Next Article in Journal
Interferon Regulatory Factors (IRF1, IRF4, IRF5, IRF7 and IRF9) in Sichuan taimen (Hucho bleekeri): Identification and Functional Characterization
Next Article in Special Issue
Profiling of Known and Novel microRNAs in an Oleaginous Crop Native to the Amazon Basin, Sacha Inchi (Plukenetia volubilis), Through smallRNA-Seq
Previous Article in Journal
In Silico Identification of the Laccase-Encoding Gene in the Transcriptome of the Amazon River Prawn Macrobrachium amazonicum (Heller, 1862)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis

1
Department of Biotechnology and Genetic Engineering, Hazara University Mansehra, Mansehra 21300, Pakistan
2
Department of Technology, State University of Maringá, Umuarama 87506-370, PR, Brazil
3
Department of Biotechnology, Jeonbuk National University, Iksan 54596, Republic of Korea
4
Department of Zoology, College of Science, King Saud University, P.O. Box 2455, Riyadh 2455, Saudi Arabia
5
Key Laboratory of Plant Reproductive Adaptation and Evolutionary Ecology and Institute of Biodiversity, Yunnan University, Ministry of Education, Kunming 650500, China
6
Department of Horticulture and Life Science, Yeungnam University, Gyeongsan 38541, Republic of Korea
*
Authors to whom correspondence should be addressed.
Genes 2024, 15(11), 1417; https://doi.org/10.3390/genes15111417
Submission received: 4 September 2024 / Revised: 23 October 2024 / Accepted: 28 October 2024 / Published: 31 October 2024
(This article belongs to the Special Issue Bioinformatics of Plant)

Abstract

Background/Objectives: The current research work aimed to evaluate the cryptic walnut genotypes of the Hazara region in Pakistan by using DNA barcoding and phylogenetic analysis. Methods: Based on morphological traits such as nut size, nut shape, and the number of leaflets, five genotypes were chosen and samples were collected for the current study. For molecular analysis, gDNA was isolated from the fresh leaves, and the five most effective angiosperm-specific markers, ITS2, rbcLa, rbcLc, rpoC1, and UBE3, were utilized. Based on amplification, sequencing, and identification success rates, ITS2 and UBE3 were recorded as the most efficient markers followed by rbcLa, rbcLc, and rpoC1. Results: During phylogenetic analysis, the query genotype-1 based on ITS2 and genotype-2 based on UBE3 clustered with (KF454101.1-Juglans regia) and (KC870919.1-J. regia) with bootstraps of 56 and 100, respectively. Genotype-3 based on rbcla clustered in a major clade with J. regia L., cultivars (MN397935.1 J. regia ‘Vina’) and (MN397934.1-J. regia ‘Serr’), (MN397933.1 J. regia ‘Pedro’), (MN397932.1 J. regia ‘Lara’), (MN397931.1 J. regia ‘Howard’), and (MN397930.1 J. regia ‘Hartley’) with bootstrap of 100. Meanwhile, genotype-4 and genotype-5 based on rbclc and rpoC1 clustered with (MN397935.1 J. regia ‘Vina’) and (MN397934.1 J. regia ‘Serr’), across the database sequences. To clarify the taxonomic status of cryptic walnut genotypes, it is necessary to combine diverse DNA barcodes. The results of ITS2 and UBE3, followed by rbcL barcoding markers, are promising taxonomic tools for cryptic walnut genotypes in Pakistan. Conclusions: It has been determined that the genotypes of walnuts in the study area are both J. regia L. and its cultivars and that the accuracy of discrimination regarding the genus Juglans L. is greater than 90%. The reported DNA barcodes are recommended for the correct identification and genetic evaluation of Juglans taxa and its population.

1. Introduction

The genus Juglans L. (Juglandaceae), having basic chromosome number 2n = 32, is a monoecious in nature, wind-pollinated, and self-compatible flowering plant [1]. The Juglandaceae family comprises 10 genera and 60 species [2]. The Juglans L. genus is one of the major genera of the family Juglandaceae, consisting of 21 species [3]. The walnut holds significant economic and commercial importance due to its edible nuts, high-quality wood, suitability for landscaping and ornamental purposes, and traditional, cultural, and medicinal uses [4]. Recent epidemiological studies have linked walnut consumption to a reduced risk of cardiovascular mortality [5]. Walnuts originate from the mountainous areas of Central Asia and are found in a wide territory that extends from southeastern Europe and the Caucasus to Turkey and Iran [6]. They also grow in Armenia, Azerbaijan, Belarus, Estonia, Georgia, Kazakhstan, Kyrgyzstan, Latvia, Lithuania, Moldova, Russia, Tajikistan, Turkmenistan, Ukraine, and Uzbekistan, as well as in China and the eastern Himalayas [7].
The genus Juglans L. is classified into four major sections, Cardiocaryon, Dioscaryon, Rhysocaryon, and Trachycaryon [8]. Cardiocaryon consists of Juglans ailantifolia Carriere., Juglans cathayensis Dode, and Juglans mandshurica Maxim. Dioscaryon and Trachycaryon consist of single species Juglans cinerea L. and J. regia L., respectively. Rhysocaryon is endemic to South and North America and comprises Juglans australis Griseb., Juglans boliviana Dode, Juglans californica S., Juglans guatemalensis W.E. Manning, Juglans hindsii Jeps, Juglans hirsuta W.E. Manning, Juglans jamaicensis C. DC., Juglans major Torr, Juglans microcarpa Berland, Juglans mollis Engelm, Juglans neotropica Diels, Juglans nigra L., Juglans olanchana Standl, Juglans pyriformis Liebm, Juglans steyermarkii W.E. Manning, and Juglans venezuelensis W.E. Manning [9]. All these species exhibit variation in nut size and shape, leaf shape, leaflet number, and overall morphological characteristics [10].
The walnut has a long cultivation history spanning over 6800 years, with more than 300 J. regia L. cultivars documented to produce edible nuts [11]. In Pakistan, walnuts predominantly grow in the northern region, with Hazara being the major contributor to walnut production and exhibiting rich morphological walnut diversity [12]. Despite the presence of numerous walnut cultivars and diversity in both wild and cultivated forms, their taxonomic status remains suspicious due to a lack of skilled experts, literature, comprehensive data, and accessibility to their habitat [13]. Remarkably, the flora of Pakistan reported only one species, J. regia L., approximately 70 years ago [14].
DNA barcoding is an emerging technological identification tool that performs identification of the genus level, species level, or even lower taxonomic levels of biological taxa [15]. The primary purpose of this technique is the correct identification of multiple plant species based on DNA fragment nucleotide sequences within a short duration [16]. It is an efficient, rapid, cost-effective, and standardized method for assessing and identifying various plant species [17]. Moreover, DNA barcoding allows for the exploration of both inter-specific and intra-specific variations and facilitates the identification of unknown species or those exhibiting complex morphometric behaviors [16]. Initially, COI gene sequences were used for the identification of certain metazoan species [18]; subsequently, various nucleotide sequences such as ITS, matK, rbcL, and trnH-psbA were employed for the identification of flowering plant species [19]. These nucleotide sequences play a crucial role in studying the similarities and differences among different plant species and are widely employed in addressing evolutionary and taxonomic issues [20]. Several plastid genome loci including rbcL, matK rpoB, rpoC1, and trnH-psbA have been explored and used as DNA barcoding regions for plants [21].
The current study was designed to evaluate the suspicious walnut genotypes found in the Hazara region of Northern Pakistan through molecular markers for their differentiation and identification and establish phylogenetic or evolutionary relationships with database reference sequences.

2. Materials and Methods

2.1. Study Area and Sample Collections

The current research work was conducted in the Hazara region of Khyber Pakhtunkhwa Province (KP), Pakistan. Initially, we collected 150 samples in the form of nuts and leaves. Further, these samples were segregated into fifteen groups based on their morphological traits. Again, two genotypes were randomly selected for the DNA barcoding of Juglans (Figure 1). After amplification and nucleotide sequencing, only five walnut genotypes were found suitable for further analysis. The samples were carefully tagged and stored at −20 °C in the laboratory (Table 1).

2.2. DNA Extraction and Quantification

For DNA isolation, the fresh leaf samples were powdered well using a mortar and pestle. About 100 mg of powder tissue of each genotype was added to an Eppendorf tube, 800 µL of the CTAB solution was added, and the mixture was vortexed thoroughly. Then the homogenate was incubated for 2 h at 65 °C. Following incubation, 600 µL of phenol-chloroform isoamyle alcohol (PCI) was added, and the homogenate was centrifuged for 20 min at 13,000 rpm. The supernatant, along with 500 µL of ice-cold isopropanol, was frozen for 2 h. Subsequently, the samples were centrifuged again at 13,000 rpm for 20 min, and the isopropanol was discarded. Next, 500 µL of ethanol (70%) was added, and the samples were centrifuged for 10 min at 13,000 rpm. The tubes were dried to remove the ethanol completely. To dilute the dried sample, 60–80 µL of ddH2O was added. The quality and concentration of the extracted gDNA were evaluated using a 1% agarose gel through electrophoresis [22,23,24].

2.3. Primers Selection and PCR Amplification

The internal transcribed spacer region (ITS2) [25], UBE3 [26], and chloroplasts rbcLa [27], rbcLc [28], and rpoC1; CBOL [29] are the most studied and widely used nuclear DNA markers and were selected for molecular analysis of the suspicious walnut genotypes; the nucleotide sequences of their respective primers are presented in Table 2. In the amplification of the desired DNA fragment, a PCR reaction mixture was prepared in PCR tubes with a total volume of 25 µL for each DNA marker [30].
Each reaction mixture contained 14 µL of ddH20, 2 µL of template DNA, 2.5 µL of 10× PCR buffer, 2 µL of MgCl2, 2 µL of dNTPs, 0.5 units of Taq Polymerase kit (Catalogue no. KO171), and 2 µL of each forward and reverse primers. The amplification of the desired DNA markers was conducted using an applied Biosystems 2720 thermal cycler (PCR) (GRI, Braintree, United Kingdom) [31]. The conditions of PCR consisted of initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing for 40 s at 52 °C, extension at 72 °C for approximately 35 s, and a final extension step for 10 min at 72 °C [32]. The PCR-amplified products were analyzed using 1% agarose gel electrophoresis [33].

2.4. Nucleotide Sequencing and Phylogenetic Analysis

The amplified fragment of DNA from each sample was isolated from the agarose gel through the prescribed protocol and checked on 1% agarose gel for confirmation. The isolated fragments of DNA from each sample were sent to Macrogn Inc., Seoul, Republic of South Korea, for nucleotide sequencing. After successful sequencing, the quality of the sequences was checked using Geneious software R7 (https://www.geneious.com/). The rough sequences from the start and end were deleted to ensure the quality was high [34]. Moreover, the sequencer was used for sequence editing and further analysis. The consensus sequences were used for confirmation of the correct and similar identification on the BLAST, and a Maft aligner was used to align the sequences [35]. BioEdit software (ver 7.2.0) was used to remove the roughly arranged data and MEGA 11 was used to construct a phylogenetic tree based on sequence analysis [36].

3. Results

In the current research work, the selected walnut genotypes were evaluated using angiosperm-specific DNA markers, including nuclear (ITS2 and UBE3) and chloroplast (rbcLa, rbcLc, and rpoC1), which were used for molecular evaluation, differentiation, recognition, and identification. Furthermore, all the above-mentioned DNA markers demonstrated a 100% amplification rate in ITS2 and UBE3, 60% in rbcLa and rbcLc, and 20% in rpoC1. While successful sequencing rates were recorded at 100%, high identity success rates ranged from 97 to 100% (Figure 2).
Similar to BLAST searching the query sequences, the highest similar database sequences were compared based on query cover, percent identity, and E-value (Table 3).

3.1. DNA Sequence Analysis and Characterizations of Barcodes

Sequence analysis was conducted to ascertain the monophyly and evolutionary lineage of local walnut genotype samples in comparison with available database sequences. The analysis used the neighbor-joining method. The bootstrap consensus tree, based on 1000 replicates, was generated to represent the phylogeny of the genotypes. Branches supported by less than 50% of bootstrap replicates were collapsed. The percentage of replicate trees in which the associated genotypes clustered together in the bootstrap test of 1000 replicates is indicated next to the branches [37]. The Tamura–Nei method was employed to compute distances, which are presented as the number of base substitutions per site [38]. The candidate barcode sequence analysis generates various characteristics in the form of length in bp, conserved domains, variable sites, singletons, and informative sites (Table 4).

3.2. Nucleotide Sequence Analysis and Phylogeny of Genotype-1 Based on ITS2

The ITS2 region yielded a 335-base pair sequence with a query cover of 94%, 99% identity, and an E-value of 0.0. In the final dataset, characters of 335 bp, 326 conserved sites, 7 variable sites, 7 singletons, and 0 parsimony informative sites were recorded. There was a single-nucleotide missing gap recorded in blast alignment (0 = A) (Figure 3).
The phylogenetic analysis resulted in the formation of two clades: Clades I and II. Clade I comprised eight accessions, including (MF182375.1-J. regia), (HM049904.1-J. regia ‘Del Carril’), (HM049899.1-J. regia ‘Rego’), (HM049903.1-J. regia), (HM049891.1-J. regia ‘Sorrento’), and (MT227636.1-J. regia). The query genotype-1 sequence clustered with (KF454101.1-J. regia) and (MF182375.1-J. regia) with a bootstrap value of 59. MF182375.1-J. regia) is previously reported from China. Clade II included (HM049897.1-J. regia ‘Grand Jefe’) and (HM049901.1-J. regia). All sequences were retrieved from GenBank (Figure 4).

3.3. Nucleotide Sequence Analysis and Phylogeny of Genotype-2 Based on UBE3

The UBE3 primer produced a 768-base pair sequence with a 92% query cover, 100% identity, and an E-value of 0.0. A neighbor-joining tree was constructed based on a total dataset of 768 bp, which comprised 465 conserved sites, 303 variable sites variable sites, 288 parsimony informative sites, and 15 singleton sites (Figure 5).
The phylogenetic analysis revealed the formation of two major clades: Clades I and II. In Clade I, query genotype-2 shares a clade with (KF994007.1-J. regia), (KC870919.1-J. regia), (KF589927.1-Juglans sigillata Dode), (KF994009.1-J. sigillata), and (KC870918.1-J. mandshurica), with a bootstrap value of 97. Both the (KF994007.1-J. regia) and (KC870919.1-J. regia) were previously reported in China in 2013. Clade II comprised four accessions, including (MF279073.1-Juglans regia), (MF279072.1-J. regia), (MF182377.1-J. cinerea), and (MF279074.1-J. cathayensis) (Figure 6).

3.4. Nucleotide Sequence Analysis and Phylogeny of Genotype-3 Based on rbcLa

During the phylogenetic analysis, the rbcLa primer yielded a 698-base pair sequence with a 99% query cover, 100% identity, and an E-value of 0.0. A neighbor-joining tree was constructed based on the total dataset characters of 698 bp, which included 698 conserved sites; however, no variable parsimony informative or singleton sites were observed (Figure 7).
The analysis resulted in the formation of two major clades: Clades I and II. Within clade I, query genotype-3 clustered together with a bootstrap value of 100 alongside accessions (MN397935.1-J. regia ‘Vina’), (MN397934.1-J. regia ‘Serr’), (MN397933.1-J. regia ‘Pedro’), (MN397932.1-J. regia ‘Lara’), (MN397931.1-J. regia ‘Howard’), and (MN397930.1-J. regia ‘Hartley’). (MN397935.1-J. regia ‘Vina’) was previously reported in Switzerland and the sequence was submitted in Ncbi in Germany in 2019. Conversely, Clade II comprised (MN397927.1-J. regia ‘Fernor’), (MN397929.1-J. regia ‘Geisenheim’), and (MN397928.1-J. regia ‘Franquette’) (Figure 8).

3.5. Nucleotide Sequence Analysis and Phylogeny of Genotype-4 Based on rbcLc

In the phylogenetic analysis, the rbcLc primer produced a 587-base pair sequence with a 38% query cover, 97% identity, and an E-value of 0.0. A neighbor-joining tree was then constructed based on a total dataset of 587 bp, which consisted of 538 conserved sites, 5 variable sites, 5 singleton sites, 5 missing gap (deletion) sites (T = 0, A = 0, T = 0, T = G, T = 0), and 9 nucleotide replacement (insertion) sites (G = A, T = G, A = C, A = G, T = A, C = T, T = G, and =G) (Figure 9).
The phylogeny revealed that the total accessions clustered into two distinct clades: Clades I and II. Clade I comprised seven accessions, namely (MN397928.1-J. regia ‘Franquette’), (MN397927.1-J. regia ‘Fernor’), (MN397929.1-J. regia ‘Geisenheim’), (MN397930.1-J. regia ‘Hartley’), (MN397931.1-J. regia ‘Howard’), (MN397932.1-J. regia ‘Lara’), and (MN397933.1-J. regia ‘Pedro’). In Clade II, query genotype-4 clustered with (MN397935.1-J. regia ‘Vina’) and (MN397934.1-J. regia ‘Serr’) with bootstrap values of 37 and 38. Both the (MN397935.1-J. regia ‘Vina’) and (MN397934.1-J. regia ‘Serr’) were previously reported in Switzerland and sequences were submitted in Germany in 2017 and 2019 (Figure 10).

3.6. Nucleotide Sequence Analysis and Phylogeny of Genotype-5 Based onrpoC1

In the phylogenetic analysis, the rpoC1 primer yielded a 646-base pair sequence with a 58% query cover, 99% identity, and an E-value of 0.0. A neighbor-joining tree was then constructed based on a total dataset of 646 bp, which included 331 conserved sites, 239 variable sites, 239 singleton sites, 1 missing gap deletion (G = 0), and 1 nucleotide replacement (insertion) of T = C (Figure 11).
The resulting phylogeny grouped the total accessions into two distinct clades: Clades I and II. Clades I consisted of seven accessions, namely (MN397928.1-J. regia ‘Franquette’), (MN397927.1-J. regia ‘Fernor’), (MN397929.1-J. regia ‘Geisenheim’), (MN397930.1-J. regia ‘Hartley’), (MN397931.1-J. regia ‘Howard’), (MN397932.1-J. regia ‘Lara’), and (MN397933.1-J. regia ‘Pedro’). In Clade II, query genotype-5 clustered with bootstrap values of 28 (MN397935.1-J. regia ‘Vina’) and 41 (MN397934.1-J. regia ‘Serr’) (Figure 12).

3.7. DNA Barcode of Selected Genotypes

The barcode from the nuclear (ITS2 and UBE3) and chloroplast (rbcLa, rbcLc, and rpoC1) marker sequence was generated by DNA barcode generator (Bio-Rad) software (v 1.3) for their exact identification (Figure 13).

4. Discussion

The present research work was designed to screen out suitable DNA barcode regions for available cryptic walnut genotypes and check the phylogenetic relationship with reference database sequences. Walnut genotypes were collected from the different localities of the Hazara region of Pakistan and evaluated through different DNA markers. A combination of different molecular markers provides comprehensive insights into walnut diversity [40]. In the current study, various types of nuclear (ITS2 and UBE3) and chloroplast (rbcLa, rbcLc, and ropC1) were used to confirm the amplification sequencing and identity success rate in the selected cryptic walnut genotypes. Similarly, various types of DNA markers have been used in previous studies on Juglans species by Yang et al. [41].
In the current study’s results, primers reveal notable performances in the successful amplification rate, sequencing rate, and rate of similarity among the tested DNA barcoding markers in local walnut genotypes. ITS2, UBE3, rbcLa, rbcLc, and rpoC1 markers performed well across all metrics, with maximum amplification, sequencing, and identity success rates. Similar to the previous study, high amplification and sequencing success rates of selected DNA markers were reported by Chen et al. [42]. The current study’s results regarding the identification success rate of 97–100% (>90% identity, >90% query cover, and E value of 0.0) align with the results underscoring the reliability of ITS2 and rbcL in genus Juglans L. by Han et al. [43], Juglans nigra L. by Pollegioni et al. [40], and UBE3 by Suo et al. [26] in J. regia. L cultivars, rbcL, and rpoC1 (Aradhya et al. [44]) in Juglans species identification. Our analysis revealed a significant number of conserved sites (326, 465, 698, 538, and 331 in ITS2, UBE3, rbcLa, rbcLc, and rpoC1) and 303 and 239 variable sites in UBE3 and rpoC1 markers. Comparable to the findings of Stevens et al. [45] who also documented genetic variations in Juglans species, resolved phylogenetic relationships within Juglans, and identified specific regions, conserved sites are useful for species identification and evolutionary studies of Juglans species.
The nucleotide gaps (deletions) 4 (T = 0) 1 (A = 0) and nucleotide replacements (substitutions) 3 (T = G) 2 (G = A) 1 (A = C) 1 (T = A) 1 (C = T) were identified particularly in rbcLc and 1 (G = 0) 1 (T = C) and A = 0 in rpoC1. The current study is like those reported, highlighting the genetic complexity within walnut species [46]. This study also contributes to genetic diversity by introducing new variations that can be acted upon by evolutionary forces [6]. Variations such as nucleotide substitutions and deletions can lead to a reproductive barrier, causing them to be reproductively isolated from other populations and leading to speciation [47]. Non-synonymous substitutions and significant deletions can lead to an adaptation that allows different populations to exploit different ecological niches. Over time, this ecological differentiation can contribute to the formation of new species [48]. Genetic markers like ITS2, UBE3, rbcL, and ropC1 are often used in phylogenetic studies to understand the evolutionary relationships between species. Variations in these markers can help trace lineage divergence and speciation events [49]. The phylogenetic tree constructed using the NJ method showed robust clustering of query genotypes with J. regia and cultivars of J. regia with high bootstrap scores. The ITS2 sequence-based phylogenetic tree results in the formation of two major clades, Clades I and II. In Clade I, the query genotype sequence clustered with (KF454101.1-J. regia) with a bootstrap value of 90%. (KF454101.1-J. regia) was previously reported or submitted in northern China by Wang et al. [50]. In the phylogeny, the query genotypes clustered with (KF994007.1-J. regia) and (KC870919.1-J. regia), with a bootstrap value of 97. Both the sequences of species (KF994007.1-J. regia) and (KC870919.1-J. regia) have been previously reported in China [26]. On the other hand, phylogeny, query genotype-3 clustered with (MN397935.1-J. regia ‘Vina’), (MN397934.1-J. regia ‘Serr’), (MN397933.1-J. regia ‘Pedro’), (MN397932.1-J. regia ‘Lara’), (MN397931.1-J. regia ‘Howard’), and (MN397930.1-J. regia ‘Hartley’) with a bootstrap value of 100. All these J. regia cultivars were previously reported by Teske et al. [51] in Germany. With phylogeny based on rbcLc and rpoC1, query genotype-4 and genotype-5 clustered with (MN397935.1-J. regia ‘Vina’) and (MN397934.1-J. regia ‘Serr’). Both (MN397934.1-J. regia ‘Serr’) and (MN397935.1-J. regia ‘Vina’) were previously reported by Teske et al. [51] in Germany. These results supported the monophyly of Juglans and provided insights into the evolutionary relationships within the genus. The current research is also supported by several studies using different kinds and combinations of DNA markers used for amplification, sequencing, and walnut species identification.
Similarly, 113 walnut genotypes from different regions of China were analyzed for genetic diversity and population structure analysis using molecular markers [50]. Aradhya et al. [44] examined 77 walnut cultivars for genetic differentiation and conservation using DNA markers. Similarly, in a previous study, ITS2 was used along with chloroplast DNA to analyze phylogenetic relationships within Juglans, helping to identify species and cultivars [52]. On the other hand, Yildiz et al. [53] analyzed the genetic diversity and identified the J. regia and its related species through various markers. Similarly, Chen et al. [42] identified the phylogenetic relationship and fingerprint elite cultivars through molecular markers in Juglans. Nuclear ITS and chloroplast DNA sequences are reliable for phylogenetic studies in Juglans [27]. Aradhya et al. [44] applied ITS and chloroplast DNA sequences to construct a molecular phylogeny of Juglans, offering a biogeographic perspective on the genus. Similarly, ITS2 markers were used for the phylogenetic analysis and diversification of the order Fagales [54], the molecular characterization, genetic diversity, and phylogenetic relationships of walnut genotypes [55], the genetic diversity and evolutionary relationships within the walnut germplasm in Azerbaijan [56], and the population structure and genetic diversity of walnuts in Kazakhstan. Genome sequences provide insight into the genetic diversity and potential markers for cultivar identification in walnuts [57]. These findings emphasize the robustness and reliability of effective markers for DNA barcoding, highlighting their potential for accurate species identification and genetic diversity analysis within walnut populations. Similarly, the current findings confirm the efficacy of markers in the identification of the taxon at the species level. However, the literature on UBE3, rbcLa, rbcLc, and rpoC1 as DNA barcoding markers for walnut genotypes is limited; studies on other plant species have highlighted their efficacy in accurate species identification and phylogenetic inference [58].

5. Conclusions

The DNA barcode regions we used were successfully amplified using PCR, successfully sequenced, managed, and analyzed through different computational software and tools. The differentiation and recognition of query genotype sequences were carried out through analysis and comparisons with the database sequences of the genus Juglans. The overall primer efficacy surpassed 90%. The nuclear markers applied, i.e., ITS2 and UBE3, and chloroplast markers, i.e., rbcLa, rbcLc, and rpoC1, performed best for the evaluation of walnut genotypes and are recommended for the evaluation of other Juglans genotypes across the world. The phylogenetic analysis revealed that all the query genotypes belong to the genus Juglans and regia (J. regia) (KF454101.1-J. regia) and (KC870919.1-J. regia) and cultivars of the Juglan regia such as (MN397935.1-J. regia ‘Vina’), (MN397934.1-J. regia ‘Serr’), (MN397933.1-J. regia ‘Pedro’), (MN397932.1-J. regia ‘Lara’), (MN397931.1-J. regia ‘Howard’), and (MN397930.1-J. regia ‘Hartley’). The current findings provide baseline information for the next steps in research with respect to the genus Juglans genotypes and their recognition, diversity, occurrence, habit, habitat, and use for cultivation, grafting, and breeding programs.

Author Contributions

Conceptualization, M.I. and K.M.; methodology, S.S., M.I., and I.U.; software, S.S.; and S.-u.G.; validation, M.I., S.-u.G., and K.M.; formal analysis, I.U. and S.-u.G.; investigation, S.S., and I.U.; resources, M.I. and K.M.; data curation, I.U.; writing—original draft preparation, writing—review and editing; S.A., M.S., A.F.A., J.A.S., A.K., M.I., and I.U.; visualization, A.F.A., K.M., and I.U.; supervision, M.I. and K.M.; project administration, M.I. and K.M.; funding acquisition, S.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.

Acknowledgments

All authors extend their sincere appreciation to the Researchers Supporting Project No. RSP2025R218, King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wani, M.S.; Hussain, A.; Ganie, S.; Munshi, A.; Lal, E.; Gupta, R. Juglans regia—A review. Int. J. Latest Res. Sci. Technol 2016, 5, 90–97. [Google Scholar]
  2. Frei, J. A Brief History of Juglandaceae. Arnoldia 2021, 78, 10–17. [Google Scholar] [CrossRef]
  3. Luo, X.; Zhou, H.; Cao, D.; Yan, F.; Chen, P.; Wang, J.; Woeste, K.; Chen, X.; Fei, Z.; An, H. Domestication and selection footprints in Persian walnuts (Juglans regia). PLoS Genet. 2022, 18, e1010513. [Google Scholar] [CrossRef]
  4. Shigaeva, J.; Darr, D. On the socio-economic importance of natural and planted walnut (Juglans regia L.) forests in the Silk Road countries: A systematic review. For. Policy Econ. 2020, 118, 102233. [Google Scholar] [CrossRef]
  5. Sharma, M.; Sharma, M.; Sharma, M. A comprehensive review on ethnobotanical, medicinal and nutritional potential of walnut (Juglans regia L.). Proc. Indian Natl. Sci. Acad. 2022, 88, 601–616. [Google Scholar] [CrossRef]
  6. Bernard, A.; Lheureux, F.; Dirlewanger, E. Walnut: Past and future of genetic improvement. Tree Genet. Genomes 2018, 14, 1. [Google Scholar] [CrossRef]
  7. Sharma, V.; Singh, J.; Sidhu, G.S. Biotechnological Interventions for Improvement of Temperate Nuts. In Temperate Nuts; Springer: Singapore, 2023; pp. 247–267. [Google Scholar]
  8. Guo, Z.; Jin, Q.; Zhao, Z.; Yu, W.; Li, G.; Cheng, Y.; Wu, C. Analysis of Phylogenetic Relationships in The Walnut Family Based on Internal Transcribed Spacer Sequences and Secondary Structures (ITS2). 2021. Available online: https://assets-eu.researchsquare.com/files/rs-501634/v1/1b2f9c95-c758-4b25-b7a3-2be436c4f5e3.pdf?c=1631882771 (accessed on 28 October 2024).
  9. Shah, R.; Bakshi, P.; Jasrotia, A.; Wali, V.; Sharma, S.; Gupta, M.; Gupta, R.; Jamwal, M. Comparative morpho-molecular characterization of elite walnut variety Parbat (JWSP-06) with local selections of north-western Himalayan region of Jammu and Kashmir, India. Sci. Hortic. 2023, 319, 112176. [Google Scholar] [CrossRef]
  10. Khadivi-Khub, A.; Ebrahimi, A.; Sheibani, F.; Esmaeili, A. Phenological and pomological characterization of Persian walnut to select promising trees. Euphytica 2015, 205, 557–567. [Google Scholar] [CrossRef]
  11. Meng, X.; Li, Y.; Li, S.; Zhou, Y.; Gan, R.-Y.; Xu, D.-P.; Li, H.-B. Dietary sources and bioactivities of melatonin. Nutrients 2017, 9, 367. [Google Scholar] [CrossRef]
  12. Khan, M.P.Z. Floral Diversity, Ethnobotanical and Cultural Significance of Medicinally Important Wild Edible Fruits in Northern Pakistan. Ph.D. Thesis, Quaid-i-Azam University, Islamabad, Pakistan, 2018. [Google Scholar]
  13. Ur-Rahman, I.; Sher, H.; Bussmann, R. Reference Guide on High Value Medicinal and Aromatic Plants–Sustainable Management and Cultivation Practices; University of Swat: Swat, Pakistan, 2019. [Google Scholar]
  14. Kamil, M.; Khan, I.; Rauf, A.; Bawazeer, S.; Bawazeer, S.; Rauf, A.; Irfan, M. Chemical divergence of the Juglans regia L. across districts Swat and Dir, Khyber Pakhtunkhwa, Pakistan. Braz. J. Biol. 2022, 84, e259731. [Google Scholar] [CrossRef]
  15. Ahmed, S.; Ibrahim, M.; Nantasenamat, C.; Nisar, M.F.; Malik, A.A.; Waheed, R.; Ahmed, M.Z.; Ojha, S.C.; Alam, M.K. Pragmatic applications and universality of DNA barcoding for substantial organisms at species level: A review to explore a way forward. BioMed Res. Int. 2022, 2022, 1846485. [Google Scholar] [CrossRef] [PubMed]
  16. Letsiou, S.; Madesis, P.; Vasdekis, E.; Montemurro, C.; Grigoriou, M.E.; Skavdis, G.; Moussis, V.; Koutelidakis, A.E.; Tzakos, A.G. DNA Barcoding as a Plant Identification Method. Appl. Sci. 2024, 14, 1415. [Google Scholar] [CrossRef]
  17. Mahima, K.; Sunil Kumar, K.N.; Rakhesh, K.V.; Rajeswaran, P.S.; Sharma, A.; Sathishkumar, R. Advancements and future prospective of DNA barcodes in the herbal drug industry. Front. Pharmacol. 2022, 13, 947512. [Google Scholar] [CrossRef] [PubMed]
  18. Andújar, C.; Arribas, P.; Yu, D.W.; Vogler, A.P.; Emerson, B.C. Why the COI barcode should be the community DNA metabarcode for the metazoa. Mol. Ecol. 2018, 27, 3968–3975. [Google Scholar] [CrossRef]
  19. Espinosa Prieto, A.; Hardion, L.; Debortoli, N.; Beisel, J.N. Finding the perfect pairs: A matchmaking of plant markers and primers for multi-marker eDNA metabarcoding. Mol. Ecol. Resour. 2024, 24, e13937. [Google Scholar] [CrossRef]
  20. Loeuille, B.; Thode, V.; Siniscalchi, C.; Andrade, S.; Rossi, M.; Pirani, J.R. Extremely low nucleotide diversity among thirty-six new chloroplast genome sequences from Aldama (Heliantheae, Asteraceae) and comparative chloroplast genomics analyses with closely related genera. PeerJ 2021, 9, e10886. [Google Scholar] [CrossRef]
  21. Osman, S.A. The Power of DNA Barcoding for Plant Identification. Egypt. J. Chem. 2024, 67, 633–646. [Google Scholar] [CrossRef]
  22. Gupta, M.K.; Senthilkumar, S.; Rangan, L. 3,5-Dihydroxy 4′,7-dimethoxyflavone–DNA interaction study for nucleic acid detection and differential cell staining. Int. J. Biol. Macromol. 2024, 261, 129713. [Google Scholar] [CrossRef]
  23. Phukan, A.; Gayan, J.; Ravindran, A.; Nabis, B. A standardized protocol for the genomic DNA isolation from the leaf of Camellia sinensis (Linn.) O. Kuntze. J. Food Agric. Environ. 2018, 16, 33–37. [Google Scholar]
  24. Drábková, L.Z. DNA extraction from herbarium specimens. In Molecular Plant Taxonomy: Methods and Protocols; Humana Press: Totowa, NJ, USA, 2014; pp. 69–84. [Google Scholar]
  25. Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Consortium, F.B.; List, F.B.C.A.; Bolchacova, E. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef]
  26. Suo, Z.; Chen, L.; Pei, D.; Jin, X.; Zhang, H. A new nuclear DNA marker from ubiquitin ligase gene region for genetic diversity detection of walnut germplasm resources. Biotechnol. Rep. 2015, 5, 40–45. [Google Scholar] [CrossRef] [PubMed]
  27. Dong, W.; Cheng, T.; Li, C.; Xu, C.; Long, P.; Chen, C.; Zhou, S. Discriminating plants using the DNA barcode rbc L b: An appraisal based on a large data set. Mol. Ecol. Resour. 2014, 14, 336–343. [Google Scholar] [CrossRef] [PubMed]
  28. Hasebe, M.; Omori, T.; Nakazawa, M.; Sano, T.; Kato, M.; Iwatsuki, K. rbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns. Proc. Natl. Acad. Sci. USA 1994, 91, 5730–5734. [Google Scholar] [CrossRef]
  29. CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef]
  30. Pokharel, S.; Khanal, B.C.; Basnet, A.; Pandey, G.R.; Basnet, S. DNA extraction and PCR optimization for DNA barcode analysis of commercially-grown coffee varieties in Nepal. Kathmandu Univ. J. Sci. Eng. Technol. 2023, 17. [Google Scholar] [CrossRef]
  31. Soldati, A. Characterisation of Apparent Mismatches Detected during Routine Short Tandem Repeat Analysis in Parentage Investigations. Master’s Thesis, University of the Free State, Bloemfontein, South Africa, 2023. [Google Scholar]
  32. Asif, S.; Khan, M.; Arshad, M.W.; Shabbir, M.I. PCR Optimization for Beginners: A Step by Step Guide. Res. Mol. Med. 2021, 9, 81–102. [Google Scholar] [CrossRef]
  33. Duineveld, B.M.; Kowalchuk, G.A.; Keijzer, A.; van Elsas, J.D.; van Veen, J.A. Analysis of bacterial communities in the rhizosphere of chrysanthemum via denaturing gradient gel electrophoresis of PCR-amplified 16S rRNA as well as DNA fragments coding for 16S rRNA. Appl. Environ. Microbiol. 2001, 67, 172–178. [Google Scholar] [CrossRef]
  34. Schwessinger, B.; Sperschneider, J.; Cuddy, W.S.; Garnica, D.P.; Miller, M.E.; Taylor, J.M.; Dodds, P.N.; Figueroa, M.; Park, R.F.; Rathjen, J.P. A near-complete haplotype-phased genome of the dikaryotic wheat stripe rust fungus Puccinia striiformis f. sp. tritici reveals high interhaplotype diversity. MBio 2018, 9, 1–24. [Google Scholar] [CrossRef]
  35. Kobiowu, A. Sequence Analysis and In Vitro Genome Editing of Atlantic salmon MHC-I-F10 Gene in Atlantic salmon Macrophage Cell line TO Cell. Master’s Thesis, Norwegian University of Life Sciences, Ås, Norway, 2022. [Google Scholar]
  36. Chatla, D.; Pamulapati, P.; Kola, S.; Naranji, M.K. Genetic identification of grouper fishes (Perciformes: Serranidae: Epinephelus) through DNA barcoding from Nizampatnam coastal waters: DNA barcoding of grouper fishes (Perciformes: Serranidae: Epinephelus). TAXA 2024, 3, ad23302. [Google Scholar]
  37. Jones, R.C.; Nicolle, D.; Steane, D.A.; Vaillancourt, R.E.; Potts, B.M. High density, genome-wide markers and intra-specific replication yield an unprecedented phylogenetic reconstruction of a globally significant, speciose lineage of Eucalyptus. Mol. Phylogenetics Evol. 2016, 105, 63–85. [Google Scholar] [CrossRef]
  38. Panda, R.; Nehra, A.K.; Ram, H.; Karikalan, M.; Garg, R.; Nala, R.R.; Pawde, A. Phylogenetic analysis and haplotype networking of Hepatozoon felis infecting wild animals in Gir National Park, Gujarat, India. Parasitol. Res. 2024, 123, 92. [Google Scholar] [CrossRef] [PubMed]
  39. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
  40. Pollegioni, P.; Woeste, K.; Chiocchini, F.; Del Lungo, S.; Ciolfi, M.; Olimpieri, I.; Tortolano, V.; Clark, J.; Hemery, G.E.; Mapelli, S. Rethinking the history of common walnut (Juglans regia L.) in Europe: Its origins and human interactions. PLoS ONE 2017, 12, e0172541. [Google Scholar] [CrossRef]
  41. Yang, C.-q.; Lv, Q.; Zhang, A.-b. Sixteen years of DNA barcoding in China: What has been done? What can Be done? Front. Ecol. Evol. 2020, 8, 57. [Google Scholar] [CrossRef]
  42. Chen, Z.; Gao, L.; Wang, H.; Feng, S. Molecular Identification and Phylogenetic Analysis of Cymbidium Species (Orchidaceae) Based on the Potential DNA Barcodes matK, rbcL, psbA-trnH, and Internal Transcribed Spacer. Agronomy 2024, 14, 933. [Google Scholar] [CrossRef]
  43. Han, Q.; Zhang, Y.; Shu, Y.; Chen, J.; Zhang, Y.; Zhou, W.; Zhang, Z. Identification of Common Adulterants in Walnut Beverage Based on Plant DNA Barcode Technology. bioRxiv 2018. [Google Scholar] [CrossRef]
  44. Aradhya, M.K.; Potter, D.; Gao, F.; Simon, C.J. Molecular phylogeny of Juglans (Juglandaceae): A biogeographic perspective. Tree Genet. Genomes 2007, 3, 363–378. [Google Scholar] [CrossRef]
  45. Stevens, K.A.; Woeste, K.; Chakraborty, S.; Crepeau, M.W.; Leslie, C.A.; Martínez-García, P.J.; Puiu, D.; Romero-Severson, J.; Coggeshall, M.; Dandekar, A.M. Genomic variation among and within six Juglans species. G3 Genes Genomes Genet. 2018, 8, 2153–2165. [Google Scholar] [CrossRef] [PubMed]
  46. Ji, F.; Ma, Q.; Zhang, W.; Liu, J.; Feng, Y.; Zhao, P.; Song, X.; Chen, J.; Zhang, J.; Wei, X. A genome variation map provides insights into the genetics of walnut adaptation and agronomic traits. Genome Biol. 2021, 22, 1–22. [Google Scholar] [CrossRef] [PubMed]
  47. Öztoprak, H. Evolutionary Persistence and Speciation under Ancient Asexuality. Ph.D. Thesis, Universität zu Köln, Köln, Germany, 2023. [Google Scholar]
  48. Jennings, R.M.; Etter, R.J.; Ficarra, L. Population differentiation and species formation in the deep sea: The potential role of environmental gradients and depth. PLoS ONE 2013, 8, e77594. [Google Scholar] [CrossRef]
  49. Soltis, D.E.; Soltis, P.S.; Mort, M.E.; Chase, M.W.; Savolainen, V.; Hoot, S.B.; Morton, C.M. Inferring complex phylogenies using parsimony: An empirical approach using three large DNA data sets for angiosperms. Syst. Biol. 1998, 47, 32–42. [Google Scholar] [CrossRef] [PubMed]
  50. Qi, H.; Fan, P.; Wang, Y.; Liu, J. Genetic diversity and population structure of Juglans regia from six provinces in northern China. Biodivers. Sci. 2023, 31, 23120. [Google Scholar]
  51. Teske, D.; Peters, A.; Möllers, A.; Fischer, M. Genomic profiling: The strengths and limitations of chloroplast genome-based plant variety authentication. J. Agric. Food Chem. 2020, 68, 14323–14333. [Google Scholar] [CrossRef] [PubMed]
  52. Zhao, W.; Liu, Y.; Li, L.; Meng, H.; Yang, Y.; Dong, Z.; Wang, L.; Wu, G. Genome-wide identification and characterization of bHLH transcription factors related to anthocyanin biosynthesis in red walnut (Juglans regia L.). Front. Genet. 2021, 12, 632509. [Google Scholar] [CrossRef]
  53. Yildiz, E.; Pinar, H.; Uzun, A.; Yaman, M.; Sumbul, A.; Ercisli, S. Identification of genetic diversity among Juglans regia L. genotypes using molecular, morphological, and fatty acid data. Genet. Resour. Crop Evol. 2021, 68, 1425–1437. [Google Scholar] [CrossRef]
  54. Xiang, X.-G.; Wang, W.; Li, R.-Q.; Lin, L.; Liu, Y.; Zhou, Z.-K.; Li, Z.-Y.; Chen, Z.-D. Large-scale phylogenetic analyses reveal fagalean diversification promoted by the interplay of diaspores and environments in the Paleogene. Perspect. Plant Ecol. Evol. Syst. 2014, 16, 101–110. [Google Scholar] [CrossRef]
  55. Doğan, Y.; Kafkas, S.; Sütyemez, M.; Akça, Y.; Türemiş, N. Assessment and characterization of genetic relationships of walnut (Juglans regia L.) genotypes by three types of molecular markers. Sci. Hortic. 2014, 168, 81–87. [Google Scholar] [CrossRef]
  56. Abbasi Holasou, H.; Mohammadzadeh Jalaly, H.; Mohammadi, R.; Panahi, B. Genetic diversity and structure of superior spring frost tolerant genotypes of Persian walnut (Juglans regia L.) in East Azerbaijan province of Iran, characterized using inter simple sequence repeat (ISSR) markers. Genet. Resour. Crop Evol. 2023, 70, 539–548. [Google Scholar] [CrossRef]
  57. Martínez-García, P.J.; Crepeau, M.W.; Puiu, D.; Gonzalez-Ibeas, D.; Whalen, J.; Stevens, K.A.; Paul, R.; Butterfield, T.S.; Britton, M.T.; Reagan, R.L. The walnut (Juglans regia) genome sequence reveals diversity in genes coding for the biosynthesis of non-structural polyphenols. Plant J. 2016, 87, 507–532. [Google Scholar] [CrossRef]
  58. Zhao, P.; Zhou, H.-J.; Potter, D.; Hu, Y.-H.; Feng, X.-J.; Dang, M.; Feng, L.; Zulfiqar, S.; Liu, W.-Z.; Zhao, G.-F. Population genetics, phylogenomics and hybrid speciation of Juglans in China determined from whole chloroplast genomes, transcriptomes, and genotyping-by-sequencing (GBS). Mol. Phylogenetics Evol. 2018, 126, 250–265. [Google Scholar] [CrossRef]
Figure 1. Nuts, nut cross-sections, and leaflet variations of walnut genotypes studied. (A) Nut shape, (B) nut cross-section, and (C) leaflets.
Figure 1. Nuts, nut cross-sections, and leaflet variations of walnut genotypes studied. (A) Nut shape, (B) nut cross-section, and (C) leaflets.
Genes 15 01417 g001
Figure 2. The amplification success rate, sequencing success rate, and authentication of DNA barcode region for the identification of walnut genotypes.
Figure 2. The amplification success rate, sequencing success rate, and authentication of DNA barcode region for the identification of walnut genotypes.
Genes 15 01417 g002
Figure 3. Basic local alignment of query genotype-1 ITS2 nucleotide sequence with reference database sequence, resulting in a single-nucleotide deletion (indicated by arrow) out of 430 nucleotides in position 12 of ITS2 sequence of genome.
Figure 3. Basic local alignment of query genotype-1 ITS2 nucleotide sequence with reference database sequence, resulting in a single-nucleotide deletion (indicated by arrow) out of 430 nucleotides in position 12 of ITS2 sequence of genome.
Genes 15 01417 g003
Figure 4. Phylogenetic tree constructed using NJ method prescribed by Saitou and Nei [39] for query nucleotide sequence of ITS2 of genotype-1 (marked with green node).
Figure 4. Phylogenetic tree constructed using NJ method prescribed by Saitou and Nei [39] for query nucleotide sequence of ITS2 of genotype-1 (marked with green node).
Genes 15 01417 g004
Figure 5. Alignment of query genotype-2 nucleotide sequence of UBE3 with the database reference sequence.
Figure 5. Alignment of query genotype-2 nucleotide sequence of UBE3 with the database reference sequence.
Genes 15 01417 g005
Figure 6. Phylogenetic tree constructed using NJ method Saitou and Nei [39] for query sequence of UBE3 for genotype-2 (node is marked with green color).
Figure 6. Phylogenetic tree constructed using NJ method Saitou and Nei [39] for query sequence of UBE3 for genotype-2 (node is marked with green color).
Genes 15 01417 g006
Figure 7. Alignment of query genotype-3 nucleotide sequence of rbcLa with the reference sequences collected database.
Figure 7. Alignment of query genotype-3 nucleotide sequence of rbcLa with the reference sequences collected database.
Genes 15 01417 g007
Figure 8. Phylogenetic tree constructed using NJ method Saitou and Nei [39] for query nucleotide sequence of rbcLa for genotype-3. The genotypes in green colors indicates classes occurrence.
Figure 8. Phylogenetic tree constructed using NJ method Saitou and Nei [39] for query nucleotide sequence of rbcLa for genotype-3. The genotypes in green colors indicates classes occurrence.
Genes 15 01417 g008
Figure 9. Alignment of query genotype-4 nucleotide sequence of rbcLc with the reference database sequences. The variations in the nucleotide’s sequences are marked by arrows.
Figure 9. Alignment of query genotype-4 nucleotide sequence of rbcLc with the reference database sequences. The variations in the nucleotide’s sequences are marked by arrows.
Genes 15 01417 g009
Figure 10. Phylogenetic tree constructed using NJ method Saitou and Nei [39] for query sequence of rbcLc genotype-4. The Genotypes in the green colors alongside of G-4 are the closest and previously reported.
Figure 10. Phylogenetic tree constructed using NJ method Saitou and Nei [39] for query sequence of rbcLc genotype-4. The Genotypes in the green colors alongside of G-4 are the closest and previously reported.
Genes 15 01417 g010
Figure 11. Alignment of query genotype-5 nucleotide sequence of rpoC1 with the reference sequence collected from database. The variables nucleotides are marked with arrows.
Figure 11. Alignment of query genotype-5 nucleotide sequence of rpoC1 with the reference sequence collected from database. The variables nucleotides are marked with arrows.
Genes 15 01417 g011
Figure 12. Phylogenetic tree constructed using NJ method Saitou and Nei [39] for query sequence of rpoC1 genotype-5 (green node).
Figure 12. Phylogenetic tree constructed using NJ method Saitou and Nei [39] for query sequence of rpoC1 genotype-5 (green node).
Genes 15 01417 g012
Figure 13. DNA barcode of selected markers selected walnut genotypes.
Figure 13. DNA barcode of selected markers selected walnut genotypes.
Genes 15 01417 g013
Table 1. Collection sites of genotypes studied.
Table 1. Collection sites of genotypes studied.
GenotypesCollection SitesLatitude (N)Longitude (E)
Genotype-1Shingli bala Battagram34°40′42″72°59′05″
Genotype-2Sanger valley Kaghan34°34′55″73°22′43″
Genotype-3Jared valley Kaghan34°40′34″73°33′24″
Genotype-4Rashang valley Allai34°49′10″73°7′30″
Genotype-5Shatial upper Kohistan35°31′37″73°32′36″
Table 2. DNA barcode regions and their nucleotide sequences used.
Table 2. DNA barcode regions and their nucleotide sequences used.
Barcode RegionPrimersSequence 5′–3′References
ITS2F5′ATGCGATACTTGGTGTGAAT3′[25]
UBE3F5′TCGCCTCCAAGTTCAGTG3′[26]
rbcLaF5′ATGTCACCACAAACAGAGACTAAAGC3′[27]
rbcLcF5′TGAAAACGTGAATTCCCAACCGTTTATGCG3′[28]
rpoC1F5′AATCTATGCAGGGTAGGCGC3′[29]
Table 3. The sequence lengths, query covers, E-values, and percent identity of studied DNA barcode regions.
Table 3. The sequence lengths, query covers, E-values, and percent identity of studied DNA barcode regions.
PrimersSequence (bp)Query CoverE-Value% Identity
ITS233594099.77
UBE3768920100
rbcLa698990100
rbcLc58738096.89
rpoC164658099.65
Table 4. Molecular characterizations of candidate’s DNA barcode regions in selected genotypes.
Table 4. Molecular characterizations of candidate’s DNA barcode regions in selected genotypes.
Barcode RegionTotal CharactersConserved SitesVariable SiteParsimony InfoSingleton
ITS2335326707
UBE376846530328815
rbcLa698698000
rbcLc587538555
rpoC16463312390239
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sajjad, S.; Islam, M.; Muhammad, K.; Ghafoor, S.-u.; Ullah, I.; Khan, A.; Siraj, M.; Alrefaei, A.F.; Shah, J.A.; Ali, S. Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis. Genes 2024, 15, 1417. https://doi.org/10.3390/genes15111417

AMA Style

Sajjad S, Islam M, Muhammad K, Ghafoor S-u, Ullah I, Khan A, Siraj M, Alrefaei AF, Shah JA, Ali S. Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis. Genes. 2024; 15(11):1417. https://doi.org/10.3390/genes15111417

Chicago/Turabian Style

Sajjad, Sajjad, Muhammad Islam, Khushi Muhammad, Sajid-ul Ghafoor, Irfan Ullah, Asif Khan, Muhammad Siraj, Abdulwahed Fahad Alrefaei, Jawad Ali Shah, and Sajid Ali. 2024. "Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis" Genes 15, no. 11: 1417. https://doi.org/10.3390/genes15111417

APA Style

Sajjad, S., Islam, M., Muhammad, K., Ghafoor, S.-u., Ullah, I., Khan, A., Siraj, M., Alrefaei, A. F., Shah, J. A., & Ali, S. (2024). Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis. Genes, 15(11), 1417. https://doi.org/10.3390/genes15111417

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop