The Mouse CircGHR Regulates Proliferation, Differentiation and Apoptosis of Hepatocytes and Myoblasts
Abstract
:1. Introduction
2. Materials and Methods
2.1. The Open Reading Frame (ORF) of Mouse circGHR
2.2. RNA Extraction and Complementary DNA (cDNA) Synthesis
2.3. Vector Construction
2.4. Cell Culture and Treatment
2.5. Quantitative Real-Time PCR (qRT-PCR)
2.6. Cell Counting Kit 8 (CCK-8) and EdU Assay
2.7. Western Blot Assay
2.8. Flow Cytometric Cell Apoptosis Analysis
2.9. Immunofluorescence Assay
2.10. Statistical Analysis
3. Results
3.1. Mouse circGHR Encodes Novel Polypeptide circGHR-295aa
3.2. CircGHR Inhibits the Proliferation of Mouse NTCT1469
3.3. CircGHR Tends to Inhibit NCTC1469 Apoptosis
3.4. CircGHR Has No Effects on the Proliferation of C2C12
3.5. CircGHR Promotes C2C12 Differentiation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sanger, H.L.; Klotz, G.; Riesner, D.; Gross, H.J.; Kleinschmidt, A.K. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc. Natl. Acad. Sci. USA 1976, 73, 3852–3856. [Google Scholar] [CrossRef] [PubMed]
- Rybak-Wolf, A.; Stottmeister, C.; Glazar, P.; Jens, M.; Pino, N.; Giusti, S.; Hanan, M.; Behm, M.; Bartok, O.; Ashwal-Fluss, R.; et al. Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed. Mol. Cell 2015, 58, 870–885. [Google Scholar] [CrossRef] [PubMed]
- Legnini, I.; Di Timoteo, G.; Rossi, F.; Morlando, M.; Briganti, F.; Sthandier, O.; Fatica, A.; Santini, T.; Andronache, A.; Wade, M.; et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Mol. Cell 2017, 66, 22–37. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, H.; Zuo, Y.; Wang, J.; Zhang, M.Q.; Malhotra, A.; Mayeda, A. Characterization of RNase R-digested cellular RNA source that consists of lariat and circular RNAs from pre-mRNA splicing. Nucleic Acids Res. 2006, 34, e63. [Google Scholar] [CrossRef]
- Suzuki, H.; Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. Int. J. Mol. Sci. 2014, 15, 9331–9342. [Google Scholar] [CrossRef]
- Yang, L.; Wilusz, J.E.; Chen, L.L. Biogenesis and Regulatory Roles of Circular RNAs. Annu. Rev. Cell Dev. Biol. 2022, 38, 263–289. [Google Scholar] [CrossRef]
- Wen, S.Y.; Qadir, J.; Yang, B.B. Circular RNA translation: Novel protein isoforms and clinical significance. Trends Mol. Med. 2022, 28, 405–420. [Google Scholar] [CrossRef]
- Zhang, W.L.; Leng, Q.Y.; Zheng, J.H.; Hassan, N.A.; Jiao, Z.H.; Wang, F.J.; Zhang, L. Cloning and expression of circular transcript of mouse growth hormone receptor gene. Hereditas 2021, 43, 890–900. [Google Scholar] [CrossRef]
- Capel, B.; Swain, A.; Nicolis, S.; Hacker, A.; Walter, M.; Koopman, P.; Goodfellow, P.; Lovell-Badge, R. Circular transcripts of the testis-determining gene Sry in adult mouse testis. Cell 1993, 73, 1019–1030. [Google Scholar] [CrossRef]
- Abdelmohsen, K.; Panda, A.C.; De, S.; Grammatikakis, I.; Kim, J.; Ding, J.; Noh, J.H.; Kim, K.M.; Mattison, J.A.; de Cabo, R.; et al. Circular RNAs in monkey muscle: Age-dependent changes. Aging 2015, 7, 903–910. [Google Scholar] [CrossRef]
- Veno, M.T.; Hansen, T.B.; Veno, S.T.; Clausen, B.H.; Grebing, M.; Finsen, B.; Holm, I.E.; Kjems, J. Spatio-temporal regulation of circular RNA expression during porcine embryonic brain development. Genome Biol. 2015, 16, 245. [Google Scholar] [CrossRef]
- Yuan, X.; Diao, J.; Du, A.; Wen, S.; Zhou, L.; Pan, Y. Circular RNA expression profiles and features in NAFLD mice: A study using RNA-seq data. J. Transl. Med. 2020, 18, 476. [Google Scholar] [CrossRef]
- Meng, H.; Wang, L.; You, H.; Huang, C.; Li, J. Circular RNA expression profile of liver tissues in an EtOH-induced mouse model of alcoholic hepatitis. Eur. J. Pharmacol. 2019, 862, 172642. [Google Scholar] [CrossRef]
- Gao, M.; Li, X.; Yang, Z.; Zhao, S.; Ling, X.; Li, J.; Xing, K.; Qi, X.; Wang, X.; Xiao, L.; et al. circHIPK3 regulates proliferation and differentiation of myoblast through the miR-7/TCF12 pathway. J. Cell. Physiol. 2021, 236, 6793–6805. [Google Scholar] [CrossRef]
- Liu, J.; Li, M.; Kong, L.; Cao, M.; Zhang, M.; Wang, Y.; Song, C.; Fang, X.; Chen, H.; Zhang, C. CircARID1A regulates mouse skeletal muscle regeneration by functioning as a sponge of miR-6368. Faseb J. 2021, 35, e21324. [Google Scholar] [CrossRef]
- Tanaka, M.; Miyazaki, T.; Yamamoto, I.; Nakai, N.; Ohta, Y.; Tsushima, N.; Wakita, M.; Shimada, K. Molecular characterization of chicken growth hormone secretagogue receptor gene. Gen. Comp. Endocrinol. 2003, 134, 198–202. [Google Scholar] [CrossRef]
- Zhao, J.; Taverne, M.A.; van der Weijden, G.C.; Bevers, M.M.; van den Hurk, R. Immunohistochemical localisation of growth hormone (GH), GH receptor (GHR), insulin-like growth factor I (IGF-I) and type I IGF-I receptor, and gene expression of GH and GHR in rat pre-antral follicles. Zygote 2002, 10, 85–94. [Google Scholar] [CrossRef]
- Janeczko, R.A.; Etlinger, J.D. Inhibition of intracellular proteolysis in muscle cultures by multiplication-stimulating activity. Comparison of effects of multiplication-stimulating activity and insulin on proteolysis, protein synthesis, amino acid uptake, and sugar transport. J. Biol. Chem. 1984, 259, 6292–6297. [Google Scholar] [CrossRef]
- Schmid, C.; Steiner, T.; Froesch, E.R. Preferential enhancement of myoblast differentiation by insulin-like growth factors (IGF I and IGF II) in primary cultures of chicken embryonic cells. FEBS Lett. 1983, 161, 117–121. [Google Scholar] [CrossRef]
- Ingolia, N.T.; Ghaemmaghami, S.; Newman, J.R.; Weissman, J.S. Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 2009, 324, 218–223. [Google Scholar] [CrossRef]
- Melmed, S. Acromegaly pathogenesis and treatment. J. Clin. Investig. 2009, 119, 3189–3202. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Leng, Q.; Zheng, J.; Adu-Asiamah, P.; Lin, S.; Li, T.; Wang, Z.; An, L.; Zhao, Z.; Zhang, L. Effects of Circular RNA of Chicken Growth Hormone Receptor Gene on Cell Proliferation. Front. Genet. 2021, 12, 598575. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.; Shen, X.; Zhao, J.; Cao, X.; He, H.; Han, S.; Chen, Y.; Cui, C.; Wei, Y.; Wang, Y.; et al. Circular RNA CircFAM188B Encodes a Protein That Regulates Proliferation and Differentiation of Chicken Skeletal Muscle Satellite Cells. Front. Cell Dev. Biol. 2020, 8, 522588. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Pamudurti, N.R.; Bartok, O.; Jens, M.; Ashwal-Fluss, R.; Stottmeister, C.; Ruhe, L.; Hanan, M.; Wyler, E.; Perez-Hernandez, D.; Ramberger, E.; et al. Translation of CircRNAs. Mol. Cell 2017, 66, 9–21. [Google Scholar] [CrossRef]
- Shi, Y.; Jia, X.; Xu, J. The new function of circRNA: Translation. Clin. Transl. Oncol. 2020, 22, 2162–2169. [Google Scholar] [CrossRef]
- Chen, R.X.; Chen, X.; Xia, L.P.; Zhang, J.X.; Pan, Z.Z.; Ma, X.D.; Han, K.; Chen, J.W.; Judde, J.G.; Deas, O.; et al. N(6)-methyladenosine modification of circNSUN2 facilitates cytoplasmic export and stabilizes HMGA2 to promote colorectal liver metastasis. Nat. Commun. 2019, 10, 4695. [Google Scholar] [CrossRef]
- He, R.Z.; Jiang, J.; Luo, D.X. M6A modification of circNSUN2 promotes colorectal liver metastasis. Genes Dis. 2021, 8, 6–7. [Google Scholar] [CrossRef]
- Ingolia, N.T.; Lareau, L.F.; Weissman, J.S. Ribosome profiling of mouse embryonic stem cells reveals the complexity and dynamics of mammalian proteomes. Cell 2011, 147, 789–802. [Google Scholar] [CrossRef]
- Xia, X.; Li, X.; Li, F.; Wu, X.; Zhang, M.; Zhou, H.; Huang, N.; Yang, X.; Xiao, F.; Liu, D.; et al. A novel tumor suppressor protein encoded by circular AKT3 RNA inhibits glioblastoma tumorigenicity by competing with active phosphoinositide-dependent Kinase-1. Mol. Cancer 2019, 18, 131. [Google Scholar] [CrossRef]
- Zheng, X.; Chen, L.; Zhou, Y.; Wang, Q.; Zheng, Z.; Xu, B.; Wu, C.; Zhou, Q.; Hu, W.; Wu, C.; et al. A novel protein encoded by a circular RNA circPPP1R12A promotes tumor pathogenesis and metastasis of colon cancer via Hippo-YAP signaling. Mol. Cancer 2019, 18, 47. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Liu, Y.; Li, P.; Zhu, D. RE: Novel Role of FBXW7 Circular RNA in Repressing Glioma Tumorigenesis. J. Natl. Cancer Inst. 2019, 111, 435. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.K.; Cheng, R.; Demeter, J.; Chen, J.; Weingarten-Gabbay, S.; Jiang, L.; Snyder, M.P.; Weissman, J.S.; Segal, E.; Jackson, P.K.; et al. Structured elements drive extensive circular RNA translation. Mol. Cell 2021, 81, 4300–4318. [Google Scholar] [CrossRef]
- Perriman, R.; Ares, M.J. Circular mRNA can direct translation of extremely long repeating-sequence proteins in vivo. RNA 1998, 4, 1047–1054. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Fan, X.; Mao, M.; Song, X.; Wu, P.; Zhang, Y.; Jin, Y.; Yang, Y.; Chen, L.L.; Wang, Y.; et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Res. 2017, 27, 626–641. [Google Scholar] [CrossRef]
- Guo, X.Y.; Chen, J.N.; Sun, F.; Wang, Y.Q.; Pan, Q.; Fan, J.G. circRNA_0046367 Prevents Hepatoxicity of Lipid Peroxidation: An Inhibitory Role against Hepatic Steatosis. Oxid. Med. Cell. Longev. 2017, 2017, 3960197. [Google Scholar] [CrossRef]
- Zhu, L.; Ren, T.; Zhu, Z.; Cheng, M.; Mou, Q.; Mu, M.; Liu, Y.; Yao, Y.; Cheng, Y.; Zhang, B.; et al. Thymosin-beta4 Mediates Hepatic Stellate Cell Activation by Interfering with CircRNA-0067835/miR-155/FoxO3 Signaling Pathway. Cell. Physiol. Biochem. 2018, 51, 1389–1398. [Google Scholar] [CrossRef]
- Zhou, T.C.; Li, X.; Chen, L.J.; Fan, J.H.; Lai, X.; Tang, Y.; Zhang, L.; Wei, J. Differential expression profile of hepatic circular RNAs in chronic hepatitis B. J. Viral Hepat. 2018, 25, 1341–1351. [Google Scholar] [CrossRef]
- Liu, Z.; Yu, Y.; Huang, Z.; Kong, Y.; Hu, X.; Xiao, W.; Quan, J.; Fan, X. CircRNA-5692 inhibits the progression of hepatocellular carcinoma by sponging miR-328-5p to enhance DAB2IP expression. Cell Death Dis. 2019, 10, 900. [Google Scholar] [CrossRef]
- Jiang, P.; Han, W.; Fu, Y.; Chen, Q. The Hsa_circ_0091579/miR-940/TACR1 Axis Regulates the Development of Hepatocellular Carcinoma. Cancer Manag. Res. 2020, 12, 9087–9096. [Google Scholar] [CrossRef]
- Hong, L.; Gu, T.; He, Y.; Zhou, C.; Hu, Q.; Wang, X.; Zheng, E.; Huang, S.; Xu, Z.; Yang, J.; et al. Genome-Wide Analysis of Circular RNAs Mediated ceRNA Regulation in Porcine Embryonic Muscle Development. Front. Cell Dev. Biol. 2019, 7, 289. [Google Scholar] [CrossRef]
- Wei, X.; Li, H.; Yang, J.; Hao, D.; Dong, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Lin, F.; et al. Circular RNA profiling reveals an abundant circLMO7 that regulates myoblasts differentiation and survival by sponging miR-378a-3p. Cell Death Dis. 2017, 8, e3153. [Google Scholar] [CrossRef]
- Ouyang, H.; Chen, X.; Li, W.; Li, Z.; Nie, Q.; Zhang, X. Circular RNA circSVIL Promotes Myoblast Proliferation and Differentiation by Sponging miR-203 in Chicken. Front. Genet. 2018, 9, 172. [Google Scholar] [CrossRef]
- Li, H.; Wei, X.; Yang, J.; Dong, D.; Hao, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Ma, Y.; et al. circFGFR4 Promotes Differentiation of Myoblasts via Binding miR-107 to Relieve Its Inhibition of Wnt3a. Mol. Ther. Nucleic Acids 2018, 11, 272–283. [Google Scholar] [CrossRef]
- Li, H.; Yang, J.; Wei, X.; Song, C.; Dong, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Ma, Y.; et al. CircFUT10 reduces proliferation and facilitates differentiation of myoblasts by sponging miR-133a. J. Cell. Physiol. 2018, 233, 4643–4651. [Google Scholar] [CrossRef]
- Li, L.; Chen, Y.; Nie, L.; Ding, X.; Zhang, X.; Zhao, W.; Xu, X.; Kyei, B.; Dai, D.; Zhan, S.; et al. MyoD-induced circular RNA CDR1as promotes myogenic differentiation of skeletal muscle satellite cells. Biochim. Biophys. Acta Gene Regul. Mech. 2019, 1862, 807–821. [Google Scholar] [CrossRef]
- Pandey, P.R.; Yang, J.H.; Tsitsipatis, D.; Panda, A.C.; Noh, J.H.; Kim, K.M.; Munk, R.; Nicholson, T.; Hanniford, D.; Argibay, D.; et al. circSamd4 represses myogenic transcriptional activity of PUR proteins. Nucleic Acids Res. 2020, 48, 3789–3805. [Google Scholar] [CrossRef]
- Millay, D.P.; Gamage, D.G.; Quinn, M.E.; Min, Y.L.; Mitani, Y.; Bassel-Duby, R.; Olson, E.N. Structure-function analysis of myomaker domains required for myoblast fusion. Proc. Natl. Acad. Sci. USA 2016, 113, 2116–2121. [Google Scholar] [CrossRef]
- Abmayr, S.M.; Pavlath, G.K. Myoblast fusion: Lessons from flies and mice. Development 2012, 139, 641–656. [Google Scholar] [CrossRef]
Genes | Primer Sequence (5′ to 3′) | Annealing Temp (°C) | Product Length (bp) |
---|---|---|---|
circGHR-full | F: GTCTCAGGTATGGATCTTTGTCAGG R: CTTCTTCACATGCTTCCAATATGTTC | 57 | 820 |
circGHR-DL | F: GGGATTCGTGGAGACATCCAA R: GACTGCCAGTGCCAAGGTTA | 59 | 343 |
circGHR-Flag-DL | F: AACCTGATCCACCCATTGGC R: ATCTCACCCGCACTTCATGT | 58 | 252 |
PCNA | F: ACCTCACCAGCATGTCCAAAA R: GGATTCCAAGTTGCTCCACATC | 60 | 174 |
CCND1 | F: AAAATGCCAGAGGCGGATGA R: GAAAGTGCGTTGTGCGGTAG | 60 | 199 |
CDK2 | F: GCCATTCTCACCGTGTCCTT R: GGACTCCAAAGGCTCTTGCT | 60 | 111 |
BAX | F: TGAAGACAGGGGCCTTTTTG R: AATTCGCCGGAGACACTCG | 58 | 140 |
Fas | F: GAAAGTCCAGCTGCTCCTGT R: ACACCAGGAGTTGCCAATGT | 59 | 290 |
MyoG | F: GGCTGTCCTGATGTCCAGAAA R: CCAGAGGCTTTGGAACCGGATA | 58 | 396 |
MyHC | F: CAAGTCATCGGTGTTTGTGG R: TGTCGTACTTGGGCGGGTTC | 58 | 158 |
MyMK | F: CCTGCTGTCTCTCCCAAGGT R: GAACCAGTGGGTCCCTAAGC | 59 | 133 |
GAPDH | F: AGGTTGTCTCCTGCGACTTCA R: TGGTCCAGGGTTTCTTACTCC | 57 | 184 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, W.; Lin, S.; Jiao, Z.; An, L.; Xie, T.; Wu, J.; Zhang, L. The Mouse CircGHR Regulates Proliferation, Differentiation and Apoptosis of Hepatocytes and Myoblasts. Genes 2023, 14, 1207. https://doi.org/10.3390/genes14061207
Zhang W, Lin S, Jiao Z, An L, Xie T, Wu J, Zhang L. The Mouse CircGHR Regulates Proliferation, Differentiation and Apoptosis of Hepatocytes and Myoblasts. Genes. 2023; 14(6):1207. https://doi.org/10.3390/genes14061207
Chicago/Turabian StyleZhang, Weilu, Shudai Lin, Zhenhai Jiao, Lilong An, Tingting Xie, Jiang Wu, and Li Zhang. 2023. "The Mouse CircGHR Regulates Proliferation, Differentiation and Apoptosis of Hepatocytes and Myoblasts" Genes 14, no. 6: 1207. https://doi.org/10.3390/genes14061207