Next Article in Journal
The Mouse CircGHR Regulates Proliferation, Differentiation and Apoptosis of Hepatocytes and Myoblasts
Previous Article in Journal
Characterization and Phylogenetic Analysis of the Complete Mitochondrial Genome of Aythya marila
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regulatory Mechanisms of ArAux/IAA13 and ArAux/IAA16 in the Rooting Process of Acer rubrum

1
Beijing Advanced Innovation Center for Tree Breeding by Molecular Design, Beijing University of Agriculture, Beijing 102206, China
2
College of Landscape Architecture, Beijing University of Agriculture, Beijing 102206, China
3
Beijing Laboratory of Urban and Rural Ecological Environment, Beijing 102206, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Genes 2023, 14(6), 1206; https://doi.org/10.3390/genes14061206
Submission received: 23 April 2023 / Revised: 25 May 2023 / Accepted: 28 May 2023 / Published: 31 May 2023
(This article belongs to the Section Plant Genetics and Genomics)

Abstract

Acer rubrum is difficult to root during cutting propagation. Auxin/indole-acetic acids (Aux/IAA) proteins, which are encoded by the early response genes of auxin, are transcriptional repressors that play important roles in auxin-mediated root growth and development. In this study, ArAux/IAA13 and ArAux/IAA16, which were significantly differentially expressed after 300 mg/L indole butyric acid treatment, were cloned. Heatmap analysis revealed that they might be associated with the process of adventitious root (AR) growth and development mediated by auxin. Subcellular localization analysis showed that they performed their function in the nucleus. Bimolecular fluorescence complementation assays revealed the interactions between them and two auxin response factor (ARF) proteins, ArARF10 and ArARF18, confirming their relevance to AR growth and development. Overexpression of transgenic plants confirmed that the overexpression of ArAux/IAA13 and ArAux/IAA16 inhibited AR development. These results help elucidate the mechanisms of auxin-mediated AR growth and development during the propagation of A. rubrum and provide a molecular basis for the rooting of cuttings.

1. Introduction

A. rubrum belongs to the Sapindaceae family and is also known as red maple, scarlet maple, and swamp maple. It is native to the northeastern United States and is mainly distributed in the northern part of the United States and most of Canada. It is a landscape tree that is used for pollution control. It is also an important street tree [1,2] (Guo et al., 2021; Zhang, 2022). A. rubrum is extremely difficult to root under natural conditions. There are two main methods for the asexual propagation of red maple, namely cutting and grafting. At present, the survival rate of grafted red maple is higher than that of cuttings, though the survival rate of grafting is only 80% [3] (Li, 2018). As the grafting propagation process is tedious, time-consuming, and labor-intensive, it is necessary to select and purchase high-affinity rootstocks with scions. Later management also requires a lot of labor and material resources [4] (Li et al., 2019), and so compared with grafting propagation, cutting propagation is more effective in propagating A. rubrum in China at present.
Currently, the propagation techniques of cuttings both in China and abroad are relatively advanced and their principles have been analyzed relatively thoroughly. Plant hormones play an important role in the rooting of plant cuttings. The main plant hormone is auxin, which promotes the growth of plant roots and is one of the most important plant hormones. Adventitious roots (ARs) are mainly dependent on the induction of exogenous hormones, mainly 3-indoleacetic acid (IAA), indole butyric acid (IBA), and naphthalene acetic acid (NAA), which regulate the occurrence of the ARs mainly by influencing the distribution of plant hormones within the spike [5] (Ma et al., 2020). One study found that the application of exogenous auxin significantly increased the rooting rate of A. rubrum, and IAA was particularly closely related to plant rooting [6,7,8] (Zhang et al., 2017; Hao et al., 2009; Yuan et al., 2012). A large number of studies have shown that auxin is involved in most growth and developmental reactions in plants, and plants achieve complex functions mainly through auxin anabolism, polar transport, and signal transduction, in which the most typical signal transduction regulatory pathway is that auxin regulates the growth of plant root organs [9] (Ma et al., 2020). Dynamic changes in the auxin levels of this pathway can precisely regulate the expression of downstream genes of the pathway in which it is located, such as the Gretchen Hagen 3 (GH3), Auxin/Indole-Acetic Acids protein (Aux/IAA) gene family, Auxin Response Factor (ARF) gene family, and Small Auxin-Up RNA (SAUR) family [10] (Maitra Majee et al., 2020). The three families, Aux/IAA, GH3, and SAUR, are the families of genes that regulate the early auxin response [11] (Liu et al., 2019). Briefly, in this pathway, auxin acts as a binder, binding members of the Aux/IAA protein family to F-box proteins in the Transport Inhibitor Resistant 1/Auxin signaling F-Box (TIR1/AFB) protein family, which also interacts with Skp1, while Skp1 binds to Cullin-RBX1 dimers [12] (Leyser, 2018). The F-box is part of the SCF ubiquitin ligase complex, which releases activated ubiquitin (Ub) from the E1/E2 enzyme system and transfers it to the Aux/IAA proteins to ubiquitinate them, ultimately causing the Aux/IAA proteins to be degraded [13] (Zhu et al., 2021). When the concentration of auxin in plants is low, Aux/IAA proteins bind to the ARF transcription factors and together with the co-repressor TOPLESS (TPL) proteins repress the activity of the transcription factor ARFs, thus inhibiting the transcription of the auxin response genes. When the concentration of auxin is high, Aux/IAA proteins bind to the TIR1/AFB complex, which is eventually ubiquitinated and degraded by 26S protease, and eventually ARFs are released and bind to the AuxREs binding sites of the downstream auxin response genes, regulating the transcription of the auxin response genes [14] (Quintana-Escobar et al., 2019).
Interestingly, the proteins encoded by the Aux/IAA gene family, which is an important protein family in key plant hormone regulatory pathways, have now been identified as short-lived nuclear proteins that inhibit the activity of the ARF protein family [15] (Luo et al., 2018). Aux/IAA proteins usually contain four conserved domains. Domain I is a repressor domain containing a repeated motif of leucine (LxLxL) that recognizes and binds to the co-repressor TPL to co-repress the activity of ARF proteins [16] (Liu et al., 2017). Domain II is a highly conserved domain with a “GWPPV” motif that can be recognized and bound by the TIR1/AFB complex and eventually ubiquitinates the Aux/IAA proteins and plays an important role in protein stability [17] (Paul et al., 2016). Domain III and domain IV are involved in the homo- and hetero-dimerization of Aux/IAAs with ARFs [11] (Liu et al., 2019). The Aux/IAA gene family has been identified in several species, such as Glycine max [18] (Ali et al., 2022), Carica papaya [16] (Liu et al., 2017), Arabidopsis thaliana [14] (Quintana-Escobar et al., 2019), and Prunus persica [19] (Guan et al., 2019). A total of 65 members of the Aux/IAA gene family were recently identified in Raphanus sativus, of which six members of this family have high expression in the cortex, formative layer, and root tip of radish roots, presumably associated with root thickening. RsIAA33 in particular inhibits reproductive growth and promotes the thickening of the main radish roots [20] (Xie et al., 2021). In Oryza sativa, it has been shown that root growth and development are mainly regulated by the interaction between OsIAA13 and OsARF19 [21] (Yamauchi et al., 2019). It has even been hypothesized that AtIAA14 in A. thaliana interacts with the AtDi19-3 protein to promote lateral root formation, while the AtIAA14 mutant slr1 has a significant inhibitory effect on root growth induced by cold stress [10,22] (Maitra Majee et al., 2020; Aslam et al., 2020). However, we have not studied the key regulatory pathways of auxin in A. rubrum, and few reports have studied the Aux/IAA gene family in A. rubrum. Furthermore, there is no report on the regulatory mechanism of the interaction between Aux/IAAs and ARFs on the rooting of A. rubrum.
To improve the survival rate of A. rubrum cuttings, the rooting mechanism of maple from the molecular level of key regulatory pathways of auxin will be discussed herein. In our previous studies, 17 members of the Aux/IAA gene family were identified from the A. rubrum ‘Autumn Fantasy’ transcriptome by treating annual spikes with IBA and taking cuttings [13] (Zhu et al., 2021). We selected two genes, ArAux/IAA13 and ArAux/IAA16, for which gene expression was significantly down-regulated, and we hypothesized that they played a significant role in the rooting of maple cuttings. Therefore, in this paper, we performed transgenic functional verification and biochemical analysis of ArAux/IAA13 and ArAux/IAA16 to investigate the roles of the two genes in the rooting mechanism of A. rubrum. Because ArARF10 [23] (Zhu et al., 2022) and ArARF18 have been successfully demonstrated to participate in plant hormone signaling pathways and promote the growth of ARs in plants, they were selected as the ArAux/IAA13 and ArAux/IAA16 interacting proteins for related experiments in this study. This study will provide further insight into the mechanism of ARs generation of A. rubrum ‘Autumn Fantasy’, which will be important for the propagation of A. rubrum mass cuttings in the future.

2. Materials and Methods

2.1. Plant Materials

The cuttings selected for this study were obtained from A. rubrum ‘Autumn Fantasy’ from the nursery of Landscape Architecture, Beijing University of Agriculture. We selected annual young branches as the test materials. The annual branches were cut into spikes of about 8–10 cm in length, and the upper ports of these spikes were cut flat, and the lower ports were cut diagonally, keeping half of the leaves at the tip. They were then placed into a solution of KMnO4 at a concentration of 0.5% for sterilization. Afterward, based on a previous study by our research group, these spikes were divided equally into two groups, one of which was inserted into water and the other into a solution containing IBA at a concentration of 300 mg/L, soaked for 1 h, and then inserted into a pre-sterilized substrate (grass carbon: vermiculite = 3:1). They were, respectively, named CK and IBA300. The room temperature was controlled at 18–25 °C, the air humidity was maintained at 60%, and the soil humidity was 80%. Ten days later, the phloem within 3 cm of the base of the spike was extracted. The removed phloem of the A. rubrum branches was wrapped in tin foil and stored at −80 °C in the refrigerator for subsequent experiments.

2.2. Bioinformatics Analysis of ArAux/IAA13 and ArAux/IAA16

The gene expression data of the ArAux/IAA gene family members were selected from the transcriptome data [23] (Zhu et al., 2022) analyzed earlier by our research group, and the data of CK and IBA300 were summed and averaged to construct a gene expression heatmap using TBtools (v1.108) software.

2.3. Gene Cloning

The A. rubrum phloem samples stored at −80 °C were subjected to total RNA extraction with The Polysaccharide Polyphenol RNA Rapid Extraction Kit (Abelson, Beijing, China). First, a clean blade was used to gently scrape off the phloem of the frozen A. rubrum branches, following which the total RNA in the phloem of the branches was extracted using the liquid nitrogen grinding method, and then electrophoresis was used to evaluate the extraction quality of the total RNA. Total RNA of good quality was extracted for cDNA first-strand synthesis using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beijing, China).
Primers for cloning were designed for ArAux/IAA13 and ArAux/IAA16 using Primer3Plus (https://www.primer3plus.com URL (accessed on 23 March 2021)) online software. Subsequently, gene cloning was performed through polymerase chain reaction (PCR) expansion.

2.4. Subcellular Localization

The online prediction software ProtComp 9.0 (http://linux1.softberry.com/berry.phtml URL (accessed on 21 October 2021)) was used for predicting the subcellular localization of ArAux/IAA13 and ArAuxIAA16.
The cloned ArAux/IAA13 and ArAux/IAA16 genes with full-length coding sequences (CDSs) were constructed into ArAux/IAA13-GFP and ArAux/IAA16-GFP recombinant vectors through Nimble Cloning (NC) reaction with the pNC-Cam1304-SubN [24] (Yan et al., 2020) vector (with GFP tag sequence). The successfully constructed ArAux/IAA13-GFP and ArAux/IAA16-GFP recombinant vectors were transformed into Agrobacterium rhizogenes GV3101. A single colony was incubated in YEB liquid medium (containing Rif and Kan antibiotics) until the optical density at 600 nm (OD600) was 0.6, and then the bacterial solution was configured as an infestation solution, then, it was co-transfected into tobacco leaf cells with nucleus marker. Low light culture for two days after infection. Subsequently, the protoplasts are extracted. Then, the green fluorescent protein (GFP) signal was observed with a fluorescent orthomosaic microscope (Nikon C2-ER, Shanghai, China) at an excitation wavelength of 488–580 nm. A negative control was also set up.

2.5. Bimolecular Fluorescence Complementation (BIFC) Assay

For bimolecular fluorescence complementation detection, the complete CDSs of the ArARF10 and ArARF18 genes were inserted into the pNC-BIFC-ENN [24] (Yan et al., 2020) vector (with NYFP tag sequence) to constitute the ArARF10-N-YFP recombinant vector and ArARF18-N-YFP recombinant vector. The complete CDSs of the ArAux/IAA13 and ArAux/IAA16 genes were inserted into the pNC-BIFC-ECN [24] (Yan et al., 2020) vector (with CYFP tag sequence) to constitute the ArAux/IAA13-C-YFP recombinant vector and ArAux/IAA16-C-YFP recombinant vector. The four constructed recombinant vectors were transformed into A. rhizogenes GV3101. The transformed Agrobacterium was cultured in liquid medium YEB (containing Rif and Kan antibiotics) until the OD600 was 1.0 and then configured into an infestation solution. The infestation solution was mixed 1:1 according to the test combination (Table 1) and dark-treated for 3 h before being injected into the leaves of Ben’s tobacco at 5–6 weeks of breeding age. After dark treatment for 24 h and incubation for three days, the yellow fluorescent protein (YFP) signal was observed in the lower epidermis of the tobacco leaves using a laser confocal microscope (Leica TCS SP5, Germany) (excitation wavelength of 514 nm). The test combinations with empty carriers were used as negative controls.

2.6. Transgenic Functional Validation

The T-DNA insertion patterns of the A. thaliana loss-of-function mutants aux/iaa13 and aux/iaa16 were purchased from the Chinese A. thaliana Mutant Sharing Center (AraShare, Fuzhou, China). The full CDSs length of the ArAux/IAA13 and ArAux/IAA16 genes was inserted into the pNC-Cam3304-MCS35S [24] (Yan et al., 2020) overexpression vector by NC reaction to constitute ArAux/IAA13-pCamiba3304 and ArAux/IAA16-pCamiba3304 recombinant vectors to obtain overexpressed ArAux/IAA13 and ArAux/IAA16 plants (OE-ArAux/IAA13 and OE-ArAux/IAA16). Then, we transformed the successfully constructed recombinant vector into A. rhizogenes GV3101. Ultimately, we used the inflorescence infestation method to infest the mutant A. thaliana aux/iaa13 and aux/iaa16 with the infestation solution. We identified positive seedlings when cultured to the T1 generation and collected the seeds. The successfully identified T1 generation seeds were cultured to the T2 generation, and seeds from the T2 generation were then collected. After the seeds were dried, they were stored in a refrigerator at 4 °C. A small amount of wild-type seeds, A. thaliana mutant seeds, and T2 generation seeds were placed in 1/2 Murashige and Skoog (MS) solid medium and vernalized at 4 °C for 3 days. After that, the seedlings were photoinduced at 19 °C for 5 h and then wrapped in three layers of tin foil in the dark at 19 °C for 4 days until the average length of the seedling hypocotyls reached 6 mm. All root organs of the seedlings were excised with a sterile blade on a sterile ultra-clean bench, leaving only the 6 –mm long hypocotyls. The treated seedlings were neatly placed in 1/2 MS solid vertical medium with clean forceps and cultivated at 23 °C for 16 h in light and 20 °C for 8 h in dark to induce ARs formation. Three biological replicates were performed for both the experimental and control groups, and the length and number of ARs were recorded. Finally, the obtained experimental results were measured for specific traits using ImageJ and statistically analyzed using GraphPad8 (paired t-test).
The relative expressions of ArAux/IAA13 and ArAux/IAA16 were verified in transgenic A. thaliana mutants through quantitative real-time PCR (qRT-PCR). Total RNA was extracted from the leaves of the transgenic A. thaliana mutant T3 generation and wild-type A. thaliana using the polysaccharide polyphenol RNA rapid extraction kit (Aibosun, Beijing, China). Total RNA was extracted for fluorescent quantitative cDNA first-strand synthesis using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beijing, China). Primers were designed using the online software Primer3Plus (https://www.primer3plus.com URL (accessed on 23 June 2022)) (Table 2). The enzyme used in this assay was 2× SYBR GREEN (Aiberson, Beijing, China). The qRT-PCR cycling steps were 95 °C for 2 min, followed by 95 °C for 15 s, 60 °C for 20 s, and then 72 °C for 20 s, for 45 total cycles. On average, each reaction was performed five times. The internal reference used in this assay was 18S rRNA [25] (Wang et al., 2015).

3. Results

3.1. Bioinformatics Analysis of ArAux/IAAs

Figure 1 shows that the expression trend of ArAux/IAAs was divided into two modules: up-regulated and down-regulated trends. The three significantly up-regulated gene IDs were: ArAux/IAA5 (CL3294.Contig2_All), ArAux/IAA14 (CL3861.Contig2_All), and ArAux/IAA6 (CL8667.Contig1_All); the three significantly down-regulated gene IDs were: ArAux/IAA13 (Unigene5767_All), ArAux/IAA16 (Unigene13407_All), and ArAux/IAA8 (Unigene3732_All). The results showed that the expressions of red-labeled ArAux/IAA13 (Unigene5767_All) and ArAux/IAA16 (Unigene13407_All) were significantly down-regulated after treatment.

3.2. Subcellular Localization

The online prediction software ProtComp 9.0 was used to predict the subcellular localization of ArAux/IAA13 and ArAuxIAA16. The results are shown in Figure 2 and Figure 3, which predict that ArAux/IAA13 and ArAux/IAA16 transcription factors may play their roles in the nucleus.
The subcellular localization results indicated that the GFP green fluorescence of the ArAux/IAA13-GFP and ArAux/IAA16-GFP fusion proteins was only detected in the nucleus of the cells (Figure 4). By contrast, the GFP fluorescent protein of the control was detected in the nucleus, cell membrane, and cytoplasm. Thus, ArAux/IAA13 and ArAux/IAA16 proteins are mainly localized in the nucleus of plant cells.

3.3. Interaction of ArAux/IAA13 and ArAux/IAA16 with ArARF10 and ArARF18

Figure 5, Figure 6, Figure 7 and Figure 8 show the results of YFP expression in tobacco leaves through BIFC assay. Both ArAux/IAA13 and ArAux/IAA16 were found to interact with ArARF10, and bright yellow fluorescence was only found in the nucleus. In addition, both ArAux/IAA13 and ArAux/IAA16 were found to interact with ArARF18 in the nucleus, but the yellow fluorescence was less than that with ArARF10. This suggests that ArARF10 and ArARF18 could interact with ArAux/IAA13 and ArAux/IAA16.

3.4. Overexpression of ArAux/IAA13 and ArAux/IAA16 in A. thaliana Mutants

To verify the role of ArAux/IAA13 and ArAux/IAA16 in the growth and development of ARs in plants, transgenic transfer was performed in A. thaliana mutants and root growth was then observed. Through transgenic functional verification, the ARs of Col-0, aux/iaa13, and OE-ArAux/IAA13 (Figure 9A), and Col-0, aux/iaa16, and OE-ArAux/IAA16 (Figure 10A) were examined after 10 days of cultivation. The results showed that there were obvious phenotypic differences in the length of the ARs of Col-0 and aux/iaa13 and aux/iaa16. The length of the ARs of aux/iaa13 and aux/iaa16 was significantly longer than that of Col-0 (Figure 9C and Figure 10C). The ARs of OE-ArAux/IAA13 and OE-ArAux/IAA16 were significantly shorter than aux/iaa13 and aux/iaa16 and were also shorter than Col-0 (Figure 9C and Figure 10C). The AR number and length of the mutants of both genes were overall higher than the Col-0 and overexpression plants during these 10 days, while those of the overexpression plants were overall lower than the mutants and Col-0. On day 6, the number of ARs of OE-ArAux/IAA13 differed the most from that of Col-0 and aux/iaa13 (Figure 9D).
To verify overexpression, qRT-PCR was performed. The qRT-PCR results indicated that the relative expression levels of ArAux/IAA13 and ArAux/IAA16 in the T3 transgenic plants were significantly higher than those of Col-0 (Figure 9E and Figure 10E). The expression level of OE-ArAux/IAA13 was about 90 times higher than that of Col-0 and this difference was significant. The expression level of OE-ArAux/IAA16 was about 450 times higher than that of Col-0 and this difference was also significant. Thus, the two genes were transferred into the A. thaliana mutant and successfully overexpressed.

4. Discussion

This paper studied the role of ArAux/IAA13 and ArAux/IAA16 in the key regulatory pathway of plant hormone signaling in A. rubrum and in the regulation of maple rooting. Over the past few years, the Aux/IAA family has been identified in many species, such as Eucalyptus robusta [26] (Yu et al., 2015), Cucumis sativus [27] (Gan et al., 2013), Zea mays [28] (Wang et al., 2010), G. max [29] (Singh et al., 2015), and P. persica [19] (Guan et al., 2019), indicating that this family plays a critical role in the plant hormone signaling pathway.
In this study, the clustering heatmap analysis of the ArAux/IAAs following IBA 300 mg/L treatment showed that the gene expression of the ArAux/IAAs of A. rubrum was divided into two modules of up-regulation and down-regulation, indicating that the ArAux/IAAs had multiple modes of regulation. This family exhibits similar gene expression patterns in most species. A total of 44 genes of the Aux/IAA family have been identified in Arachis hypogaea, of which 31 genes of this family were differentially expressed in A. hypogaea seeds, with the up-regulated expression of AhIAA-3A, AhIAA-16A, and AhIAA-15B and down-regulated expression of AhIAA-11A, AhIAA-5B, and AhIAA-14B [30] (Zhang et al., 2022). In Solanum lycopersicum, six genes (SlIAA11, SlIAA15, SlIAA16, SlIAA17, SlIAA19, and SlIAA23) were up-regulated, while three genes (SlIAA20, SlIAA21, and SlIAA22) were significantly down-regulated after exogenous auxin treatment [31] (Wu et al., 2012). This experiment also revealed that Aux/IAAs are sensitive to the auxin response factors and the key genes in plant root development [32] (Hochholdinger et al., 2018). In this paper, the expression of ArAux/IAA13 and ArAux/IAA16 showed significant down-regulation patterns and combined with the abovementioned research results, we speculated that they played negative regulatory roles in the rooting of A. rubrum. The proteins encoded by the Aux/IAA gene family are generally identified as negative regulators during rooting in most plants and act as inhibitors of rooting, which is consistent with our research. In A. thaliana, Aux/IAAs inhibited hypocotyl growth through photoreceptors [33] (Li et al., 2022), and three proteins, namely AtIAA6, AtIAA9, and AtIAA17, were found to have cumulative effects in inhibiting AR development [34] (Lakehal et al., 2019).
Most transcription factors are located in the nucleus and perform their functions there. Several studies have shown that Aux/IAA proteins are short-lived nuclear proteins, with ZmIAA2, ZmIAA11, and ZmIAA15 in Z. mays [35] (Ludwig et al., 2014) and PeIAA8 in Phyllostachys edulis [36] (Li et al., 2018) all localized in the nucleus. This is because Aux/IAA proteins that localize in the nucleus all contain nuclear localization signals that direct the proteins into the nucleus to perform their functions [37,38] (Abel et al., 1994; Wu et al., 2017). In this study, ArAux/IAA13 and ArAux/IAA16 were also confirmed to be localized in the nucleus to perform their functions through the subcellular localization assay.
Aux/IAAs and ARFs are two key transcription factors in the auxin regulatory pathway, and the auxin signaling model predicted that auxin was largely dependent on ARF-Aux/IAA interactions. The interaction between the two proteins is mediated by the protein–protein interaction domain (CTD) at the C-terminus of ARF and Aux/IAA proteins. In this study, we successfully verified that ArAux/IAA13 and ArAux/IAA16 interact with ArARF10 and ArARF18 through the BIFC assay, in which ArAux/IAA13 and ArAux/IAA16 significantly interacted with ArARF10. By analyzing the ArAux/IAA13 and ArAux/IAA16 protein modules, we found that they both contained motif 1 and motif 2 in two conserved domains: domain III and domain IV. Recent studies have indicated the existence of a high degree of compensation among Aux/IAA genes. In A. thaliana, one study [39] (Ori, 2019) produced loss-of-function double and triple mutants, which were not significantly different compared with Col-0. However, in S. lycopersicum [40] (Wang et al., 2005), missing an Aux/IAA family gene resulted in a distinct phenotype; however, dominant mutants in this gene family would have a more pronounced phenotype. This is similar to the case of the A. thaliana loss-of-function mutants used in this study that did not differ significantly from the wild type in AR occurrence. This phenomenon may be related to the species and the mode of mutation. The acquired mutant of the AtIAA16 gene in A. thaliana has now been shown to have an inhibitory effect on plant growth, while it can make plants less sensitive to auxin [41] (Rinaldi et al., 2012). In Vaccinium spp. [42] (Hou et al., 2020), it has been found that the overexpression of VcIAA27 in A. thaliana leads to leaf curling and plant dwarfism, while it is speculated to play a negative regulatory role in the auxin regulatory pathway. In C. papaya [43] (Estrella-Maldonado et al., 2022), the rooting rate increased significantly after exogenous hormone treatment, in which CpAux/IAA family expression was down-regulated, while CpARF family expression was up-regulated, indicating that the Aux/IAA gene family also had a negative regulatory role in the auxin signaling pathway in C. papaya. This is similar to the situation whereby the length of the ARs of the overexpression OE-ArAux/IAA13 and OE-ArAux/IAA16 in this paper was lower than that of the wild-type and mutant A. thaliana. Furthermore, the lengths of the ARs of the deletion-type mutants were much higher than those of the Col-0 and transgenic A. thaliana. In conclusion, this confirmed that the Aux/IAA family plays a negative role in auxin-regulated plant rooting.
Thus far, many studies have confirmed that the ARF family promotes root growth and development. In addition, our research group has successfully proved that ArARF10 [23] (Zhu et al., 2022) and ArARF18 in A. rubrum can promote the growth and development of plant ARs. In this study, we found that ArAux/IAA13 and ArAux/IAA16 can interact with ArARF10 and ArARF18, and we successfully verified that ArAux/IAA13 and ArAux/IAA16 have an inhibitory effect on plant AR growth. This indicates that ArAux/IAA13 and ArAux/IAA16 mainly inhibit the downstream gene transcription of ArARFs through interaction with ArARFs in the nucleus. This also indicates that they are involved in the regulatory role of key regulatory pathways of plant hormone signal transduction related to root growth and development. They regulate the growth and development of plant ARs by interacting with ArARFs.

5. Conclusions

ArAux/IAA13 and ArAux/IAA16 play an important role in the growth and development of ARs in A. rubrum. Heatmap analysis indicated that they were significantly down-regulated after 300 mg/mL IBA treatment. Subcellular localization confirmed that ArAux/IAA13 and ArAux/IAA16 were located in the nucleus. The bimolecular fluorescence complementary test showed that they could interact with ArARF10 and ArARF18, which further verified their regulatory mechanisms in the auxin regulation pathway. Furthermore, the functional verification of transgenes also confirmed that they played negative regulatory roles in AR growth and development. This research provides new avenues and data for the study of the rooting regulation of Acer.

Author Contributions

Conceptualization, W.G., K.Z. and H.Z. (Hewen Zhao); Formal Analysis, H.Z. (Huiyu Zhu), H.L. and J.Y.; Investagation, H.Z. (Huiyu Zhu) and H.L.; Writing—Original Draft Preparation, H.Z. (Huiyu Zhu); Writing—Review and Editing, Wei Ge; Funding Acquisition, W.G. and K.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This project was supported by The Project of Cultivation for young top-notch Talents of Beijing Municipal Institutions (grant No. BPHR202203100) and Beijing Innovation Consortium of Agriculture Research System (grant No. BAIC09-2022).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All relevant data are contained within the manuscript text, and any additional underlying data are available upon request.

Acknowledgments

The authors hope to express their appreciation to the reviewers for this manuscript. The Nimble Cloning vectors used in this paper was provided by Pu Yan, Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Guo, C.; Chen, Y.; Wang, Y.; Tan, F.; Ke, P.B.; Sha, W.F.; Li, Y.J. Sequence analysis of SSR in transcriptome of American red maple. J. Cent. South Univ. For. Technol. 2021, 41, 132–141. [Google Scholar]
  2. Zhang, Y.F. Study on the Adaptability of American Red Maple introduction and cultivation in the eastern Liaoning mountainous area. For. By-Prod. Spec. China 2022, 37, 41–42. [Google Scholar]
  3. Li, L. Current situation of fine varieties and breeding and cultivation techniques of American Red Maple. Heilongjiang Agric. Sci. 2018, 41, 158–160. [Google Scholar]
  4. Li, X. Efficient breeding and cultivation techniques of Acer rubrum L. in northern Anhui. Mod. Agric. Sci. Technol. 2019, 48, 145–146. [Google Scholar]
  5. Ma, S.J.; Peng, T.L.; Yu, Y.; Liu, Y.; Li, C.; Wang, J. Effect of plant hormones and magnetic field on rooting of soft cuttings for Catalpa bungei. J. Northeast. For. Univ. 2020, 48, 21–24. [Google Scholar]
  6. Hao, A.L.; Wang, C.; Feng, X.B. Effects of growth regulators on softwood-cutting rooting and oxidase activities during rooting of Acer davidii Franch. Acta Bot. Boreali-Occident. Sin. 2009, 29, 2026–2030. [Google Scholar]
  7. Yuan, L.L.; Zhang, L.; Wang, H.X.; Sun, F.; Yv, Y.C.; Niu, T.; Li, C.X.; Wang, C.X. Changes of endogenous homones during Acer truncatum bunge cutting. Chin. Agric. Sci. Bull. 2012, 28, 61–64. [Google Scholar]
  8. Zhang, J.Q.; Zhang, D.Y.; Liu, D.H. Effects of different exogenous hormone treatments on rootage rate of Acer Tetramerum. Bull. Soil Water Conserv. 2017, 37, 207–210. [Google Scholar]
  9. Ma, J.; Xu, T.D. Non-canonical auxin signaling pathway in plants. Biotechnol. Bull. 2020, 36, 15–22. [Google Scholar]
  10. Maitra Majee, S.; Sharma, E.; Singh, B.; Khurana, J.P. Drought-induced protein (Di19-3) plays a role in auxin signaling by interacting with IAA14 in Arabidopsis. Plant Direct 2020, 4, e00234. [Google Scholar] [CrossRef]
  11. Liu, H.B.; Li, L.; Li, C.; Huang, C.; ShangGuan, Y.; Chen, R.; Xiao, S.; Wen, W.; Xu, D. Identification and bioinformatic analysis of Aux/IAA family based on transcriptome data of Bletilla striata. Bioengineered 2019, 10, 668–678. [Google Scholar] [CrossRef] [PubMed]
  12. Leyser, O. Auxin signaling. Plant Physiol. 2018, 176, 465–479. [Google Scholar] [CrossRef] [PubMed]
  13. Zhu, W.P.; Zhang, M.Y.; Li, J.Y.; Zhao, H.W.; Ge, W.; Zhang, K.Z. Identification and analysis of Aux/IAA family in Acer rubrum. Evol. Bioinform. 2021, 17, 1–12. [Google Scholar] [CrossRef] [PubMed]
  14. Quintana-Escobar, A.O.; Nic-Can, G.I.; Galaz Avalos, R.M.; Loyola-Vargas, V.M.; Gongora-Castillo, E. Transcriptome analysis of the induction of somatic embryogenesis in Coffea canephora and the participation of ARF and Aux/IAA genes. PeerJ 2019, 7, e7752. [Google Scholar] [CrossRef] [PubMed]
  15. Luo, J.; Zhou, J.J.; Zhang, J.Z. Aux/IAA gene family in plants: Molecular structure, regulation, and function. Int. J. Mol. Sci. 2018, 19, 259. [Google Scholar] [CrossRef]
  16. Liu, K.; Yuan, C.; Feng, S.; Zhong, S.; Li, H.; Zhong, J.; Shen, C.; Liu, J. Genome-wide analysis and characterization of Aux/IAA family genes related to fruit ripening in papaya (Carica papaya L.). BMC Genom. 2017, 18, 351. [Google Scholar] [CrossRef]
  17. Paul, P.; Dhandapani, V.; Rameneni, J.J.; Li, X.; Sivanandhan, G.; Choi, S.R.; Pang, W.; Im, S.; Lim, Y.P. Genome-wide analysis and characterization of Aux/IAA family genes in Brassica rapa. PLoS ONE 2016, 11, e0151522. [Google Scholar]
  18. Ali, S.; Wang, W.; Zhang, Z.; Xie, L.; Boer, D.R.; Khan, N. Genome-Wide Identification, Expression and Interaction Analysis of ARF and AUX/IAA Gene Family in Soybean. Front. Biosci. Landmark 2022, 27, 251. [Google Scholar] [CrossRef]
  19. Guan, D.; Hu, X.; Diao, D.; Wang, F.; Liu, Y.P. Genome-wide analysis and identification of the Aux/IAA gene family in peach. Int. J. Mol. Sci. 2019, 20, 4703. [Google Scholar] [CrossRef]
  20. Xie, Y.; Ying, J.; Tang, M.; Wang, Y.; Xu, L.; Liu, M.; Liu, L. Genome-wide identification of AUX/IAA in radish and functional characterization of RsIAA33 gene during taproot thickening. Gene 2021, 795, 145782. [Google Scholar] [CrossRef]
  21. Yamauchi, T.; Tanaka, A.; Inahashi, H.; Nishizawa, N.K.; Tsutsumi, N.; Inukai, Y.; Nakazono, M. Fine control of aerenchyma and lateral root development through AUX/IAA- and ARF-dependent auxin signaling. Proc. Natl. Acad. Sci. USA 2019, 116, 20770–20775. [Google Scholar] [CrossRef] [PubMed]
  22. Aslam, M.; Sugita, K.; Qin, Y.; Rahman, A. Aux/IAA14 regulates microRNA-mediated cold stress response in Arabidopsis roots. Int. J. Mol. Sci. 2020, 21, 8441. [Google Scholar] [CrossRef] [PubMed]
  23. Zhu, W.P.; Zhang, M.Y.; Li, J.Y.; Zhao, H.W.; Zhang, K.Z.; Ge, W. Key regulatory pathways, microRNAs, and target genes participate in adventitious root formation of Acer rubrum l. Sci. Rep. 2022, 12, 12057. [Google Scholar] [CrossRef] [PubMed]
  24. Yan, P.; Zeng, Y.; Shen, W.; Tuo, D.; Li, X.; Zhou, P. Nimble Cloning: A Simple, Versatile, and Efficient System for Standardized Molecular Cloning. Front. Bioeng Biotechnol. 2020, 7, 460. [Google Scholar] [CrossRef]
  25. Wang, X.; Fu, Y.; Ban, L.; Wang, Z.; Feng, G.; Li, J.; Gao, H. Selection of reliable reference genes for quantitative real-time RT-PCR in alfalfa. Genes Genet. Syst. 2015, 90, 175–180. [Google Scholar] [CrossRef]
  26. Yu, H.; Soler, M.; San Clemente, H.; Mila, I.; Paiva, J.A.; Myburg, A.A.; Bouzayen, M.; Grima-Pettenati, J.; Cassan-Wang, H. Comprehensive genome-wide analysis of the Aux/IAA gene family in Eucalyptus: Evidence for the role of EgrIAA4 in wood formation. Plant Cell Physiol. 2015, 56, 700–714. [Google Scholar] [CrossRef]
  27. Gan, D.; Zhuang, D.; Ding, F.; Yu, Z.; Zhao, Y. Identification and expression analysis of primary auxin-responsive Aux/IAA gene family in cucumber (Cucumis sativus). J. Genet. 2013, 92, 513–521. [Google Scholar] [CrossRef]
  28. Wang, Y.; Deng, D.; Bian, Y.; Lv, Y.; Xie, Q. Genome-wide analysis of primary auxin-responsive Aux/IAA gene family in maize (Zea mays. L.). Mol. Biol. Rep. 2010, 37, 3991–4001. [Google Scholar] [CrossRef]
  29. Singh, V.K.; Jain, M. Genome-wide survey and comprehensive expression profiling of Aux/IAA gene family in chickpea and soybean. Front. Plant Sci. 2015, 6, 918. [Google Scholar] [CrossRef]
  30. Zhang, X.; Zhang, K.; Luo, L.; Lv, Y.Y.; Li, Y.Y.; Zhu, S.Q.; Luo, B.; Wan, Y.S.; Zhang, X.S.; Liu, F.Z. Identification of peanut Aux/IAA genes and functional prediction during seed development and maturation. Plants 2022, 11, 472. [Google Scholar] [CrossRef]
  31. Wu, J.; Peng, Z.; Liu, S.Y.; He, Y.; Cheng, L.; Kong, F.; Wang, J.; Lu, G. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model. Mol. Genet. Genom. 2012, 287, 295–311. [Google Scholar] [CrossRef]
  32. Hochholdinger, F.; Yu, P.; Marcon, C. Genetic control of root system development in maize. Trends Plant Sci. 2018, 23, 79–88. [Google Scholar] [CrossRef] [PubMed]
  33. Li, Q.Q.; Zhang, Z.; Zhang, C.X.; Wang, Y.L.; Liu, C.B.; Wu, J.C.; Han, M.L.; Wang, Q.X.; Chao, D.Y. Phytochrome-interacting factors orchestrate hypocotyl adventitious root initiation in Arabidopsis. Development 2022, 149, dev200362. [Google Scholar] [CrossRef] [PubMed]
  34. Lakehal, A.; Chaabouni, S.; Cavel, E.; Le Hir, R.; Ranjan, A.; Raneshan, Z.; Novak, O.; Pacurar, D.I.; Perrone, I.; Jobert, F.; et al. A molecular framework for the control of adventitious rooting by TIR1/AFB2-Aux/IAA-dependent auxin signaling in Arabidopsis. Mol. Plant 2019, 12, 1499–1514. [Google Scholar] [CrossRef]
  35. Ludwig, Y.; Berendzen, K.W.; Xu, C.; Piepho, H.P.; Hochholdinger, F. Diversity of stability, localization, interaction and control of downstream gene activity in the maize Aux/IAA protein family. PLoS ONE 2014, 9, e107346. [Google Scholar] [CrossRef] [PubMed]
  36. Li, F.; Wu, M.; Liu, H.; Gao, Y.; Xiang, Y. Systematic identification and expression pattern analysis of the Aux/IAA and ARF gene families in moso bamboo (Phyllostachys edulis). Plant Physiol. Biochem. 2018, 130, 431–444. [Google Scholar] [CrossRef]
  37. Abel, S.; Oeller, P.W.; Theologis, A. Early auxin-induced genes encode short-lived nuclear proteins. Proc. Natl. Acad. Sci. USA 1994, 91, 326–330. [Google Scholar] [CrossRef]
  38. Wu, W.; Liu, Y.X.; Wang, Y.Q.; Li, H.M.; Liu, J.X.; Tan, J.X.; He, J.D.; Bai, J.W.; Ma, H.L. Evolution analysis of the Aux/IAA gene family in plants shows dual origins and variable nuclear localization signals. Int. J. Mol. Sci. 2017, 18, 2107. [Google Scholar] [CrossRef]
  39. Ori, N. Dissecting the biological functions of ARF and Aux/IAA genes. Plant Cell 2019, 31, 1210–1211. [Google Scholar] [CrossRef]
  40. Wang, H.; Jones, B.; Li, Z.; Frasse, P.; Delalande, C.; Regad, F.; Chaabouni, S.; Latche, A.; Pech, J.C.; Bouzayen, M. The tomato Aux/IAA transcription factor IAA9 is involved in fruit development and leaf morphogenesis. Plant Cell 2005, 17, 2676–2692. [Google Scholar] [CrossRef]
  41. Rinaldi, M.A.; Liu, J.; Enders, T.A.; Bartel, B.; Strader, L.C. A gain-of-function mutation in IAA16 confers reduced responses to auxin and abscisic acid and impedes plant growth and fertility. Plant Mol. Biol. 2012, 79, 359–373. [Google Scholar] [CrossRef] [PubMed]
  42. Hou, Y.M.; Li, H.X.; Zhai, L.L.; Xie, X.; Li, X.Y.; Bian, S.M. Identification and functional characterization of the Aux/IAA gene VcIAA27 in blueberry. Plant Signal. Behav. 2020, 15, 1700327. [Google Scholar] [CrossRef] [PubMed]
  43. Estrella-Maldonado, H.; Chan-Leon, A.; Fuentes, G.; Giron-Ramirez, A.; Desjardins, Y.; Santamaria, J.M. The interaction between exogenous IBA with sucrose, light and ventilation alters the expression of ARFs and Aux/IAA genes in Carica papaya plantlets. Plant Mol. Biol. 2022, 110, 107–130. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Heatmap clustering analysis of ArAux/IAAs. Bars represent scaled gene expression levels log10 (FPKM+1).
Figure 1. Heatmap clustering analysis of ArAux/IAAs. Bars represent scaled gene expression levels log10 (FPKM+1).
Genes 14 01206 g001
Figure 2. Predicted results of subcellular localization of ArAux/IAA13.
Figure 2. Predicted results of subcellular localization of ArAux/IAA13.
Genes 14 01206 g002
Figure 3. Predicted results of subcellular localization of ArAux/IAA16.
Figure 3. Predicted results of subcellular localization of ArAux/IAA16.
Genes 14 01206 g003
Figure 4. Subcellular localization of ArAux/IAA13 and ArAux/IAA16. (AC) show the green fluorescence field, (DF) show the nuclear marker field. (GI) show the bright field, and (JL) show the merged field. Scale bar, 10 μm.
Figure 4. Subcellular localization of ArAux/IAA13 and ArAux/IAA16. (AC) show the green fluorescence field, (DF) show the nuclear marker field. (GI) show the bright field, and (JL) show the merged field. Scale bar, 10 μm.
Genes 14 01206 g004
Figure 5. Bimolecular fluorescence complementary assay between ArARF10 and ArAux/IAA13. (AD) show the yellow fluorescence field, (EH) show the bright field, and (IL) show the merged field. Scale bar, 50 μm.
Figure 5. Bimolecular fluorescence complementary assay between ArARF10 and ArAux/IAA13. (AD) show the yellow fluorescence field, (EH) show the bright field, and (IL) show the merged field. Scale bar, 50 μm.
Genes 14 01206 g005
Figure 6. Bimolecular fluorescence complementary assay between ArARF10 and ArAux/IAA16 proteins. (AD) show the yellow fluorescence field, (EH) show the bright field, and (IL) show the merged field. Scale bar, 50 μm.
Figure 6. Bimolecular fluorescence complementary assay between ArARF10 and ArAux/IAA16 proteins. (AD) show the yellow fluorescence field, (EH) show the bright field, and (IL) show the merged field. Scale bar, 50 μm.
Genes 14 01206 g006
Figure 7. Bimolecular fluorescence complementary assay between ArARF18 and ArAux/IAA13 proteins. (AD) show the yellow fluorescence field, (EH) show the bright field, and (IL) show the merged field. Scale bar, 50 μm.
Figure 7. Bimolecular fluorescence complementary assay between ArARF18 and ArAux/IAA13 proteins. (AD) show the yellow fluorescence field, (EH) show the bright field, and (IL) show the merged field. Scale bar, 50 μm.
Genes 14 01206 g007
Figure 8. Bimolecular fluorescence complementary assay between ArARF18 and ArAux/IAA16 proteins. (AD) show the yellow fluorescence field, (EH) show the bright field, and (IL) show the merged field. Scale bar, 50 μm.
Figure 8. Bimolecular fluorescence complementary assay between ArARF18 and ArAux/IAA16 proteins. (AD) show the yellow fluorescence field, (EH) show the bright field, and (IL) show the merged field. Scale bar, 50 μm.
Genes 14 01206 g008
Figure 9. Transgenic functional validation phenotype of ArAux/IAA13. (A) shows the T3 phenotypic observation graph. (B) shows the line graph of the length/cm of ARs in 10 days. (C) shows the bar chart of the length/cm of ARs on the 10th day. (D) shows the line graph of the number of ARs in 10 days. (E) shows the real-time fluorescence PCR expression of ArAux/IAA13 in Col-0 and OE-ArAux/IAA13. Scale bar, 1 cm. * p < 0.05, ** p < 0.01, *** p < 0.001, n = 9.
Figure 9. Transgenic functional validation phenotype of ArAux/IAA13. (A) shows the T3 phenotypic observation graph. (B) shows the line graph of the length/cm of ARs in 10 days. (C) shows the bar chart of the length/cm of ARs on the 10th day. (D) shows the line graph of the number of ARs in 10 days. (E) shows the real-time fluorescence PCR expression of ArAux/IAA13 in Col-0 and OE-ArAux/IAA13. Scale bar, 1 cm. * p < 0.05, ** p < 0.01, *** p < 0.001, n = 9.
Genes 14 01206 g009
Figure 10. Transgenic functional validation phenotype of ArAux/IAA16. (A) shows the T3 phenotypic observation graph. (B) shows the line graph of the length/cm of ARs in 10 days. (C) shows the bar chart of the length/cm of ARs on the 10th day. (D) shows the line graph of the number of ARs in 10 days. (E) shows the real-time fluorescence PCR expression of ArAux/IAA16 in Col-0 and OE-ArAux/IAA16. Scale bar, 1 cm. ** p < 0.01, **** p < 0.0001, n = 9.
Figure 10. Transgenic functional validation phenotype of ArAux/IAA16. (A) shows the T3 phenotypic observation graph. (B) shows the line graph of the length/cm of ARs in 10 days. (C) shows the bar chart of the length/cm of ARs on the 10th day. (D) shows the line graph of the number of ARs in 10 days. (E) shows the real-time fluorescence PCR expression of ArAux/IAA16 in Col-0 and OE-ArAux/IAA16. Scale bar, 1 cm. ** p < 0.01, **** p < 0.0001, n = 9.
Genes 14 01206 g010
Table 1. Bimolecular fluorescence combination of ArARF10, ArARF18, ArAux/IAA13, and ArAux/IAA16. 1–5 are the negative controls, and 6–9 are the test groups.
Table 1. Bimolecular fluorescence combination of ArARF10, ArARF18, ArAux/IAA13, and ArAux/IAA16. 1–5 are the negative controls, and 6–9 are the test groups.
Serial NumberENN-Linked GenesECN-Linked Genes
1NoneArAux/IAA13
2NoneArAux/IAA16
3ArARF10None
4ArARF18None
5NoneNone
6ArARF10ArAux/IAA13
7ArARF18ArAux/IAA13
8ArARF10ArAux/IAA16
9ArARF18ArAux/IAA16
Table 2. Primers used in qRT-PCR.
Table 2. Primers used in qRT-PCR.
Primer NamesPrimer Sequences
18S-FCCTGAGAAACGGCTACCACAT
18S-RCACCAGACTTGCCCTCCA
ArAux/IAA13-FGAAAGTCCAGACGAATGAGAGC
ArAux/IAA13-RTCCAACGTCATGGCAAGATC
ArAux/IAA16-FAACAAGAAGAAAGGAGGCACAG
ArAux/IAA16-RCCAGAGAAAACCCACTTGCTAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhu, H.; Li, H.; Yu, J.; Zhao, H.; Zhang, K.; Ge, W. Regulatory Mechanisms of ArAux/IAA13 and ArAux/IAA16 in the Rooting Process of Acer rubrum. Genes 2023, 14, 1206. https://doi.org/10.3390/genes14061206

AMA Style

Zhu H, Li H, Yu J, Zhao H, Zhang K, Ge W. Regulatory Mechanisms of ArAux/IAA13 and ArAux/IAA16 in the Rooting Process of Acer rubrum. Genes. 2023; 14(6):1206. https://doi.org/10.3390/genes14061206

Chicago/Turabian Style

Zhu, Huiyu, Huiju Li, Jiayu Yu, Hewen Zhao, Kezhong Zhang, and Wei Ge. 2023. "Regulatory Mechanisms of ArAux/IAA13 and ArAux/IAA16 in the Rooting Process of Acer rubrum" Genes 14, no. 6: 1206. https://doi.org/10.3390/genes14061206

APA Style

Zhu, H., Li, H., Yu, J., Zhao, H., Zhang, K., & Ge, W. (2023). Regulatory Mechanisms of ArAux/IAA13 and ArAux/IAA16 in the Rooting Process of Acer rubrum. Genes, 14(6), 1206. https://doi.org/10.3390/genes14061206

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop