Genome-Wide Analysis of miR159 Gene Family and Predicted Target Genes Associated with Environmental Stress in Dendrobium officinale: A Bioinformatics Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of MIR159 Gene Family in D. officinale
2.2. Chromosome Localization of Dof-MIR159 Gene Family
2.3. Phylogenetic Analysis of Dof-MIR159s
2.4. Conservation Analysis of Dof-miR159 Gene Family
2.5. Structure Prediction of Dof-miR159 Precursors
2.6. Regulatory Elements Prediction on the Promoter Region of Dof-MIR159s
2.7. Prediction of D. officinale miR159-Targeted Genes
2.8. Annotation and GO Enrichment Analysis of Predicted Target Genes in D. officinale
2.9. Expression Profiling of Predicted Dof-miR159 Target Genes
3. Results
3.1. Genome-Wide Identification of MIR159 Gene Family in D. officinale
3.2. Evolutionary Relationships of Dof-MIR159 Gene Family
3.3. Prediction of Cis-Acting Elements on the Promoters of the Precursor Sequences of Dof-miR159s
3.4. Prediction of Putative Target Genes and Functional Annotation
3.5. Tissue-Specific Expression Analysis of Predicted Dof-miR159 Target Genes
3.6. The Expression Pattern of Predicted Dof-miR159-Targeted Genes under Various Stresses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| miRNA | microRNA |
| nt | Nucleotide |
| RPPT | retrovirus-related Pol polyprotein from transposon |
| DEGs | differentially expressed genes |
References
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [Scilit]
- Jones-Rhoades, M.W.; Bartel, D.P.; Bartel, B. MicroRNAs and their regulatory roles in plants. Annu. Rev. Plant. Biol. 2006, 57, 19–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Voinnet, O. Origin, biogenesis, and activity of plant microRNAs. Cell 2009, 136, 669–687. [Google Scholar] [CrossRef] [Scilit]
- Khraiwesh, B.; Zhu, J.-K.; Zhu, J. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim. Biophys. Acta Gene Regul. Mech. 2012, 1819, 137–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- D’Ario, M.; Griffiths-Jones, S.; Kim, M. Small RNAs: Big impact on plant development. Trends Plant Sci. 2017, 22, 1056–1068. [Google Scholar] [CrossRef] [Scilit]
- Sun, G. MicroRNAs and their diverse functions in plants. Plant Mol. Biol. 2011, 80, 17–36. [Google Scholar] [CrossRef] [Scilit]
- Chavez Montes, R.A.; de Fatima Rosas-Cardenas, F.; De Paoli, E.; Accerbi, M.; Rymarquis, L.A.; Mahalingam, G.; Marsch-Martinez, N.; Meyers, B.C.; Green, P.J.; de Folter, S. Sample sequencing of vascular plants demonstrates widespread conservation and divergence of microRNAs. Nat. Commun. 2014, 5, 3722. [Google Scholar] [CrossRef] [Scilit]
- Millar, A.A.; Lohe, A.; Wong, G. Biology and function of miR159 in plants. Plants 2019, 8, 255. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.; Wang, S.; Zhang, B.; Shang-Guan, K.; Shi, Y.; Zhang, D.; Liu, X.; Wu, K.; Xu, Z.; Fu, X.; et al. A Gibberellin-mediated DELLA-NAC signaling cascade regulates cellulose synthesis in rice. Plant Cell 2015, 27, 1681–1696. [Google Scholar] [CrossRef] [Scilit]
- Gubler, F.; Kalla, R.; Roberts, J.K.; Jacobsen, J.V. Gibberellin-regulated expression of a myb gene in barley aleurone cells: Evidence for Myb transactivation of a high-pI alpha-amylase gene promoter. Plant Cell 1995, 7, 1879–1891. [Google Scholar] [CrossRef] [Scilit]
- Alonso-Peral, M.M.; Li, J.Y.; Li, Y.J.; Allen, R.S.; Schnippenkoetter, W.; Ohms, S.; White, R.G.; Millar, A.A. The MicroRNA159-regulated GAMYB-like genes inhibit growth and promote programmed cell death in Arabidopsis. Plant Physiol. 2010, 154, 757–771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsuji, H.; Aya, K.; Ueguchi-Tanaka, M.; Shimada, Y.; Nakazono, M.; Watanabe, R.; Nishizawa, N.K.; Gomi, K.; Shimada, A.; Kitano, H.; et al. GAMYB controls different sets of genes and is differentially regulated by microRNA in aleurone cells and anthers. Plant J. 2006, 47, 427–444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Millar, A.A.; Gubler, F. The Arabidopsis GAMYB-like genes, MYB33 and MYB65, are microRNA-regulated genes that redundantly facilitate anther development. Plant Cell 2005, 17, 705–721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Da Silva, E.M.; Silva, G.; Bidoia, D.B.; da Silva Azevedo, M.; de Jesus, F.A.; Pino, L.E.; Peres, L.E.P.; Carrera, E.; Lopez-Diaz, I.; Nogueira, F.T.S. microRNA159-targeted SlGAMYB transcription factors are required for fruit set in tomato. Plant J. 2017, 92, 95–109. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Zhao, Y.L.; Zhao, J.H.; Wang, S.; Jin, Y.; Chen, Z.Q.; Fang, Y.Y.; Hua, C.L.; Ding, S.W.; Guo, H.S. Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen. Nat. Plants 2016, 2, 16153. [Google Scholar] [CrossRef] [Scilit]
- Medina, C.; da Rocha, M.; Magliano, M.; Ratpopoulo, A.; Revel, B.; Marteu, N.; Magnone, V.; Lebrigand, K.; Cabrera, J.; Barcala, M.; et al. Characterization of microRNAs from Arabidopsis galls highlights a role for miR159 in the plant response to the root-knot nematode Meloidogyne Incogn. New Phytol. 2017, 216, 882–896. [Google Scholar] [CrossRef] [Scilit]
- Seneviratne, S.I. Climate science: Historical drought trends revisited. Nature 2012, 491, 338–339. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B. MicroRNA: A new target for improving plant tolerance to abiotic stress. J. Exp. Bot. 2015, 66, 1749–1761. [Google Scholar] [CrossRef] [Scilit]
- Xiang, X.G.; Schuiteman, A.; Li, D.Z.; Huang, W.C.; Chung, S.W.; Li, J.W.; Zhou, H.L.; Jin, W.T.; Lai, Y.J.; Li, Z.Y.; et al. Molecular systematics of Dendrobium (Orchidaceae, Dendrobieae) from mainland Asia based on plastid and nuclear sequences. Mol. Phylogenet. Evol. 2013, 69, 950–960. [Google Scholar] [CrossRef] [Scilit]
- Ng, T.B.; Liu, J.; Wong, J.H.; Ye, X.; Wing Sze, S.C.; Tong, Y.; Zhang, K.Y. Review of research on Dendrobium, a prized folk medicine. Appl. Microbiol. Biotechnol. 2012, 93, 1795–1803. [Google Scholar] [CrossRef] [Scilit]
- Niu, Z.; Zhu, F.; Fan, Y.; Li, C.; Zhang, B.; Zhu, S.; Hou, Z.; Wang, M.; Yang, J.; Xue, Q.; et al. The chromosome-level reference genome assembly for Dendrobium officinale and its utility of functional genomics research and molecular breeding study. Acta Pharm. Sin. B 2021, 11, 2080–2092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, Y.; Yu, D.; Xue, J.; Lu, J.; Feng, S.; Shen, C.; Wang, H. A transcriptome-wide, organ-specific regulatory map of Dendrobium officinale, an important traditional Chinese orchid herb. Sci. Rep. 2016, 6, 18864. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, C.J.; Li, J.W.; Feng, J.T.; Liu, B.; Feng, L.; Yu, X.L.; Li, G.L.; Zhai, J.X.; Meyers, B.C.; Xia, R. sRNAanno-a database repository of uniformly annotated small RNAs in plants. Hortic. Res. 2021, 8, 45. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.J.; Ma, Y.K.; Chen, T.; Wang, M.; Wang, X.J. PsRobot: A web-based plant small RNA meta-analysis toolbox. Nucleic Acids Res. 2012, 40, W22–W28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buchfink, B.; Xie, C.; Huson, D.H. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 2015, 12, 59–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Z.G.; Jiang, W.; Chen, S.L.; Mantri, N.; Tao, Z.M.; Jiang, C.X. Insights from the cold transcriptome and metabolome of Dendrobium officinale: Global reprogramming of metabolic and gene regulation networks during cold acclimation. Front. Plant Sci. 2016, 7, 1653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, L.H.; Wan, X.; Deng, H.; Zheng, B.Q.; Li, B.J.; Wang, Y. RNA-seq transcriptomic profiling of crassulacean acid metabolism pathway in Dendrobium catenatum. Sci. Data 2018, 5, 180252. [Google Scholar] [CrossRef] [Scilit]
- Jiang, W.; Wu, Z.; Wang, T.; Mantri, N.; Huang, H.; Li, H.; Tao, Z.; Guo, Q. Physiological and transcriptomic analyses of cadmium stress response in Dendrobium officinale seedling. Plant Physiol. Biochem. 2020, 148, 152–165. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Shen, Q.; Cai, X.; Lai, D.; Wu, L.; Han, Z.; Zhao, T.; Chen, D.; Si, J. JA signal-mediated immunity of Dendrobium catenatum to necrotrophic Southern Blight pathogen. BMC Plant Biol. 2021, 21, 360. [Google Scholar] [CrossRef] [Scilit]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef] [Scilit]
- Llave, C.; Xie, Z.X.; Kasschau, K.D.; Carrington, J.C. Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 2002, 297, 2053–2056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palatnik, J.F.; Wollmann, H.; Schommer, C.; Schwab, R.; Boisbouvier, J.; Rodriguez, R.; Warthmann, N.; Allen, E.; Dezulian, T.; Huson, D.; et al. Sequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319. Dev. Cell 2007, 13, 115–125. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.H.; Cho, J.S.; Lee, J.H.; Bae, S.Y.; Choi, Y.I.; Park, E.J.; Lee, H.; Ko, J.H. Poplar MYB transcription factor PtrMYB012 and its Arabidopsis AtGAMYB orthologs are differentially repressed by the Arabidopsis miR159 family. Tree Physiol. 2018, 38, 801–812. [Google Scholar] [CrossRef] [Scilit]
- Reyes, J.L.; Chua, N.H. ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. Plant J. 2007, 49, 592–606. [Google Scholar] [CrossRef] [Scilit]
- Yu, S.; Wang, J.W. The crosstalk between microRNAs and gibberellin signaling in plants. Plant Cell Physiol. 2020, 61, 1880–1890. [Google Scholar] [CrossRef] [Scilit]
- Allen, R.S.; Li, J.; Stahle, M.I.; Dubroue, A.; Gubler, F.; Millar, A.A. Genetic analysis reveals functional redundancy and the major target genes of the Arabidopsis miR159 family. Proc. Natl. Acad. Sci. USA 2007, 104, 16371–16376. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.J.; Seo, P.J. Ca2+ talyzing initial responses to environmental stresses. Trends Plant Sci. 2021, 26, 849–870. [Google Scholar] [CrossRef] [Scilit]
- Song, X.W.; Li, Y.; Cao, X.F.; Qi, Y.J. MicroRNAs and their regulatory roles in plant-environment interactions. Annu. Rev. Plant Biol. 2019, 70, 489–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verma, V.; Ravindran, P.; Kumar, P.P. Plant hormone-mediated regulation of stress responses. BMC Plant Biol. 2016, 16, 86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reichel, M.; Li, Y.J.; Li, J.Y.; Millar, A.A. Inhibiting plant microRNA activity: Molecular SPONGEs, target MIMICs and STTMs all display variable efficacies against target microRNAs. Plant Biotechnol. J. 2015, 13, 915–926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Wang, K.; Li, D.; Yan, J.; Zhang, W. Enhanced cold tolerance and tillering in switchgrass (Panicum virgatum L.) by heterologous expression of Osa-miR393a. Plant Cell Physiol. 2017, 58, 2226–2240. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Cui, Z.; Li, Y.; Kang, Y.; Song, X.; Wang, J.; Zhou, Y. Genome-wide identification and expression analysis of MYB transcription factor superfamily in Dendrobium catenatum. Front. Genet. 2021, 12, 714696. [Google Scholar] [CrossRef] [Scilit]
- Amatore, Z.; Gunn, S.; Harris, L.K. An educational bioinformatics project to improve genome annotation. Front. Microbiol. 2020, 11, 577497. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Zheng, Y.; Sun, L.; Chen, M. Genome-wide DNA methylation signatures of sea cucumber Apostichopus japonicus during environmental induced aestivation. Genes 2020, 11, 1020. [Google Scholar] [CrossRef] [Scilit]







| Dof-miRNA159 Gene Family | Mature Sequences (5′-3′) | Length (nt) | Chromosome Localization |
|---|---|---|---|
| Dof-miR159a | UUUGGAUUGAAGGGAGUUCC | 20 | chr4: 27722223–27721971 |
| Dof-miR159b | GUUGGAUUGAAGUGAGCUCUG | 21 | chr2: 29534166–29533917 |
| Dof-miR159c | UUUGGCUUGAAGGGAGCUCC | 20 | chr4: 25802668–25802903 |
| Dof-miR159d | UUUGGAUUGAAGGGAGUUCC | 20 | JACXSL010001612.1: 9402–9654 |
| Dof-miR159e | UUUGGAUUGAAGGGAGCUCUG | 21 | chr18: 17853945–17854139 |
| Dof-miR159f | UUGGAGUGAAGGGAGCUCCAU | 21 | chr3: 65301674–65301356 |
| Dof-miR159g | UUUGGAUUGAAGGAAGUUCUG | 21 | chr19: 647221–647302 |
| chr3: 4033924–4033843 | |||
| chr18: 10991639–10991558 | |||
| Dof-miR159h | UUUGGGUUGAAGGGAGCUCUG | 21 | chr4: 38860800–38860456 |
| Dof-miR159i | CUUGGAUUGAAGGGAGCUCC | 21 | chr1: 18800452–18800688 |
| Dof-miR159j | UUGGGUUUGAAGGGAGCUCUA | 20 | chr5: 66058489–66058730 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hao, L.; Zhang, Y. Genome-Wide Analysis of miR159 Gene Family and Predicted Target Genes Associated with Environmental Stress in Dendrobium officinale: A Bioinformatics Study. Genes 2022, 13, 1221. https://doi.org/10.3390/genes13071221
Hao L, Zhang Y. Genome-Wide Analysis of miR159 Gene Family and Predicted Target Genes Associated with Environmental Stress in Dendrobium officinale: A Bioinformatics Study. Genes. 2022; 13(7):1221. https://doi.org/10.3390/genes13071221
Chicago/Turabian StyleHao, Li, and Yi Zhang. 2022. "Genome-Wide Analysis of miR159 Gene Family and Predicted Target Genes Associated with Environmental Stress in Dendrobium officinale: A Bioinformatics Study" Genes 13, no. 7: 1221. https://doi.org/10.3390/genes13071221
APA StyleHao, L., & Zhang, Y. (2022). Genome-Wide Analysis of miR159 Gene Family and Predicted Target Genes Associated with Environmental Stress in Dendrobium officinale: A Bioinformatics Study. Genes, 13(7), 1221. https://doi.org/10.3390/genes13071221

