Adropin Slightly Modulates Lipolysis, Lipogenesis and Expression of Adipokines but Not Glucose Uptake in Rodent Adipocytes
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Cultures
2.3. Isolation of Rat Preadipocytes
2.4. Preadipocyte Differentiation
2.5. Lipolysis
2.6. Lipogenesis
2.7. Glucose Uptake
2.8. Real-Time PCR
2.9. Western Blot
2.10. Statistical Analysis
3. Results
3.1. Adropin Promotes Lipolysis in Rat Primary Adipocytes
3.2. Adropin Inhibits Lipogenesis but Fails to Modulate Glucose Uptake in Rat Primary Preadipocytes
3.3. Adropin Modulates Adipokine mRNA Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Kumar, K.G.; Trevaskis, J.L.; Lam, D.D.; Sutton, G.M.; Koza, R.A.; Chouljenko, V.N.; Kousoulas, K.G.; Rogers, P.M.; Kesterson, R.A.; Thearle, M.; et al. Identification of adropin as a secreted factor linking dietary macronutrient intake with energy homeostasis and lipid metabolism. Cell Metab. 2008, 8, 468–481. [Google Scholar] [CrossRef]
- Aydin, S.; Kuloglu, T.; Aydin, S.; Eren, M.N.; Yilmaz, M.; Kalayci, M.; Sahin, I.; Kocaman, N.; Citil, C.; Kendir, Y. Expression of adropin in rat brain, cerebellum, kidneys, heart, liver, and pancreas in streptozotocin-induced diabetes. Mol. Cell. Biochem. 2013, 380, 73–81. [Google Scholar] [CrossRef] [PubMed]
- Butler, A.A.; Zhang, J.; Price, C.A.; Stevens, J.R.; Graham, J.L.; Stanhope, K.L.; King, S.; Krauss, R.M.; Bremer, A.A.; Havel, P.J. Low plasma adropin concentrations increase risks of weight gain and metabolic dysregulation in response to a high-sugar diet in male nonhuman primates. J. Biol. Chem. 2019, 294, 9706–9719. [Google Scholar] [CrossRef] [PubMed]
- Lian, W.; Gu, X.; Qin, Y.; Zheng, X. Elevated plasma levels of adropin in heart failure patients. Intern. Med. 2011, 50, 1523–1527. [Google Scholar] [CrossRef]
- Neethu, A.; Jayashree, K.; Senthilkumar, G.P.; Ramesh Babu, K.; Vadivelan, M. Circulating adropin and vascular endothelial growth factor receptor-2 levels in age-related macular degeneration and T2DM patients-A cross-sectional study. J. Fam. Med. Prim. Care 2020, 9, 4875–4879. [Google Scholar] [CrossRef]
- Butler, A.A.; Tam, C.S.; Stanhope, K.L.; Wolfe, B.M.; Ali, M.R.; O’Keeffe, M.; St-Onge, M.P.; Ravussin, E.; Havel, P.J. Low circulating adropin concentrations with obesity and aging correlate with risk factors for metabolic disease and increase after gastric bypass surgery in humans. J. Clin. Endocrinol. Metab. 2012, 97, 3783–3791. [Google Scholar] [CrossRef]
- Stein, L.M.; Yosten, G.L.; Samson, W.K. Adropin acts in brain to inhibit water drinking: Potential interaction with the orphan G protein-coupled receptor, GPR19. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2016, 310, R476–R480. [Google Scholar] [CrossRef]
- Rao, A.; Herr, D.R. G protein-coupled receptor GPR19 regulates E-cadherin expression and invasion of breast cancer cells. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 1318–1327. [Google Scholar] [CrossRef]
- Thapa, D.; Stoner, M.W.; Zhang, M.; Xie, B.; Manning, J.R.; Guimaraes, D.; Shiva, S.; Jurczak, M.J.; Scott, I. Adropin regulates pyruvate dehydrogenase in cardiac cells via a novel GPCR-MAPK-PDK4 signaling pathway. Redox Biol. 2018, 18, 25–32. [Google Scholar] [CrossRef]
- Ganesh Kumar, K.; Zhang, J.; Gao, S.; Rossi, J.; McGuinness, O.P.; Halem, H.H.; Culler, M.D.; Mynatt, R.L.; Butler, A.A. Adropin deficiency is associated with increased adiposity and insulin resistance. Obesity 2012, 20, 1394–1402. [Google Scholar] [CrossRef] [PubMed]
- Thapa, D.; Xie, B.; Manning, J.R.; Zhang, M.; Stoner, M.W.; Huckestein, B.R.; Edmunds, L.R.; Zhang, X.; Dedousis, N.L.; O’Doherty, R.M.; et al. Adropin reduces blood glucose levels in mice by limiting hepatic glucose production. Physiol. Rep. 2019, 7, e14043. [Google Scholar] [CrossRef]
- Gao, S.; Ghoshal, S.; Zhang, L.; Stevens, J.R.; McCommis, K.S.; Finck, B.N.; Lopaschuk, G.D.; Butler, A.A. The peptide hormone adropin regulates signal transduction pathways controlling hepatic glucose metabolism in a mouse model of diet-induced obesity. J. Biol. Chem. 2019, 294, 13366–13377. [Google Scholar] [CrossRef]
- Gao, S.; McMillan, R.P.; Jacas, J.; Zhu, Q.; Li, X.; Kumar, G.K.; Casals, N.; Hegardt, F.G.; Robbins, P.D.; Lopaschuk, G.D.; et al. Regulation of substrate oxidation preferences in muscle by the peptide hormone adropin. Diabetes 2014, 63, 3242–3252. [Google Scholar] [CrossRef]
- Sayin, O.; Tokgoz, Y.; Arslan, N. Investigation of adropin and leptin levels in pediatric obesity-related nonalcoholic fatty liver disease. J. Pediatric Endocrinol. Metab. JPEM 2014, 27, 479–484. [Google Scholar] [CrossRef]
- Yu, H.Y.; Zhao, P.; Wu, M.C.; Liu, J.; Yin, W. Serum adropin levels are decreased in patients with acute myocardial infarction. Regul. Pept. 2014, 190–191, 46–49. [Google Scholar] [CrossRef]
- Zang, H.; Jiang, F.; Cheng, X.; Xu, H.; Hu, X. Serum adropin levels are decreased in Chinese type 2 diabetic patients and negatively correlated with body mass index. Endocr. J. 2018, 65, 685–691. [Google Scholar] [CrossRef]
- Jasaszwili, M.; Wojciechowicz, T.; Billert, M.; Strowski, M.Z.; Nowak, K.W.; Skrzypski, M. Effects of adropin on proliferation and differentiation of 3T3-L1 cells and rat primary preadipocytes. Mol. Cell. Endocrinol. 2019, 496, 110532. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Ojeda, F.J.; Ruperez, A.I.; Gomez-Llorente, C.; Gil, A.; Aguilera, C.M. Cell Models and Their Application for Studying Adipogenic Differentiation in Relation to Obesity: A Review. Int. J. Mol. Sci. 2016, 17, 1040. [Google Scholar] [CrossRef] [PubMed]
- Kolodziejski, P.A.; Pruszynska-Oszmalek, E.; Micker, M.; Skrzypski, M.; Wojciechowicz, T.; Szwarckopf, P.; Skieresz-Szewczyk, K.; Nowak, K.W.; Strowski, M.Z. Spexin: A novel regulator of adipogenesis and fat tissue metabolism. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2018, 1863, 1228–1236. [Google Scholar] [CrossRef]
- Dole, V.P.; Meinertz, H. Microdetermination of long-chain fatty acids in plasma and tissues. J. Biol. Chem. 1960, 235, 2595–2599. [Google Scholar] [CrossRef]
- Lindvall, H.; Nevsten, P.; Strom, K.; Wallenberg, R.; Sundler, F.; Langin, D.; Winzell, M.S.; Holm, C. A novel hormone-sensitive lipase isoform expressed in pancreatic β-cells. J. Biol. Chem. 2004, 279, 3828–3836. [Google Scholar] [CrossRef]
- Langin, D. Control of fatty acid and glycerol release in adipose tissue lipolysis. Comptes Rendus Biol. 2006, 329, 598–607. [Google Scholar] [CrossRef]
- Jasaszwili, M.; Wojciechowicz, T.; Strowski, M.Z.; Nowak, K.W.; Skrzypski, M. Adropin stimulates proliferation but suppresses differentiation in rat primary brown preadipocytes. Arch. Biochem. Biophys. 2020, 692, 108536. [Google Scholar] [CrossRef]
- Duncan, R.E.; Ahmadian, M.; Jaworski, K.; Sarkadi-Nagy, E.; Sul, H.S. Regulation of lipolysis in adipocytes. Annu. Rev. Nutr. 2007, 27, 79–101. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, T.S.; Jessen, N.; Jorgensen, J.O.; Moller, N.; Lund, S. Dissecting adipose tissue lipolysis: Molecular regulation and implications for metabolic disease. J. Mol. Endocrinol. 2014, 52, R199–R222. [Google Scholar] [CrossRef]
- Djouder, N.; Tuerk, R.D.; Suter, M.; Salvioni, P.; Thali, R.F.; Scholz, R.; Vaahtomeri, K.; Auchli, Y.; Rechsteiner, H.; Brunisholz, R.A.; et al. PKA phosphorylates and inactivates AMPKalpha to promote efficient lipolysis. EMBO J. 2010, 29, 469–481. [Google Scholar] [CrossRef]
- Martin, S.; Okano, S.; Kistler, C.; Fernandez-Rojo, M.A.; Hill, M.M.; Parton, R.G. Spatiotemporal regulation of early lipolytic signaling in adipocytes. J. Biol. Chem. 2009, 284, 32097–32107. [Google Scholar] [CrossRef]
- Ge, M.; Guo, R.; Lou, H.X.; Zhang, W. Extract of Paecilomyces hepiali mycelia induces lipolysis through PKA-mediated phosphorylation of hormone-sensitive lipase and ERK-mediated downregulation of perilipin in 3T3-L1 adipocytes. BMC Complement. Altern. Med. 2018, 18, 326. [Google Scholar] [CrossRef] [PubMed]
- Kersten, S. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep. 2001, 2, 282–286. [Google Scholar] [CrossRef]
- Takano, T.; Hennes, A.R.; Power, L. Insulin-stimulated lipogenesis in rat adipose tissue in vitro: Incorporation of C14 from glucose and acetate into lipid fractions and fatty acids. Metabolism 1967, 16, 933–940. [Google Scholar] [CrossRef]
- Song, Z.; Xiaoli, A.M.; Yang, F. Regulation and Metabolic Significance of De Novo Lipogenesis in Adipose Tissues. Nutrients 2018, 10, 1383. [Google Scholar] [CrossRef]
- Fasshauer, M.; Bluher, M. Adipokines in health and disease. Trends Pharmacol. Sci. 2015, 36, 461–470. [Google Scholar] [CrossRef]
- Tripathi, D.; Kant, S.; Pandey, S.; Ehtesham, N.Z. Resistin in metabolism, inflammation, and disease. FEBS J. 2020, 287, 3141–3149. [Google Scholar] [CrossRef]
- Kadowaki, T.; Yamauchi, T.; Kubota, N.; Hara, K.; Ueki, K.; Tobe, K. Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J. Clin. Investig. 2006, 116, 1784–1792. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; McMillan, R.P.; Zhu, Q.; Lopaschuk, G.D.; Hulver, M.W.; Butler, A.A. Therapeutic effects of adropin on glucose tolerance and substrate utilization in diet-induced obese mice with insulin resistance. Mol. Metab. 2015, 4, 310–324. [Google Scholar] [CrossRef] [PubMed]
- Steppan, C.M.; Bailey, S.T.; Bhat, S.; Brown, E.J.; Banerjee, R.R.; Wright, C.M.; Patel, H.R.; Ahima, R.S.; Lazar, M.A. The hormone resistin links obesity to diabetes. Nature 2001, 409, 307–312. [Google Scholar] [CrossRef] [PubMed]
- Patel, L.; Buckels, A.C.; Kinghorn, I.J.; Murdock, P.R.; Holbrook, J.D.; Plumpton, C.; Macphee, C.H.; Smith, S.A. Resistin is expressed in human macrophages and directly regulated by PPAR γ activators. Biochem. Biophys. Res. Commun. 2003, 300, 472–476. [Google Scholar] [CrossRef]
- Park, H.K.; Kwak, M.K.; Kim, H.J.; Ahima, R.S. Linking resistin, inflammation, and cardiometabolic diseases. Korean J. Intern. Med. 2017, 32, 239–247. [Google Scholar] [CrossRef]
- Park, H.K.; Qatanani, M.; Briggs, E.R.; Ahima, R.S.; Lazar, M.A. Inflammatory induction of human resistin causes insulin resistance in endotoxemic mice. Diabetes 2011, 60, 775–783. [Google Scholar] [CrossRef] [PubMed]
- Heo, Y.J.; Choi, S.E.; Jeon, J.Y.; Han, S.J.; Kim, D.J.; Kang, Y.; Lee, K.W.; Kim, H.J. Visfatin Induces Inflammation and Insulin Resistance via the NF-kappaB and STAT3 Signaling Pathways in Hepatocytes. J. Diabetes Res. 2019, 2019, 4021623. [Google Scholar] [CrossRef]
- Zhang, S.; Chen, Q.; Lin, X.; Chen, M.; Liu, Q. A Review of Adropin as the Medium of Dialogue between Energy Regulation and Immune Regulation. Oxid. Med. Cell. Longev. 2020, 2020, 3947806. [Google Scholar] [CrossRef]
- Akcilar, R.; Emel Kocak, F.; Simsek, H.; Akcilar, A.; Bayat, Z.; Ece, E.; Kokdasgil, H. The effect of adropin on lipid and glucose metabolism in rats with hyperlipidemia. Iranian J. Basic Med. Sci. 2016, 19, 245–251. [Google Scholar]
- Bozic, J.; Borovac, J.A.; Galic, T.; Kurir, T.T.; Supe-Domic, D.; Dogas, Z. Adropin and Inflammation Biomarker Levels in Male Patients With Obstructive Sleep Apnea: A Link With Glucose Metabolism and Sleep Parameters. J. Clin. Sleep Med. JCSM 2018, 14, 1109–1118. [Google Scholar] [CrossRef]
- Banerjee, S.; Ghoshal, S.; Girardet, C.; DeMars, K.M.; Yang, C.; Niehoff, M.L.; Nguyen, A.D.; Jayanth, P.; Mersman, B.A.; Xu, F. Adropin expression correlates with age-related neuropathologies in the human brain and improves neuroinflammation and cognitive function in aging mice. Res. Sq. 2021. [Google Scholar] [CrossRef]
- Ellulu, M.S.; Patimah, I.; Khaza’ai, H.; Rahmat, A.; Abed, Y. Obesity and inflammation: The linking mechanism and the complications. Arch. Med. Sci. AMS 2017, 13, 851–863. [Google Scholar] [CrossRef]
- Lian, A.; Wu, K.; Liu, T.; Jiang, N.; Jiang, Q. Adropin induction of lipoprotein lipase expression in tilapia hepatocytes. J. Mol. Endocrinol. 2016, 56, 11–22. [Google Scholar] [CrossRef] [PubMed]
- Carmen, G.Y.; Victor, S.M. Signalling mechanisms regulating lipolysis. Cell. Signal. 2006, 18, 401–408. [Google Scholar] [CrossRef] [PubMed]







| Gene | Left Primer (5′>3′) | Right Primer (5′>3′) | NCBI Reference Sequence |
|---|---|---|---|
| Adiponectin (rat) | tggtcacaatgggataccg | cccttaggaccaagaacacct | NM_144744.3 |
| Gapdh (rat) | ctgcaccaccaactgcttag | tgatggcatggactgtgg | NM_017008.4 |
| Hsl (rat) | cccaaagtaagaggcacagagt | tcctggcattcctggtctttc | NM_012859.1 |
| Resistin (rat) | gccgctgtccagtctat | cattgctggtcagtctcc | NM_144741.1 |
| Visfatin (rat) | cacaagagactgccggcatag | tttcccccacgctgttatgg | NM_177928.3 |
| Adiponectin (mouse) | atctggaggtgggagaccaa | gggctatgggtagttgcagt | NM_009605.5 |
| Gapdh (mouse) | atggtgaaggtcggtgtga | aatctccactttgccactgc | NM_001289726.1 |
| Resistin (mouse) | tgaagatggatggcgaagtgg | gtggtgtaaatgccctgggt | NM_022984.4 |
| Visfatin (mouse) | ccataacggcttgggggaaa | gctatcgctgaccacagaca | NM_021524.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jasaszwili, M.; Pruszyńska-Oszmałek, E.; Wojciechowicz, T.; Strowski, M.Z.; Nowak, K.W.; Skrzypski, M. Adropin Slightly Modulates Lipolysis, Lipogenesis and Expression of Adipokines but Not Glucose Uptake in Rodent Adipocytes. Genes 2021, 12, 914. https://doi.org/10.3390/genes12060914
Jasaszwili M, Pruszyńska-Oszmałek E, Wojciechowicz T, Strowski MZ, Nowak KW, Skrzypski M. Adropin Slightly Modulates Lipolysis, Lipogenesis and Expression of Adipokines but Not Glucose Uptake in Rodent Adipocytes. Genes. 2021; 12(6):914. https://doi.org/10.3390/genes12060914
Chicago/Turabian StyleJasaszwili, Mariami, Ewa Pruszyńska-Oszmałek, Tatiana Wojciechowicz, Mathias Z. Strowski, Krzysztof W. Nowak, and Marek Skrzypski. 2021. "Adropin Slightly Modulates Lipolysis, Lipogenesis and Expression of Adipokines but Not Glucose Uptake in Rodent Adipocytes" Genes 12, no. 6: 914. https://doi.org/10.3390/genes12060914
APA StyleJasaszwili, M., Pruszyńska-Oszmałek, E., Wojciechowicz, T., Strowski, M. Z., Nowak, K. W., & Skrzypski, M. (2021). Adropin Slightly Modulates Lipolysis, Lipogenesis and Expression of Adipokines but Not Glucose Uptake in Rodent Adipocytes. Genes, 12(6), 914. https://doi.org/10.3390/genes12060914

