Identification of Novel Genes Associated with Fish Skeletal Muscle Adaptation during Fasting and Refeeding Based on a Meta-Analysis
Highlights
Abstract
1. Introduction
1.1. Fish and Skeletal Muscle
1.2. Meta-Analysis
2. Materials and Methods
2.1. In Silico Analysis
2.1.1. Integrative Meta-Analysis
2.1.2. Analysis of the Microarray Data and Differentially Expressed Genes (DEGs)
2.1.3. Ontologies and Network of Molecular Interactions
2.2. In Vivo Analysis
2.2.1. Ethics Statement and Animals
2.2.2. mRNA Expression
2.3. Statistical Analyses
3. Results
3.1. In Silico Analyzes
3.2. mRNA Expression
3.2.1. Early Juvenile Pacus Subjected to Four Days of Fasting (F4d) and Three Days of Refeeding (R3d)
3.2.2. Late Juvenile Pacus Subjected to Fasting for 15 Days (F15d) and Then Refeeding for Six Hours (R6h) or 15 Days (R15d)
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2020 Sustainability in Action. FAO. 2020. Available online: https://www.fao.org/documents/card/en/c/ca9229en (accessed on 20 December 2020).
- Valenti, W.C.; Barros, H.P.; Valenti, P.M.; Bueno, G.W.; Cavalli, R.O. Aquaculture in Brazil: Past, present and future. Aquac. Rep. 2021, 19, 100611. [Google Scholar] [CrossRef]
- Dias, K.; Ribeiro, T.C.; Carneiro, D.J.; Urbinati, E.C. Tempo de trânsito gastrintestinal e esvaziamento gástrico do pacu (Piaractus mesopotamicus) em diferentes temperaturas de cultivo. Acta Sci. Anim. Sci. 2005, 27, 414–417. [Google Scholar] [CrossRef][Green Version]
- Aguilar, F.A.A.; Da Cruz, T.M.P.; Mourão, J.B.; Cyrino, J.E.P. Water temperature, body mass, and fasting heat production of pacu (Piaractus mesopotamicus). SciELO 2017, 89, 1305–1312. [Google Scholar] [CrossRef]
- Mareco, E.A.; Garcia de la Serrana, D.; Johnston, I.A.; Dal-Pai-Silva, M. Characterization of the transcriptome of fast and slow muscle myotomal fibres in the pacu (Piaractus mesopotamicus). BMC Genom. 2015, 16, 182. [Google Scholar] [CrossRef] [PubMed]
- Duran, B.O.S.; de la Serrana, D.G.; Zanella, B.T.T.; Perez, E.S.; Mareco, E.A.; Santos, V.B.; Carvalho, R.F.; Dal-Pai-Silva, M. An insight on the impact of teleost whole genome duplication on the regulation of the molecular networks controlling skeletal muscle growth. PLoS ONE 2021, 16, e0255006. [Google Scholar] [CrossRef] [PubMed]
- Duran, B.O.S.; de Góes, G.A.; Zanella, B.T.T.; Freire, P.P.; Valente, J.S.; Salomão, R.A.S.; Fernandes, A.; Mareco, E.A.; Carvalho, R.F.; Dal-Pai-Silva, M. Ascorbic acid stimulates the in vitro myoblast proliferation and migration of pacu (Piaractus mesopotamicus). Sci. Rep. 2019, 9, 2229. [Google Scholar] [CrossRef]
- Johnston, I.A. Genetic and Environmental Determinants of Muscle Growth Patterns; Academic Press: Cambridge, MA, USA, 2001; pp. 141–186. [Google Scholar]
- Sänger, A.M.; Stoiber, W. Muscle Fiber Diversity and Plasticity; Academic Press: Cambridge, MA, USA, 2001; pp. 187–250. [Google Scholar]
- Johnston, I.A.; Bower, N.I.; Macqueen, D.J. Growth and the regulation of myotomal muscle mass in teleost fish. J. Exp. Biol. 2011, 214, 1617–1628. [Google Scholar] [CrossRef]
- Biga, P.R.; Goetz, F.W. Zebrafish and giant danio as models for muscle growth: Determinate vs. indeterminate growth as determined by morphometric analysis. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 291, 1327–1337. [Google Scholar] [CrossRef] [PubMed]
- Rescan, P.-Y.; Montfort, J.; Rallière, C.; Le Cam, A.; Esquerré, D.; Hugot, K. Dynamic gene expression in fish muscle during recovery growth induced by a fasting-refeeding schedule. BMC Genom. 2007, 8, 438. [Google Scholar] [CrossRef]
- Py, C.; Elizondo-González, R.; Peña-Rodríguez, A. Compensatory growth: Fitness cost in farmed fish and crustaceans. Rev. Aquac. 2022, 14, 1389–1417. [Google Scholar] [CrossRef]
- Kuniyoshi, M.L.G.; Da Silva-Gomes, R.N.; Vieira, J.C.S.; Hessel, M.C.; Mareco, E.A.; Dos Santos, V.B.; Carvalho, R.F.; Padilha, P.D.M.; Dal-Pai-Silva, M. Proteomic analysis of the fast-twitch muscle of pacu (Piaractus mesopotamicus) after prolonged fasting and compensatory growth. PLoS ONE 2019, 30, 321–332. [Google Scholar] [CrossRef]
- De Paula, T.G.; Zanella, B.T.T.; Fantinatti, B.E.D.A.; de Moraes, L.N.; Duran, B.O.D.S.; de Oliveira, C.B.; Salomão, R.A.S.; da Silva, R.N.; Padovani, C.R.; dos Santos, V.B.; et al. Food restriction increase the expression of mTORC1 complex genes in the skeletal muscle of juvenile pacu (Piaractus mesopotamicus). PLoS ONE 2017, 12, e0177679. [Google Scholar] [CrossRef] [PubMed]
- Zanella, B.T.T.; Magiori, I.C.; Duran, B.O.S.; Pereira, G.G.; Vicente, I.S.T.; Carvalho, P.L.P.F.; Salomão, R.; Mareco, E.; Carvalho, R.; Paula, T.; et al. Ascorbic acid supplementation improves skeletal muscle growth in pacu (Piaractus mesopotamicus) juveniles: In vivo and in vitro studies. Int. J. Mol. Sci. 2021, 22, 2995. [Google Scholar] [CrossRef] [PubMed]
- Nebo, C.; Portella, M.C.; Carani, F.R.; de Almeida, F.L.A.; Padovani, C.R.; Carvalho, R.F.; Dal-Pai-Silva, M. Short periods of fasting followed by refeeding change the expression of muscle growth-related genes in juvenile Nile tilapia (Oreochromis niloticus). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2013, 164, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Hagen, Ø.; Fernandes, J.M.O.; Solberg, C.; Johnston, I.A. Expression of growth-related genes in muscle during fasting and refeeding of juvenile Atlantic halibut, Hippoglossus hippoglossus L. Comp. Biochem. Physiol. B Biochem. 2008, 152, 47–53. [Google Scholar] [CrossRef]
- Tacchi, L.; Bickerdike, R.; Secombes, C.J.; Pooley, N.J.; Urquhart, K.L.; Collet, B.; Martin, S.A.M. Ubiquitin E3 ligase atrogin-1 (Fbox-32) in Atlantic salmon (Salmo salar): Sequence analysis, genomic structure and modulation of expression. Comp. Biochem. Physiol. B Biochem. 2010, 157, 364–373. [Google Scholar] [CrossRef]
- Seiliez, I.; Gabillard, J.C.; Cassy, S.S.; García-Serrana, D.; Gutiérrez, J.; Kaushik, S.; Panserat, S.; Tesseraud, S. An in vivo and in vitro assessment of TOR signaling cascade in rainbow trout (Oncorhynchus mykiss). Am. J. Physiol. Regul. Integr. Comp. Physiol. 2008, 295, 329–335. [Google Scholar] [CrossRef] [PubMed]
- Fuentes, E.; Björnsson, B.T.; Valdés, J.A.; Einarsdottir, I.E.; Lorca, B.; Alvarez, M.; Molina, A. IGF-I/PI3K/Akt and IGF-I/MAPK/ERK pathways in vivo in skeletal muscle are regulated by nutrition and contribute to somatic growth in the fine flounder. Am. J. Physiol. Integr. Comp. Physiol. 2011, 300, 1532–1542. [Google Scholar] [CrossRef] [PubMed]
- Møller, A.M.; Myles, P.S. What makes a good systematic review and meta-analysis? Br. J. Anaesth. 2016, 117, 428–430. [Google Scholar] [CrossRef] [PubMed]
- Perez-Riverol, Y.; Zorin, A.; Dass, G.; Vu, M.-T.; Xu, P.; Glont, M.; Vizcaíno, J.A.; Jarnuczak, A.F.; Petryszak, R.; Ping, P.; et al. Quantifying the impact of public omics data. Nat. Commun. 2019, 10, 3512. [Google Scholar] [CrossRef]
- Calduch-Giner, J.; Echasseriau, Y.; Crespo, D.; Baron, D.; Planas, J.V.; Prunet, P.; Pérez-Sánchez, J. Transcriptional assessment by microarray analysis and large-scale meta-analysis of the metabolic capacity of cardiac and skeletal muscle tissues to cope with reduced nutrient availability in gilthead sea bream (Sparus aurata L.). Mar. Biotechnol. 2014, 16, 423–435. [Google Scholar] [CrossRef]
- Mills, N.; Cashatt, D.; Weber, M.J.; Pierce, C.L. A case study and a meta-analysis of seasonal variation in fish mercury concentrations. Ecotoxicology 2018, 27, 641–649. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.-Y.; Hieu, B.N.; Audira, G.; Lou, B.; Lin, M.-D.; Hsiao, C.-D. Meta-Transcriptomic Analysis of RNAseq Data Reveals Pacu and Loach Fish with Unusually High Levels of Myoglobin Expression in Skeletal Muscles. Animals 2020, 10, 1130. [Google Scholar] [CrossRef] [PubMed]
- Page, M.J.; McKenzie, J.E.; Bossuyt, P.M.; Boutron, I.; Hoffmann, T.C.; Mulrow, C.D.; Shamseer, L.; Tetzlaff, J.M.; Akl, E.A.; Brennan, S.E.; et al. The PRISMA 2020 Statement: An updated guideline for reporting systematic reviews. BMJ 2021, 372, n71. [Google Scholar] [CrossRef]
- Lapa, R.M.L.; Filho, M.B.; Marchi, F.A.; Domingues, M.A.C.; de Carvalho, G.B.; Drigo, S.A.; Kowalski, L.P.; Rogatto, S.R. Integrated miRNA and mRNA expression analysis uncovers drug targets in laryngeal squamous cell carcinoma patients. Oral Oncol. 2019, 93, 76–84. [Google Scholar] [CrossRef] [PubMed]
- Kilkenny, C.; Browne, W.J.; Cuthill, I.C.; Emerson, M.; Altman, D.G. Improving bioscience research reporting: The arrive guidelines for reporting animal research. PLoS Biol. 2010, 8, e1000412. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real- time quantitative PCR and the 2∆∆Ct Method. Methods 2001, 1408, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Xiong, X.; Sun, Y. The role of ribosomal proteins in the regulation of cell proliferation, tumorigenesis, and genomic integrity. Sci. China Life Sci. 2016, 59, 656–672. [Google Scholar] [CrossRef]
- Kusnadi, E.P.; Hannan, K.M.; Hicks, R.J.; Hannan, R.D.; Pearson, R.B.; Kang, J. Regulation of rDNA transcription in response to growth factors, nutrients and energy. Gene 2015, 556, 27–34. [Google Scholar] [CrossRef]
- Lopez-Guadamillas, E.; Fernandez-Marcos, P.J.; Pantoja, C.; Muñoz-Martin, M.; Martínez, D.; Gómez-López, G.; Campos-Olivas, R.; Valverde, A.M.; Serrano, M. p21Cip1 plays a critical role in the physiological adaptation to fasting through activation of PPARα. Sci. Rep. 2016, 6, 34542. [Google Scholar] [CrossRef] [PubMed]
- Figueiredo, V.C.; McCarthy, J.J. Regulation of ribosome biogenesis in skeletal muscle hypertrophy. Physiology 2019, 34, 30–42. [Google Scholar] [CrossRef] [PubMed]
- Von Walden, F. Ribosome biogenesis in skeletal muscle: Coordination of transcription and translation. J. Appl. Physiol. 2019, 127, 591–598. [Google Scholar] [CrossRef]
- Von Walden, F.; Liu, C.; Aurigemma, N.; Nader, G.A. mTOR signaling regulates myotube hypertrophy by modulating protein synthesis, rDNA transcription, and chromatin remodeling. Am. J. Physiol. Physiol. 2016, 311, 663–672. [Google Scholar] [CrossRef] [PubMed]
- Bhat, K.P.; Itahana, K.; Jin, A.; Zhang, Y. Essential role of ribosomal protein L11 in mediating growth inhibition-induced p53 activation. EMBO J. 2004, 23, 2402–2412. [Google Scholar] [CrossRef] [PubMed]
- Goldberg, A.L.; Etlinger, J.D.; Goldspink, D.F.; Jablecki, C. Mechanism of work-induced hypertrophy of skeletal muscle. Med. Sci. Sports Exerc. 1975, 7, 185–198. [Google Scholar] [CrossRef]
- Lied, E.; Rosenlund, G.; Lund, B.; Von Der Decken, A. Effect of starvation and refeeding on in vitro protein synthesis in white trunk muscle of atlantic cod (Gadus morhua). Comp. Biochem. Physiol. Part B Comp. Biochem. 1983, 76, 777–781. [Google Scholar] [CrossRef]
- Li, Z.; Qi, C.-F.; Shin, D.-M.; Zingone, A.; Newbery, H.J.; Kovalchuk, A.L.; Abbott, C.M.; Morse, H.C., III. Eef1a2 promotes cell growth, inhibits apoptosis and activates JAK/STAT and AKT signaling in mouse plasmacytomas. PLoS ONE 2010, 5, e10755. [Google Scholar] [CrossRef]
- Chambers, D.M.; Peters, J.; Abbot, C. The lethal mutation of the mouse wasted (wst) is a deletion that abolishes expression of a tissue-specific isoform of translation elongation factor 1a, encoded by the Eef1a2 gene. Proc. Natl. Acad. Sci. USA 1998, 95, 4463–4468. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.; Smith, L.L.; Padilla-Lopez, S.R.; Guida, B.S.; Blume, E.; Shi, J.; Morton, S.U.; Brownstein, C.A.; Beggs, A.H.; Kruer, M.C.; et al. Homozygous EEF1A2 mutation causes dilated cardiomyopathy, failure to thrive, global developmental delay, epilepsy and early death. Hum. Mol. Genet. 2017, 26, 3545–3552. [Google Scholar] [CrossRef]
- Idigo, N.J.; Soares, D.C.; Abbott, C.M. Translation elongation factor 1A2 is encoded by one of four closely related eef1a genes and is dispensable for survival in zebrafish. Biosci. Rep. 2020, 40, BSR20194191. [Google Scholar] [CrossRef] [PubMed]
- Péladeau, C.; Adam, N.; Bronicki, L.M.; Coriati, A.; Thabet, M.; Al-Rewashdy, H.; Vanstone, J.; Mears, A.; Renaud, J.-M.; Holcik, M.; et al. Identification of therapeutics that target eEF1A2 and upregulate utrophin A translation in dystrophic muscles. Nat. Commun. 2020, 11, 1990. [Google Scholar] [CrossRef] [PubMed]
- Miyazaki, M.; Shimozuru, M.; Tsubota, T. Skeletal muscles of hibernating black bears show minimal atrophy and phenotype shifting despite prolonged physical inactivity and starvation. PLoS ONE 2019, 14, e0215489. [Google Scholar] [CrossRef] [PubMed]
- Jiménez, J.; Truman, A.W.; Menoyo, S.; Kron, S.; Clotet, J. The yin and yang of cyclin control by nutrients. Cell Cycle 2013, 12, 865–866. [Google Scholar] [CrossRef][Green Version]
- Yang, K.; Masahiro, H.; Stacey, D.W. Variations in Cyclin D1 levels through the cell cycle determine the proliferative fate of a cell. Cell Div. 2006, 1, 32. [Google Scholar] [CrossRef]
- Pagano, M.; Theodoras, A.M.; Tam, S.W.; Draetta, G.F. Cyclin D1-mediated inhibition of repair and replicative DNA synthesis in human fibroblasts. Genes Dev. 1994, 8, 1627–1639. [Google Scholar] [CrossRef]
- Pawlak, M.; Lefebvre, P.; Staels, B. Molecular mechanism of PPARα action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J. Hepatol. 2015, 62, 720–733. [Google Scholar] [CrossRef]
- Wahli, W.; Michalik, L. PPARs at the crossroads of lipid signaling and inflammation. Trends Endocrinol. Metab. 2012, 23, 351–363. [Google Scholar] [CrossRef]
- Kersten, S. Integrated physiology and systems biology of PPARα. Mol. Metab. 2014, 3, 354–371. [Google Scholar] [CrossRef]





| Symbol | Gene Name | Primer Sequence |
|---|---|---|
| rps27a | Ribosomal Protein S27a | F:CTACACCACCCCCAAGAAGA R:ATGAAAACACCAGCACCACA |
| eef1a2 | Eukaryotic Translation Elongation Factor 1 Alpha 2 | F:GAACAAATGCCACGGTTTCT R:AGAGCCCAACTACAGCCAGA |
| ccnd1 | Cyclin D1 | F:CACGATGCTAACCTGCTCAA R:TTTTGGGCACGATTTCTTTC |
| cdkn1a | Cyclin Dependent Kinase Inhibitor 1A | F: GTGGCGTTTCTCTGCTTAGG R:GATTCGGACTGAATGGCACT |
| mtor | Mechanistic Target of Rapamycin Kinase | F:TTGGGAGAGACGTACTGC R:CACAGGACTGGTGTAGGAA |
| ppia | Peptidylprolyl Isomerase A | F:ATTGTGGTTCGTGAAGTCGC R:CCGCTGGGCAGAGTGATTAT |
| Serial Number | Species | Treatment | Upregulated Genes | Downregulated Genes |
|---|---|---|---|---|
| GSE58929 | Danio rerio | Exercise | 1516 | 215 |
| GSE84288 | Salmo salar | Consumption of glucosinolates | 195 | 158 |
| GSE36339 | Sparus aurata | Consumption of lipopolysaccharides | 43 | 38 |
| GSE47141 | Oncorhynchus mykiss | Exercise and a high-carbohydrate diet | 152 | 206 |
| Total genes | 1906 | 617 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Perez, É.S.; Cury, S.S.; Zanella, B.T.T.; Carvalho, R.F.; Duran, B.O.S.; Dal-Pai-Silva, M. Identification of Novel Genes Associated with Fish Skeletal Muscle Adaptation during Fasting and Refeeding Based on a Meta-Analysis. Genes 2022, 13, 2378. https://doi.org/10.3390/genes13122378
Perez ÉS, Cury SS, Zanella BTT, Carvalho RF, Duran BOS, Dal-Pai-Silva M. Identification of Novel Genes Associated with Fish Skeletal Muscle Adaptation during Fasting and Refeeding Based on a Meta-Analysis. Genes. 2022; 13(12):2378. https://doi.org/10.3390/genes13122378
Chicago/Turabian StylePerez, Érika Stefani, Sarah Santiloni Cury, Bruna Tereza Thomazini Zanella, Robson Francisco Carvalho, Bruno Oliveira Silva Duran, and Maeli Dal-Pai-Silva. 2022. "Identification of Novel Genes Associated with Fish Skeletal Muscle Adaptation during Fasting and Refeeding Based on a Meta-Analysis" Genes 13, no. 12: 2378. https://doi.org/10.3390/genes13122378
APA StylePerez, É. S., Cury, S. S., Zanella, B. T. T., Carvalho, R. F., Duran, B. O. S., & Dal-Pai-Silva, M. (2022). Identification of Novel Genes Associated with Fish Skeletal Muscle Adaptation during Fasting and Refeeding Based on a Meta-Analysis. Genes, 13(12), 2378. https://doi.org/10.3390/genes13122378

