Scofield, D.G.; Vezzi, F.; Delhomme, N.; Giacomello, S.; Alexeyenko, A.; et al. The Norway spruce genome sequence and conifer genome evolution. Nature 2013, 497, 579–584. [Google Scholar] [CrossRef] [PubMed]
- Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef]
- Nei, M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef]
- Nei, M. Molecular Evolutionary Genetics; Columbia University Press: New York, NY, USA; Chichester, UK; West Sussex, UK, 1987; Volume 1, p. 514. [Google Scholar]
- Tajima, F. Statistical analysis of DNA polymorphism. Jpn. J. Genet. 1993, 68, 567–595. [Google Scholar] [CrossRef]
- Moran, E.; Lauder, J.; Musser, C.; Stathos, A.; Shu, M. The genetics of drought tolerance in conifers. New Phytol. 2017, 216, 1034–1048. [Google Scholar] [CrossRef]
- Prishnivskaya, Y.; Nassonova, E.; Vasileva, Y.; Boronnikova, S. Selecting of polymorphic loci of genome for identification of populations of Pinus sylvestris L. on East Europe Plain. Bull. Sci. Pract. 2019, 5, 25–30. [Google Scholar] [CrossRef]
- Sullivan, A.R.; Fagernäs, Z.; Zhao, W.; Meng, J.; Polyakova, T.A.; Shatokhina, A.V.; Shilkina, E.A.; Cherosov, M.M.; Zakharov, E.S.; Krutovsky, K.V.; et al. Genomic Insights on Migration and Hybridization in the Norway—Siberian Spruce Complex; Vash Format: Perm, Russia, 2017; Volume 1, p. 286. [Google Scholar]
- Krutovsky, K.V. Dendrogenomics is a new interdisciplinary field of research of the adaptive genetic potential of forest tree populations integrating dendrochronology, dendroecology, dendroclimatology, and genomics. Russ. J. Genet. 2022, 58, 1273–1286. [Google Scholar] [CrossRef]
- Novikova, S.V.; Oreshkova, N.V.; Sharov, V.V.; Zhirnova, D.F.; Belokopytova, L.V.; Babushkina, E.A.; Krutovsky, K.V. Study of the genetic adaptation mechanisms of Siberian larch (Larix sibirica Ledeb.) regarding climatic stresses based on dendrogenomic analysis. Forests 2023, 14, 2358. [Google Scholar] [CrossRef]
- Larsson, H.; Kallman, T.; Gyllenstrand, N.; Lascoux, M. Distribution of long-range linkage disequilibrium and Tajima’s D values in Scandinavian populations of Norway Spruce (Picea abies). G3 2013, 3, 795–806. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Sun, Y.; Li, L.; Wang, G.; Yue, W.; Lu, Z.; Wang, Q.; Liu, J. Population genetic evidence for speciation pattern and gene flow between Picea wilsonii, P. morrisonicola and P. neoveitchii. Ann. Bot. 2013, 112, 1829–1844. [Google Scholar] [CrossRef] [PubMed]
- Di, H.; Ma, J.; He, K.; Han, F.; Li, Y.; Niu, S. Phylogenetic relationship of Picea mongolica with other Picea species in the same area based on chloroplast gene variations. J. For. Res. 2020, 32, 297–305. [Google Scholar] [CrossRef]
- Milesi, P.; Kastally, C.; Dauphin, B.; Cervantes, S.; Bagnoli, F.; Budde, K.B.; Cavers, S.; Fady, B.; Faivre-Rampant, P.; Gonzalez-Martinez, S.C.; et al. Resilience of genetic diversity in forest trees over the Quaternary. Nat. Commun. 2024, 15, 8538. [Google Scholar] [CrossRef]
- Trujillo-Moya, C.; George, J.P.; Fluch, S.; Geburek, T.; Grabner, M.; Karanitsch-Ackerl, S.; Konrad, H.; Mayer, K.; Sehr, E.M.; Wischnitzki, E.; et al. Drought sensitivity of norway spruce at the species’ warmest fringe: Quantitative and molecular analysis reveals high genetic variation among and within provenances. G3 2018, 8, 1225–1245. [Google Scholar] [CrossRef]
- Lebedev, V.G.; Lebedeva, T.N.; Chernodubov, A.I.; Shestibratov, K.A. Genomic selection for forest tree improvement: Methods, achievements and perspectives. Forests 2020, 11, 1190. [Google Scholar] [CrossRef]
- Cappa, E.P.; Klutsch, J.G.; Sebastian-Azcona, J.; Ratcliffe, B.; Wei, X.; Da Ros, L.; Liu, Y.; Chen, C.; Benowicz, A.; Sadoway, S.; et al. Integrating genomic information and productivity and climate-adaptability traits into a regional white spruce breeding program. PLoS ONE 2022, 17, e0264549. [Google Scholar] [CrossRef]
- Laverdiere, J.P.; Lenz, P.; Nadeau, S.; Depardieu, C.; Isabel, N.; Perron, M.; Beaulieu, J.; Bousquet, J. Breeding for adaptation to climate change: Genomic selection for drought response in a white spruce multi-site polycross test. Evol. Appl. 2022, 15, 383–402. [Google Scholar] [CrossRef] [PubMed]
- Sboeva, Y.V. Assessment of the state of gene pools of Pinus sylvestris L. populations in the east and northeast of the East European Plain. Bull. Perm Univ. Biol. 2023, 4, 375–384. [Google Scholar] [CrossRef]
- Azaiez, A.; Pavy, N.; Gérardi, S.; Laroche, J.; Boyle, B.; Gagnon, F.; Mottet, M.-J.; Beaulieu, J.; Bousquet, J. A Catalog of Annotated High-Confidence SNPs from Exome Capture and Sequencing Reveals Highly Polymorphic Genes in Norway Spruce (Picea abies). BMC Genom. 2018, 19, 942. [Google Scholar] [CrossRef]
- Rigault, P.; Boyle, B.; Lepage, P.; Cooke, J.E.K.; Bousquet, J.; MacKay, J.J. A White Spruce Gene Catalog for Conifer Genome Analyses. Plant Physiol. 2011, 157, 14–28. [Google Scholar] [CrossRef] [PubMed]
Locus | Sequence (5′–3′) Forward/Reverse Primer | Ta (°C) | PCR Band Size (bp) |
---|---|---|---|
Pic01 | GCTCGTGTGAGAAACCAGGA/TGGGAAGAGGATGCAGCATG | 60 | 598 |
Pic02 | TCGGGTCCTATTCCTGCTCA/GGAAGACTCAGCAAGCCCTT | 60 | 514 |
Pic04 | ATGCTGTGGTCTCTGCACAA/GCACGCCAGAATTGATTCCC | 60 | 585 |
Pic06 | GGGCTCCCATTGTTCTTCCA/GCTTTTGCAACTGGGAAGCA | 60 | 531 |
Pic13 | CTCGCTGCTTTCTCGAATGC/TCCGAAGCTGTATACGTCGC | 60 | 584 |
Pic14 | CCCTACCCACAGTTGAGCAG/CACTTCGATCGGATGCTCGA | 60 | 511 |
GenBank Accession | Length (bp) | Gene Ontology ID | Gene Ontology Description (GO) |
---|---|---|---|
CBVK0101281798.1 | 11,571 | GO:0009414 | Response to water deprivation |
CBVK0101480371.1 | 18,086 | GO:0009414 | Response to water deprivation |
CBVK0102174952.1 | 7308 | GO:0009414 | Response to water deprivation |
CBVK0102115778.1 | 14,665 | GO:0009414 | Response to water deprivation |
CBVK0102359228.1 | 11,630 | GO:0009414 | Response to water deprivation |
CBVK0102081567.1 | 2574 | GO:0009414 | Response to water deprivation |
CBVK0103088770.1 | 4831 | GO:0009414 | Response to water deprivation |
CBVK0101156587.1 | 3896 | GO:0009414 | Response to water deprivation |
CBVK0100502403.1 | 10,672 | GO:0009414 | Response to water deprivation |
CBVK0101505806.1 | 13,982 | GO:0009414 | Response to water deprivation |
CBVK0101210595.1 | 10,062 | GO:0009414 | Response to water deprivation |
CBVK0100421303.1 | 3906 | GO:0042631 | Cellular response to water deprivation |
CBVK0102037105.1 | 4807 | GO:0009414 | Response to water deprivation |
CBVK0101157077.1 | 5795 | GO:0009819 | Drought recovery |
CBVK0100702127.1 | 8366 | GO:0009414 | Response to water deprivation |
CBVK0102666519.1 | 4156 | GO:0009414 | Response to water deprivation |
CBVK0103146733.1 | 694 | GO:0009414 | Response to water deprivation |
CBVK0101258025.1 | 6333 | GO:0009414 | Response to water deprivation |
CBVK0101506168.1 | 6574 | GO:0009414 | Response to water deprivation |
CBVK0100670468.1 | 16,109 | GO:0009414 | Response to water deprivation |
CBVK0100670468.1 | 16,109 | GO:0009414 | Response to water deprivation |
CBVK0100280442.1 | 14,474 | GO:0009414 | Response to water deprivation |
CBVK0101156767.1 | 1871 | GO:0009414 | Response to water deprivation |
CBVK0100603050.1 | 17,104 | GO:0042631 | Cellular response to water deprivation |
CBVK0103731373.1 | 6720 | GO:0042631 | Cellular response to water deprivation |
Primer | Sequence (5′–3′) Forward/Reverse Primer | Tm (°C) | PCR Band Size (bp) |
---|---|---|---|
Pic01 | GCTCGTGTGAGAAACCAGGA/TGGGAAGAGGATGCAGCATG | 60 | 598 |
Pic02 | TCGGGTCCTATTCCTGCTCA/GGAAGACTCAGCAAGCCCTT | 60 | 514 |
Pic03 | TATTCCCGACACTGATGCCG/AGACAACTGCATCCACGGAG | 60 | 505 |
Pic04 | ATGCTGTGGTCTCTGCACAA/GCACGCCAGAATTGATTCCC | 60 | 585 |
Pic05 | GCCATACAAATGACGACCGC/TTTCTGCTACAGTGGCCTCG | 60 | 551 |
Pic06 | GGGCTCCCATTGTTCTTCCA/GCTTTTGCAACTGGGAAGCA | 60 | 531 |
Pic07 | GGTGGTGTTGTGGTTGATGC/AGGTGGGAGGTGATGCAATG | 60 | 508 |
Pic08 | CAGAGGTCAAACCACTGCCA/CGCAAGTGTTGAGGAGGAGT | 60 | 521 |
Pic09 | CTGCAGTGGAAGGGCTTGTA/ACCAGAAATGGCAAGGCAGA | 60 | 508 |
Pic10 | TTCTCCTAAAGCCGCTTCCG/TGAGTCAATGGCATGCCGAT | 60 | 519 |
Pic11 | CCTTGGCAAGAGGTGGAGAG/AGACCCTCCATATGTGCCCT | 60 | 585 |
Pic12 | GCCTATCAGCATTTGCCAGC/GAGTCCGGAAAGCCTCCAAA | 60 | 559 |
Pic13 | CTCGCTGCTTTCTCGAATGC/TCCGAAGCTGTATACGTCGC | 60 | 584 |
Pic14 | CCCTACCCACAGTTGAGCAG/CACTTCGATCGGATGCTCGA | 60 | 511 |
Pic15 | TCGAATCGCCCATGATCTGG/AGCCAACGAAGAAGCGGTAA | 60 | 560 |
Pic16 | TCGGTGGATCTTGGGCTAGA/ATACGGTTAAGGGGAGGGCT | 60 | 523 |
Locus * | Po_Ch | Po_Kr | Po_Gn | Po_Kc | Po_Br | Po_Kv | Po_Kg | Po_Pr | Bceгo | |
---|---|---|---|---|---|---|---|---|---|---|
Pic01 | hn | 11 | 10 | 12 | 14 | 14 | 9 | 9 | 10 | 62 |
S | 19 | 20 | 17 | 19 | 20 | 14 | 15 | 12 | 31 | |
Pic02 | hn | 7 | 5 | 5 | 6 | 6 | 6 | 6 | 4 | 14 |
S | 7 | 4 | 5 | 5 | 5 | 6 | 5 | 3 | 12 | |
Pic04 | hn | 8 | 5 | 3 | 6 | 5 | 5 | 4 | 6 | 11 |
S | 9 | 6 | 3 | 6 | 6 | 4 | 6 | 8 | 11 | |
Pic06 | hn | 2 | 5 | 3 | 3 | 4 | 4 | 4 | 4 | 15 |
S | 1 | 5 | 3 | 2 | 5 | 3 | 7 | 3 | 14 | |
Pic13 | hn | 7 | 7 | 9 | 10 | 6 | 5 | 5 | 8 | 25 |
S | 6 | 10 | 10 | 8 | 7 | 5 | 7 | 10 | 23 | |
Pic14 | hn | 7 | 5 | 11 | 7 | 6 | 5 | 3 | 4 | 24 |
S | 9 | 7 | 13 | 7 | 6 | 3 | 3 | 5 | 19 |
Locus | Haplotype Diversity (Hd) * | Nucleotide Diversity (π) | Watterson Estimator (θW) | Tajima D-Test Coefficient (DT) |
---|---|---|---|---|
Pic01 | 0.947 (0.013) | 0.011 (0.000) | 0.011 (0.002) | −0.406 |
Pic02 | 0.701 (0.038) | 0.002 (0.000) | 0.006 (0.002) | −1.545 |
Pic04 | 0.785 (0.029) | 0.005 (0.000) | 0.006 (0.002) | −0.502 |
Pic06 | 0.516 (0.060) | 0.002 (0.000) | 0.006 (0.002) | −1.931 |
Pic13 | 0.843 (0.021) | 0.005 (0.000) | 0.009 (0.002) | −1.417 |
Pic14 | 0.772 (0.035) | 0.004 (0.000) | 0.008 (0.002) | −1.339 |
All | 0.761 (0.145) | 0.005 (0.003) | 0.008 (0.002) | −1.190 |
Population | Haplotype Diversity (Hd) | Nucleotide Diversity (π) | Watterson Estimator (θW) | Tajima D-Test Coefficient (DT) |
---|---|---|---|---|
Po_Ch | 0.759 | 0.005 | 0.006 | −0.486 |
Po_Kr | 0.775 | 0.005 | 0.006 | −0.434 |
Po_Gn | 0.727 | 0.005 | 0.006 | −0.692 |
Po_Kc | 0.823 | 0.005 | 0.005 | −0.382 |
Po_Br | 0.770 | 0.005 | 0.006 | −0.549 |
Po_Kv | 0.731 | 0.004 | 0.004 | −0.354 |
Po_Kg | 0.696 | 0.004 | 0.005 | −0.443 |
Po_Pr | 0.773 | 0.004 | 0.005 | −0.469 |
All | 0.758 (0.038) | 0.005 (0.000) | 0.005 (0.001) | −0.476 (0.106) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vasileva, Y.; Zhulanov, A.; Chertov, N.; Sboeva, Y.; Boronnikova, S.; Pechenkina, V.; Nechaeva, Y.; Kalendar, R. Identification of SNPs Associated with Drought Resistance in Hybrid Populations of Picea abies (L.) H. Karst.–P. obovata (Ledeb.). Genes 2024, 15, 1440. https://doi.org/10.3390/genes15111440
Vasileva Y, Zhulanov A, Chertov N, Sboeva Y, Boronnikova S, Pechenkina V, Nechaeva Y, Kalendar R. Identification of SNPs Associated with Drought Resistance in Hybrid Populations of Picea abies (L.) H. Karst.–P. obovata (Ledeb.). Genes. 2024; 15(11):1440. https://doi.org/10.3390/genes15111440
Chicago/Turabian StyleVasileva, Yulia, Andrei Zhulanov, Nikita Chertov, Yana Sboeva, Svetlana Boronnikova, Victoria Pechenkina, Yulia Nechaeva, and Ruslan Kalendar. 2024. "Identification of SNPs Associated with Drought Resistance in Hybrid Populations of Picea abies (L.) H. Karst.–P. obovata (Ledeb.)" Genes 15, no. 11: 1440. https://doi.org/10.3390/genes15111440
APA StyleVasileva, Y., Zhulanov, A., Chertov, N., Sboeva, Y., Boronnikova, S., Pechenkina, V., Nechaeva, Y., & Kalendar, R. (2024). Identification of SNPs Associated with Drought Resistance in Hybrid Populations of Picea abies (L.) H. Karst.–P. obovata (Ledeb.). Genes, 15(11), 1440. https://doi.org/10.3390/genes15111440