Transcriptome Sequencing Analysis of Genes Associated with Different Developmental Periods of the Ovarian Follicle in the Duolang Sheep
Abstract
:1. Introduction
2. Materials and Methods
2.1. Collection of Tissue Samples and Ethics Statement
2.2. RNA Extraction, Library Construction, and Illumina Sequencing
2.3. Differential Expression Analysis
2.4. Functional Annotation and PPI Analysis
2.5. Verification of the Reliability of the RNA-Seq Data
3. Results
3.1. Morphological Analysis of Ovarian Follicles in Sheep
3.2. Results and Analysis of Sequencing Data
3.3. Differential Expression Analysis Results
3.4. Functional Annotation and Enrichment Analysis of Differential Genes
3.5. Identification of Key Differential Candidate Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhen, C. The nutritional value of mutton and the influencing factors of its quality. Meat Res. 2003, 47–48. [Google Scholar]
- Yang, Y.X.; Wu, H.Q. Research Progress and Industrial Development Thinking of Xinjiang Duolang Sheep. Mod. Anim. Husb. Vet. 2022, 3, 90–93. [Google Scholar]
- Yang, L.G. Theriogenology, 2nd ed.; China Agricultural Publishing House: Beijing, China, 2010; pp. 18–19. ISBN 978-7-109-14764-5. [Google Scholar]
- Zhou, X. Theriogenology, 1st ed.; Science Press: Beijing, China, 2015; pp. 94–97. ISBN 978-7-03-044924-5. [Google Scholar]
- Tian, Y.B.; Zeng, S.Q.; Chen, X.J.; Shi, Z.D. Regulation of Mammalian Follicular Growth and Development. Genom. Appl. Biol. 2006, 25, 127–134. [Google Scholar]
- Xu, M.M.; Che, L.; Xu, S.Y.; Wu, D. Formation and Development of Primordial Follicles in Mammals and Influencing Factors. J. Anim. Husb. Vet. Med. 2015, 46, 20–25. [Google Scholar]
- Zhou, J.; Peng, X.; Mei, S. Autophagy in Ovarian Follicular Development and Atresia. Int. J. Biol. Sci. 2019, 15, 726–737. [Google Scholar] [CrossRef]
- Tang, J.S. Screening of Candidate Genes for Sheep Prolificacy by Transcriptome Sequencing and Proteomics Analysis. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2019. [Google Scholar]
- Wang, H.E.; Feng, X.W.; Muhatai, G.M.G.L.; Wang, L. Expression profile analysis of sheep ovary after superovulation and estrus synchronisation treatment. Vet. Med. Sci. 2022, 8, 1276–1287. [Google Scholar] [CrossRef]
- Knights, M.; Singh-Knights, D. Use of controlled internal drug releasing (CIDR) devices to control reproduction in goats: A review. Anim. Sci. J. 2016, 87, 1084–1089. [Google Scholar] [CrossRef]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Itoh, M. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef]
- Xie, C.; Gao, J.; Yuan, Y.S.; Yu, Y. Bioinformatics Analysis of Protein-Protein Interactions and Interaction Networks. J. Shanghai Jiaotong Univ. (Med. Sci.) 2009, 29, 465–469. [Google Scholar]
- McGee, E.A.; Hsueh, A.J. Initial and cyclic recruitment of ovarian follicles. Endocr. Rev. 2000, 21, 200–214. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Du, Z.X.; Zong, Z.H.; Liu, B.Q.; Li, C.; Zhang, Q.; Wang, H.Q. PKCdelta-mediated phosphorylation of BAG3 at Ser187 site induces epithelial-mesenchymal transition and enhances invasiveness in thyroid cancer FRO cells. Oncogene 2013, 32, 4539–4548. [Google Scholar] [CrossRef]
- Rosati, A.; Graziano, V.; De Laurenzi, V.; Pascale, M.; Turco, M.C. BAG3: A multifaceted protein that regulates major cell pathways. Cell Death Dis. 2011, 2, e141. [Google Scholar] [CrossRef]
- Li, X.; Colvin, T.; Rauch, J.N.; Acosta-Alvear, D.; Kampmann, M.; Dunyak, B.; Hann, B.; Aftab, B.T.; Murnane, M.; Cho, M. Validation of the Hsp70-Bag3 Protein-Protein Interaction as a Potential Therapeutic Target in Cancer. Mol. Cancer Ther. 2015, 14, 645–648. [Google Scholar] [CrossRef]
- Falco, A.; Festa, M.; Basile, A.; Rosati, A.; Pascale, M.; Florenzano, F.; Nori, S.L.; Nicolin, V.; Di Benedetto, M.; Vecchione, M.L.; et al. BAG3 controls angiogenesis through regulation of ERK phosphorylation. Oncogene 2012, 31, 5153–5161. [Google Scholar] [CrossRef]
- De Marco, M.; Falco, A.; Iaccarino, R.; Raffone, A.; Mollo, A.; Guida, M.; Rosati, A.; Chetta, M.; Genovese, G.; De Caro, M.; et al. An emerging role for BAG3 in gynaecological malignancies. Br. J. Cancer 2021, 125, 789–797. [Google Scholar] [CrossRef]
- Wheeler, A.P.; Ridley, A.J. RhoB affects macrophage adhesion, integrin expression and migration. Exp. Cell Res. 2007, 313, 3505–3516. [Google Scholar] [CrossRef]
- Chermuła, B.; Brązert, M.; Iżycki, D.; Ciesiółka, S.; Kranc, W.; Celichowski, P.; Ożegowska, K.; Nawrocki, M.J.; Jankowski, M.; Jeseta, M.; et al. New Gene Markers of Angiogenesis and Blood Vessels Development in Porcine Ovarian Granulosa Cells during Short-Term Primary Culture In Vitro. Biomed Res. Int. 2019, 2019, 1–12. [Google Scholar] [CrossRef]
- Daans, M.; Luyten, F.P.; Lories, R.J. GDF5 deficiency in mice is associated with instability-driven joint damage, gait and subchondral bone changes. Ann. Rheum. Dis. 2011, 70, 208–213. [Google Scholar] [CrossRef]
- Hinoi, E.; Nakamura, Y.; Takada, S.; Fujita, H.; Iezaki, T.; Hashizume, S.; Takahashi, S.; Odaka, Y.; Watanabe, T.; Yoneda, Y. Growth Differentiation Factor-5 Promotes Brown Adipogenesis in Systemic Energy Expenditure. Diabetes 2014, 63, 162–175. [Google Scholar] [CrossRef] [PubMed]
- Byrnes, A.M.; Racacho, L.; Nikkel, S.M.; Xiao, F.; Macdonald, H.; Underhill, T.M.; Bulman, D.E. Mutations in GDF5 presenting as semidominant brachydactyly A1. Hum. Mutat. 2010, 31, 1155–1162. [Google Scholar] [CrossRef] [PubMed]
- Valdes, A.M.; Evangelou, E.; Kerkhof, H.; Tamm, A.; Doherty, S.A.; Kisand, K.; Tamm, A.; Kerna, I.; Uitterlinden, A.; Hofman, A. The GDF5 rs143383 polymorphism is associated with osteoarthritis of the knee with genome-wide statistical significance. Ann. Rheum. Dis. 2011, 70, 873–875. [Google Scholar] [CrossRef] [PubMed]
- Bahire, S.V.; Rajput, P.K.; Kumar, V.; Kumar, D.; Kataria, M.; Kumar, S. Quantitative expression of mRNA encoding BMP/SMAD signalling genes in the ovaries of Booroola carrier and non-carrier GMM sheep. Reprod. Domest. Anim. 2019, 54, 1375–1383. [Google Scholar] [CrossRef]
- Gao, K.X. Study on the Expression Regulation Mechanism and Function of RUNX1 and RUNX2 in Ovarian Granulosa Cells of Dairy Goats. Ph.D. Thesis, Northwest A&F University, Xi’an, China, 2018. [Google Scholar]
- Liu, J.; Eun-Sil, P.; Curry, T.E.; Misung, J. Periovulatory expression of hyaluronan and proteoglycan link protein 1 (Hapln1) in the rat ovary: Hormonal regulation and potential function. Mol. Endocrinol. 2010, 2010, 1203–1217. [Google Scholar] [CrossRef]
- Inmaculada, H.G.; Ignacio, G.R.; Masayuki, S.; Wayne, C.M.; Ochsner, S.A.; Lisa, W.; Richards, J.S. Gene expression profiles of cumulus cell oocyte complexes during ovulation reveal cumulus cells express neuronal and immune-related genes: Does this expand their role in the ovulation process? Mol. Endocrinol. 2006, 2006, 1300. [Google Scholar] [CrossRef]
- Chakravarthi, V.P.; Ratri, A.; Masumi, S.; Borosha, S.; Ghosh, S.; Christenson, L.K.; Roby, K.F.; Wolfe, M.W.; Rumi, M.A.K. Granulosa cell genes that regulate ovarian follicle development beyond the antral stage: The role of estrogen receptor β. Mol. Cell. Endocrinol. 2021, 528, 111212. [Google Scholar] [CrossRef]
- Zhou, Z.Y.; Chang, T.F.; Lin, Z.B.; Jing, Y.T.; Wen, L.S.; Niu, Y.L.; Bai, Q.; Guo, C.M.; Sun, J.X.; Wang , Y.S.; et al. Microglial Galectin3 enhances endothelial metabolism and promotes pathological angiogenesis via Notch inhibition by competitively binding to Jag1. Cell Death Dis. 2023, 14, 380. [Google Scholar] [CrossRef]
- Zhang, S.; Xu, Y.; Xie, C.; Ren, L.; Wu, G.; Yang, M.; Wu, X.; Tang, M.; Hu, Y.; Li, Z.; et al. RNF219/alpha-Catenin/LGALS3 Axis Promotes Hepatocellular Carcinoma Bone Metastasis and Associated Skeletal Complications. Adv. Sci. 2021, 8, 2001961. [Google Scholar] [CrossRef]
- Freitag, N.; Tirado-Gonzalez, I.; Barrientos, G.; Powell, K.L.; Boehm-Sturm, P.; Koch, S.P.; Hecher, K.; Staff, A.C.; Arck, P.C.; Diemert, A.; et al. Galectin-3 deficiency in pregnancy increases the risk of fetal growth restriction (FGR) via placental insufficiency. Cell Death Dis. 2020, 11, 560. [Google Scholar] [CrossRef]
- Baek, S.Y.; Sa, S.J.; Jeong, Y.D.; Cho, E.S.; Hong, J.G.; Kim, Y.S.; Cho, K.H.; Park, S.H.; Kim, K.W.; Lee, H.C.; et al. Altrenogest affects expression of galectin-3 and fibroblast growth factor 9 in the reproductive tract of sows. Anim. Biotechnol. 2021, 32, 537–543. [Google Scholar] [CrossRef] [PubMed]
- Piprek, R.P.; Kolasa, M.; Podkowa, D.; Kloc, M.; Kubiak, J.Z. Tissue-specific knockout of E-cadherin (Cdh1) in developing mouse gonads causes germ cells loss. Reproduction 2019, 158, 147–157. [Google Scholar] [CrossRef] [PubMed]
- Suriano, G.; Oliveira, C.; Ferreira, P.; Machado, J.C.; Bordin, M.C.; De Wever, O.; Bruyneel, E.A.; Moguilevsky, N.; Grehan, N.; Porter, T.R.; et al. Identification of CDH1 germline missense mutations associated with functional inactivation of the E-cadherin protein in young gastric cancer probands. Hum. Mol. Genet. 2003, 12, 575–582. [Google Scholar] [CrossRef] [PubMed]
- Shi, M.; Whorton, A.E.; Nikola, S.; Marilène, P.; Maclean, J.A.; Song, Y.; Terry, V.D.; Kanako, H. Inactivation of TRP53, PTEN, RB1, and/or CDH1 in the ovarian surface epithelium induces ovarian cancer transformation and metastasis. Biol. Reprod. 2020, 102, 1055–1064. [Google Scholar] [CrossRef]
- Holt, J.E.; Weaver, J.; Jones, K.T. Spatial regulation of APCCdh1-induced cyclin B1 degradation maintains G2 arrest in mouse oocytes. Development 2010, 137, 1297–1304. [Google Scholar] [CrossRef]
- Reis, A.; Chang, H.Y.; Levasseur, M.; Jones, K.T. APCcdh1 activity in mouse oocytes prevents entry into the first meiotic division. Nat. Cell Biol. 2006, 8, 539–540. [Google Scholar] [CrossRef]
Sample ID | Raw Reads | Clean Reads | Clean Bases | Clean Ratio (%) | Q20 (%) | Q30 (%) |
---|---|---|---|---|---|---|
DTA1 | 35,201,732 | 34,599,992 | 10.38G | 98.29 | 96.72 | 95 |
DTA2 | 43,245,660 | 42,453,517 | 12.74G | 98.17 | 96.76 | 94.96 |
DTA3 | 39,512,871 | 38,877,267 | 11.66G | 98.39 | 96.85 | 95.08 |
DTB1 | 42,120,748 | 41,341,445 | 12.4G | 98.15 | 96.62 | 94.86 |
DTB2 | 41,952,090 | 41,237,817 | 12.37G | 98.30 | 96.1 | 94.08 |
DTB3 | 37,962,740 | 37,200,417 | 11.16G | 97.99 | 96.12 | 94.15 |
DTC1 | 38,470,424 | 37,869,649 | 11.36G | 98.44 | 96.42 | 94.56 |
DTC2 | 45,956,002 | 45,135,112 | 13.54G | 98.21 | 96.8 | 95.02 |
DTC3 | 51,147,006 | 50,215,954 | 15.06G | 98.18 | 96.03 | 93.83 |
Sample ID | Total Reads | Total Map | Unique Map |
---|---|---|---|
DTA1 | 69,199,984 | 58,278,035 (84.22%) | 54,937,151 (79.39%) |
DTA2 | 84,907,034 | 70,679,122 (83.24%) | 66,714,211 (78.57%) |
DTA3 | 77,754,534 | 65,144,708 (83.78%) | 61,556,713 (79.17%) |
DTB1 | 82,682,890 | 67,937,003 (82.17%) | 63,987,224 (77.39%) |
DTB2 | 82,475,634 | 67,294,692 (81.59%) | 63,555,854 (77.06%) |
DTB3 | 74,400,834 | 61,123,995 (82.15%) | 57,632,036 (77.46%) |
DTC1 | 75,739,298 | 62,363,535 (82.34%) | 58,649,112 (77.44%) |
DTC2 | 90,270,224 | 74,067,730 (82.05%) | 69,736,018 (77.25%) |
DTC3 | 100,431,908 | 79,698,447 (79.36%) | 75,107,870 (74.78%) |
Gene Name | Description | DTA/DTB | DTB/DTC | DTA/DTC | |||
---|---|---|---|---|---|---|---|
log2FC | p-Value | log2FC | p-Value | log2FC | p-Value | ||
BAG3 | BCL2 Associated Athanogene 3 | −0.24 | <0.05 | −1.00 | <0.01 | −1.25 | <0.01 |
RHOB | Ras Homolog Family Member B | −0.37 | <0.05 | −0.70 | <0.01 | −1.07 | <0.01 |
GDF5 | Growth Differentiation Factor 5 | 0.52 | >0.05 | −0.84 | >0.05 | −1.36 | <0.01 |
LGALS3 | Galectin-3 | −0.16 | >0.05 | −1.31 | <0.01 | −1.47 | <0.01 |
RUNX2 | Runt-Related Transcription Factor 2 | −1.23 | >0.05 | 1.65 | <0.01 | 0.43 | >0.05 |
CDH1 | Cadherin 1 | 1.64 | <0.01 | −1.31 | <0.01 | 0.34 | >0.05 |
Gene Name | Sequence (5′-to-3′) | Accession Number | Product Size (bp) |
---|---|---|---|
RUNX2 | F:TGAGCTCCGAAATGCCTCTG | XM_042237136 | 267 |
R:GGATGAGGAATGCGCCCTAA | |||
BAG3 | F:AAGCCCAGAAGACGCACTAC | XM_004020234 | 250 |
R:GGTTCTCGATGGGTCATGGG | |||
RHOB | F:GCACGTATGCGCACTCTTTT | NM_001127673 | 194 |
R:AGTACCACTGGATGGGGGAA | |||
GAPDH | F:GCCGCATCCCTGAGACAAG | NM_001190390 | 113 |
R:TGATGGCAACGATGTCCACTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, C.; Yan, H.; Hao, W.; Li, F.; Liu, T.; Wang, H. Transcriptome Sequencing Analysis of Genes Associated with Different Developmental Periods of the Ovarian Follicle in the Duolang Sheep. Genes 2024, 15, 1394. https://doi.org/10.3390/genes15111394
Wang C, Yan H, Hao W, Li F, Liu T, Wang H. Transcriptome Sequencing Analysis of Genes Associated with Different Developmental Periods of the Ovarian Follicle in the Duolang Sheep. Genes. 2024; 15(11):1394. https://doi.org/10.3390/genes15111394
Chicago/Turabian StyleWang, Chengqian, Hang Yan, Wen Hao, Fugui Li, Tianci Liu, and Hui’e Wang. 2024. "Transcriptome Sequencing Analysis of Genes Associated with Different Developmental Periods of the Ovarian Follicle in the Duolang Sheep" Genes 15, no. 11: 1394. https://doi.org/10.3390/genes15111394
APA StyleWang, C., Yan, H., Hao, W., Li, F., Liu, T., & Wang, H. (2024). Transcriptome Sequencing Analysis of Genes Associated with Different Developmental Periods of the Ovarian Follicle in the Duolang Sheep. Genes, 15(11), 1394. https://doi.org/10.3390/genes15111394