Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Identification and Physicochemical Property Analysis of Wheat SNAP Gene Family Members
2.3. Systematic Evolutionary Analysis of Wheat SNAP Gene Family
2.4. Gene Structure and Conserved Motif Analysis of Wheat SNAP Gene Family
2.5. Chromosome Localization Analysis of Wheat SNAP Gene Family
2.6. Cis-Acting Element Analysis of Wheat SNAP Gene Family
2.7. RNA Extraction and Real-Time Fluorescence Quantitative PCR Analysis
3. Results
3.1. Basic Information Analysis of Wheat SNAP Gene Family Members
3.2. Systematic Evolutionary Analysis of Wheat SNAP Gene Family Members
3.3. Structural Feature Analysis of Wheat SNAP Gene Family
3.4. Chromosome Localization Analysis of Wheat SNAP Gene Family
3.5. Cis-Acting Element Analysis of Wheat SNAP Gene Family
3.6. Expression of Wheat SNAP Gene Family in Different Tissues and Abiotic Stresses and Hormone Treatments
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bao, J.; Xu, J.H. Molecular Research for Cereal Grain Quality. Int. J. Mol. Sci. 2023, 24, 13687. [Google Scholar] [CrossRef] [PubMed]
- Gupta, P.K.; Balyan, H.S.; Sharma, S.; Kumar, R. Genetics of yield, abiotic stress tolerance and biofortification in wheat (Triticum aestivum L.). Theor. Appl. Genet. 2020, 133, 1569–1602. [Google Scholar] [CrossRef] [PubMed]
- Sharma, P.; Mishra, S.; Pandey, B.; Singh, G. Genome-wide identification and expression analysis of the NHX gene family under salt stress in wheat (Triticum aestivum L.). Front. Plant Sci. 2023, 14, 1266699. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Ma, Y.; Huang, X.; Song, L.; Li, N.; Qiao, M.; Li, T.; Hai, D.; Cheng, Y. GABA Application Enhances Drought Stress Tolerance in Wheat Seedlings (Triticum aestivum L.). Plants 2023, 12, 2495. [Google Scholar] [CrossRef]
- Xu, K.; Zhao, Y.; Zhao, S.; Liu, H.; Wang, W.; Zhang, S.; Yang, X. Genome-Wide Identification and Low Temperature Responsive Pattern of Actin Depolymerizing Factor (ADF) Gene Family in Wheat (Triticum aestivum L.). Front. Plant Sci. 2021, 12, 618984. [Google Scholar] [CrossRef]
- Yu, M.; Yu, Y.; Guo, S.; Zhang, M.; Li, N.; Zhang, S.; Zhou, H.; Wei, F.; Song, T.; Cheng, J.; et al. Identification of TaBADH-A1 allele for improving drought resistance and salt tolerance in wheat (Triticum aestivum L.). Front. Plant Sci. 2022, 13, 942359. [Google Scholar] [CrossRef]
- Yang, J. The development and prospect of saline soil research in China. Acta Pedol. Sin. 2008, 45, 837–845. [Google Scholar]
- Wei, B. Distribution and genesis analysis of saline-alkali soils in China. J. Soil Water Conserv. Technol. 2012, 6, 27–28. [Google Scholar]
- Zheng, D. Ecological construction issues in the arid areas of Northwest China. In Proceedings of the Symposium on Physical Geography and Ecological Construction; Institute of Geographic Sciences and Natural Resources Research, Chinese Academy of Sciences: Beijing, China, 2006; p. 6. [Google Scholar]
- Wang, Y.; Ling, L.; Zhang, W.; Wang, D.; Guo, G. Genome-wide identification and expression analysis of the B-box gene family in wheat. J. Crop Sci. 2021, 47, 1437–1449. [Google Scholar]
- Rizo, J. Molecular Mechanisms Underlying Neurotransmitter Release. Annu. Rev. Biophys. 2022, 51, 377–408. [Google Scholar] [CrossRef]
- Stenbeck, G. Soluble NSF-attachment proteins. Int. J. Biochem. Cell Biol. 1998, 30, 573–577. [Google Scholar] [CrossRef] [PubMed]
- Grote, E.; Novick, P.J. Promiscuity in Rab-SNARE interactions. Mol. Biol. Cell. 1999, 10, 4149–4161. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Li, Y.; Guo, H.; Wang, Q. Cloning, expression, and bioinformatics analysis of the StSNAP30 gene in potato. Mol. Plant Breed. 2022, 20, 1425–1434. [Google Scholar]
- Salinas-Cornejo, J.; Madrid-Espinoza, J.; Verdugo, I.; Pérez-Díaz, J.; Martín-Davison, A.S.; Norambuena, L.; Ruiz-Lara, S. The Exocytosis Associated SNAP25-Type Protein, SlSNAP33, Increases Salt Stress Tolerance by Modulating Endocytosis in Tomato. Plants 2021, 10, 1322. [Google Scholar] [CrossRef]
- Bao, Y.M.; Wang, J.F.; Huang, J.; Zhang, H.S. Molecular cloning and characterization of a novel SNAP25-type protein gene OsSNAP32 in rice (Oryza sativa L.). Mol. Biol. Rep. 2008, 35, 145–152. [Google Scholar] [CrossRef]
- Heese, M.; Gansel, X.; Sticher, L.; Wick, P.; Grebe, M.; Granier, F.; Jurgens, G. Functional characterization of the KNOLLE-interacting t-SNARE AtSNAP33 and its role in plant cytokinesis. J. Cell Biol. 2001, 155, 239–249. [Google Scholar] [CrossRef]
- Wick, P.; Gansel, X.; Oulevey, C.; Page, V.; Studer, I.; Dürst, M.; Sticher, L. The expression of the t-SNARE AtSNAP33 is induced by pathogens and mechanical stimulation. Plant Physiol. 2003, 132, 343–351. [Google Scholar] [CrossRef]
- Lei, P.; Wei, X.; Gao, R.; Huo, F.; Nie, X.; Tong, W.; Song, W. Genome-wide identification of PYL gene family in wheat: Evolution, expression and 3D structure analysis. Genomics 2021, 113, 854–866. [Google Scholar] [CrossRef]
- Wang, L.; Qin, L.; Sun, X.; Zhao, S.; Yu, L.; Chen, S.; Wang, M. Salt stress-induced changes in soil metabolites promote cadmium transport into wheat tissues. J. Environ. Sci. 2023, 127, 577–588. [Google Scholar] [CrossRef]
- Zhao, S.; Zhang, Q.; Liu, M.; Zhou, H.; Ma, C.; Wang, P. Regulation of Plant Responses to Salt Stress. Int. J. Mol. Sci. 2021, 22, 4609. [Google Scholar] [CrossRef]
- Bolser, D.; Staines, D.M.; Pritchard, E.; Kersey, P. Ensembl Plants: Integrating Tools for Visualizing, Mining, and Analyzing Plant Genomics Data. Methods Mol. Biol. 2016, 1374, 115–140. [Google Scholar] [PubMed]
- Hyeon Jeong, J.; Joo Jung, W.; Weon Seo, Y. Genome-wide identification and expression analysis of the annexin gene family in rye (Secale cereale L.). Gene 2022, 838, 146704. [Google Scholar] [CrossRef] [PubMed]
- Bolser, D.M.; Kerhornou, A.; Walts, B.; Kersey, P. Triticeae resources in Ensembl Plants. Plant Cell Physiol. 2015, 56, e3. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Lv, H.; Li, L.; Liu, J.; Mu, S.; Li, X.; Gao, J. Genome-Wide Analysis of the AP2/ERF Transcription Factors Family and the Expression Patterns of DREB Genes in Moso Bamboo (Phyllostachys edulis). PLoS ONE 2015, 10, e0126657. [Google Scholar] [CrossRef] [PubMed]
- Mei, F.; Chen, B.; Du, L.; Li, S.; Zhu, D.; Chen, N.; Zhang, Y.; Li, F.; Wang, Z.; Cheng, X.; et al. A gain-of-function allele of a DREB transcription factor gene ameliorates drought tolerance in wheat. Plant Cell. 2022, 34, 4472–4494. [Google Scholar] [CrossRef]
- Zhang, M.; Liu, W.; Bi, Y.P. [Dehydration-responsive element-binding (DREB) transcription factor in plants and its role during abiotic stresses]. Yi Chuan 2009, 31, 236–244. (In Chinese) [Google Scholar] [CrossRef]
- Yoon, T.Y.; Munson, M. SNARE complex assembly and disassembly. Curr. Biol. 2018, 28, R397–R401. [Google Scholar] [CrossRef]
- Lou, X.; Shin, Y.K. SNARE zippering. Biosci. Rep. 2016, 36, e00327. [Google Scholar] [CrossRef]
- Wang, T.; Li, L.; Hong, W. SNARE proteins in membrane trafficking. Traffic 2017, 18, 767–775. [Google Scholar] [CrossRef]
- Lakhssassi, N.; Liu, S.; Bekal, S.; Zhou, Z.; Colantonio, V.; Lambert, K.; Barakat, A.; Meksem, K. Characterization of the Soluble NSF Attachment Protein gene family identifies two members involved in additive resistance to a plant pathogen. Sci. Rep. 2017, 24, 45226. [Google Scholar] [CrossRef]
- Kádková, A.; Radecke, J.; Jakob; Sørensen, B. The SNAP-25 Protein Family. Neuroscience 2019, 420, 50–71. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Wang, T.; Jia, Z.H.; Xuan, J.P.; Pan, D.L.; Guo, Z.R.; Zhang, J.Y. Genome-Wide Bioinformatics Analysis of MAPK Gene Family in Kiwifruit (Actinidia chinensis). Int. J. Mol. Sci. 2018, 24, 2510. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Garcia, C.M.; Finer, J.J. Identification and validation of promoters and cis-acting regulatory elements. Plant Sci. 2014, 217–218, 109–119. [Google Scholar] [CrossRef] [PubMed]
- Furihata, T.; Maruyama, K.; Fujita, Y.; Umezawa, T.; Yoshida, R.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Abscisic acid-dependent multisite phosphorylation regulates the activity of a transcription activator AREB1. Proc. Natl. Acad. Sci. USA 2006, 103, 1988–1993. [Google Scholar] [CrossRef]
- Ma, H.; Bell, K.N.; Loker, R.N. qPCR and qRT-PCR analysis: Regulatory points to consider when conducting biodistribution and vector shedding studies. Mol. Ther. Methods Clin. Dev. 2020, 17, 152–168. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
TaSNAP1 | GCCAAGGCCGACAAACTA | GCATCCCACGGTGATGAG |
TaSNAP2 | CCGACCTAGCCGAGTTCCA | ATCCCACGCACTTCCGTTT |
TaSNAP3 | GAAGAGTGCTACCGCCTTGT | GTCGGAAACTTCATTCCAGAGT |
TaSNAP4 | AGAGTGCTACCGCCTTGT | CATCAGAGGCAGGTTGTG |
TaSNAP5 | TATGTGGAAGCCGCAAAC | CGGCCCTTTCTAGGTAATC |
TaSNAP6 | CCGCCGACCTATACGATA | GCAGCCATGCTCAATCTAC |
TaSNAP7 | TGGAGTTAGCCGAGTTCTACATG | CCGGTGGAGTAGTTGAAAGGAA |
TaSNAP8 | CCGCCGACCTATACGATA | GCAGCCATGCTCAATCTAC |
Gene Name | Gene ID | Coded Amino Acids | Isoelectric Point | Molecular Weight | Length (aa) | Group |
---|---|---|---|---|---|---|
TaSNAP1 | TraesCS2A02G461600.1 | 298 | 4.97 | 33083.88 | 899 | II |
TaSNAP2 | TraesCS2B02G109300.1 | 330 | 7.92 | 37561.43 | 995 | I |
TaSNAP3 | TraesCS2B02G483200.1 | 298 | 5.03 | 33025.84 | 899 | II |
TaSNAP4 | TraesCS2D02G461500.1 | 286 | 5.08 | 31782.45 | 863 | II |
TaSNAP5 | TraesCS7A02G292400.1 | 289 | 4.87 | 32473.27 | 872 | III |
TaSNAP6 | TraesCS7B02G182700.1 | 289 | 4.87 | 32505.33 | 872 | III |
TaSNAP7 | TraesCS7D02G170100.1 | 296 | 5.18 | 34045.13 | 893 | I |
TaSNAP8 | TraesCS7D02G284600.1 | 301 | 4.87 | 33725.76 | 906 | III |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Yu, Y.; Sun, Y.; Bai, Y.; Shu, Y.; Guo, C. Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat. Genes 2024, 15, 1311. https://doi.org/10.3390/genes15101311
Zhang X, Yu Y, Sun Y, Bai Y, Shu Y, Guo C. Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat. Genes. 2024; 15(10):1311. https://doi.org/10.3390/genes15101311
Chicago/Turabian StyleZhang, Xiaohan, Yanan Yu, Yumeng Sun, Yan Bai, Yongjun Shu, and Changhong Guo. 2024. "Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat" Genes 15, no. 10: 1311. https://doi.org/10.3390/genes15101311
APA StyleZhang, X., Yu, Y., Sun, Y., Bai, Y., Shu, Y., & Guo, C. (2024). Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat. Genes, 15(10), 1311. https://doi.org/10.3390/genes15101311