Heat Stress Pre-Exposure May Differentially Modulate Plant Defense to Powdery Mildew in a Resistant and Susceptible Barley Genotype
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Pathogen Inoculation
2.2. Heat Stress
2.3. Evaluation of Bgh Symptoms
2.4. Quantitative Analyses of Powdery Mildew Biomass and Plant Defense Gene Expression
2.5. Statistical Analyses
3. Results
3.1. Testing Different Barley Lines to Powdery Mildew Resistance
3.2. Determination of the Influence of Heat Stress on Powdery Mildew Infection
3.3. Expression of Plant Defense/Stress Genes in Heat-Stressed and BGH-Infected Barley
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jones, J.D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef]
- Boller, T.; Felix, G. A renaissance of elicitors: Perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 2009, 60, 379–407. [Google Scholar] [CrossRef]
- Dangl, J.L.; Horvath, D.M.; Staskawicz, B.J. Pivoting the plant immune system from dissection to deployment. Science 2013, 341, 746–751. [Google Scholar] [CrossRef]
- Hammond-Kosack, K.E.; Jones, J.D.G. Plant disease resistance genes. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1997, 48, 575–607. [Google Scholar] [CrossRef]
- Levine, A.; Tenhaken, R.; Dixon, R.; Lamb, C. H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 1994, 79, 583–593. [Google Scholar] [CrossRef]
- Thordal-Christensen, H.; Zhang, Z.; Wei, Y.; Collinge, D.B. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant J. 1997, 11, 1187–1194. [Google Scholar] [CrossRef]
- Torres, M.A.; Jones, J.D.G.; Dangl, J.L. Pathogen-induced, NADPH oxidase–derived reactive oxygen intermediates suppress spread of cell death in Arabidopsis thaliana. Nat. Genet. 2005, 37, 1130–1134. [Google Scholar] [CrossRef]
- Pogány, M.; von Rad, U.; Grün, S.; Dongó, A.; Pintye, A.; Simoneau, P.; Bahnweg, G.; Kiss, L.; Barna, B.; Durner, J. Dual roles of reactive oxygen species and NADPH oxidase RBOHD in an Arabidopsis-Alternaria pathosystem. Plant Physiol. 2009, 151, 1459–1475. [Google Scholar] [CrossRef]
- Hafez, Y.M.; Bacsó, R.; Király, Z.; Künstler, A.; Király, L. Up-regulation of antioxidants in tobacco by low concentrations of H2O2 suppresses necrotic disease symptoms. Phytopathology 2012, 102, 848–856. [Google Scholar] [CrossRef]
- Van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef]
- Sels, J.; Mathys, J.; De Coninck, B.M.A.; Cammue, B.P.A.; De Bolle, M.F.C. Plant pathogenesis-related (PR) proteins: A focus on PR peptides. Plant Physiol. Biochem. 2008, 46, 941–950. [Google Scholar] [CrossRef] [PubMed]
- Schultheiss, H.; Dechert, C.; Király, L.; Fodor, J.; Michel, K.; Kogel, K.H.; Hückelhoven, R. Functional assessment of the pathogenesis-related protein PR-1b in barley. Plant Sci. 2003, 165, 1275–1280. [Google Scholar] [CrossRef]
- Breen, S.; Williams, S.J.; Outram, M.; Kobe, B.; Solomon, P.S. Emerging insights into the functions of pathogenesis-related protein 1. Trends Plant Sci. 2017, 22, 871–879. [Google Scholar] [CrossRef]
- Glawe, D.A. The powdery mildews: A review of the world’s most familiar (yet poorly known) plant pathogens. Annu. Rev. Phytopathol. 2008, 46, 27–51. [Google Scholar] [CrossRef]
- Braun, U. The current systematics and taxonomy of the powdery mildews (Erysiphales): An overview. Mycoscience 2011, 52, 210–212. [Google Scholar] [CrossRef]
- Oliver, R.; Hewitt, H.G. Fungicides in Crop Protection, 2nd ed.; Oliver, R., Hewitt, H.G., Eds.; CABI: Wallingford, UK, 2014. [Google Scholar]
- Dean, R.; van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
- Hacquard, S.; Kracher, B.; Maekawa, T.; Vernaldi, S.; Schulze-Lefert, P.; van Themaat, E.V.L. Mosaic genome structure of the barley powdery mildew pathogen and conservation of transcriptional programs in divergent hosts. Proc. Natl. Acad. Sci. USA 2013, 110, E2219–E2228. [Google Scholar] [CrossRef]
- Cantalapiedra, C.P.; García-Pereira, M.J.; Gracia, M.P.; Igartua, E.; Casas, A.M.; Contreras-Moreira, B. Large differences in gene expression responses to drought and heat stress between elite barley cultivar scarlett and a Spanish landrace. Front. Plant Sci. 2017, 8. [Google Scholar] [CrossRef]
- Challinor, A.J.; Watson, J.; Lobell, D.B.; Howden, S.M.; Smith, D.R.; Chhetri, N. A meta-analysis of crop yield under climate change and adaptation. Nat. Clim. Chang. 2014, 4, 287–291. [Google Scholar] [CrossRef]
- Lasram, A.; Masmoudi, M.M.; Mechlia, N.B. Effect of high temperature stress on wheat and barley production in Northern Tunisia. In Water and Land Security in Drylands, Response to Climate Change; Ouessar, M., Gabriels, D., Tsunekawa, A., Evett, S., Eds.; Springer: Cham, Switzerland, 2017; pp. 27–34. [Google Scholar]
- Driedonks, N.; Xu, J.; Peters, J.L.; Park, S.; Rieu, I. Multi-level interactions between heat shock factors, heat shock proteins, and the redox system regulate acclimation to heat. Front. Plant Sci. 2015, 6, 999. [Google Scholar] [CrossRef] [PubMed]
- Desaint, H.; Aoun, N.; Deslandes, L.; Vailleau, F.; Roux, F.; Berthomé, R. Fight hard or die trying: When plants face pathogens under heat stress. New Phytol. 2021, 229, 712–734. [Google Scholar] [CrossRef]
- Matić, S.; Cucu, M.A.; Garibaldi, A.; Gullino, M.L. Combined effect of CO2 and temperature on wheat powdery mildew development. Plant Pathol. J. 2018, 34, 316–326. [Google Scholar] [CrossRef] [PubMed]
- McDonald, B.A.; Stukenbrock, E.H. Rapid emergence of pathogens in agro-ecosystems: Global threats to agricultural sustainability and food security. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20160026. [Google Scholar] [CrossRef] [PubMed]
- Atkinson, N.J.; Urwin, P.E. The interaction of plant biotic and abiotic stresses: From genes to the field. J. Exp. Bot. 2012, 63, 3523–3544. [Google Scholar] [CrossRef]
- Suzuki, N.; Rivero, R.M.; Shulaev, V.; Blumwald, E.; Mittler, R. Abiotic and biotic stress combinations. New Phytol. 2014, 203, 32–43. [Google Scholar] [CrossRef]
- Onaga, G.; Wydra, K.; Koopmann, B.; Chebotarov, D.; Séré, Y.; Von Tiedemann, A. High temperature effects on Pi54 conferred resistance to Magnaporthe oryzae in two genetic backgrounds of Oryza sativa. J. Plant Physiol. 2017, 212, 80–93. [Google Scholar] [CrossRef] [PubMed]
- Sharma, R.C.; Duveiller, E.; Ortiz-Ferrara, G. Progress and challenge towards reducing wheat spot blotch threat in the Eastern Gangetic Plains of South Asia: Is climate change already taking its toll? Field Crop. Res. 2007, 103, 109–118. [Google Scholar] [CrossRef]
- Aust, H.; Hoyningen-Huene, J.V. Microclimate in relation to epidemics of powdery mildew. Annu. Rev. Phytopathol. 1986, 24, 491–510. [Google Scholar] [CrossRef]
- Ward, S.V.; Manners, J.G. Environmental effects on the quantity and viability of conidia produced by Erysiphe graminis. Trans. Br. Mycol. Soc. 1974, 62, 119–128. [Google Scholar] [CrossRef]
- Akai, S. Relation of temperature to the invasion of the barley powdery mildew into host. Agric. Hortic. Tokyo 1952, 27, 1135. [Google Scholar]
- Jenkyn, J.F.; Bainbridge, A. Biology and pathology of cereal powdery mildews. In The Powdery Mildews; Spencer, D.M., Ed.; Academic Press: London, UK, 1978; pp. 283–321. [Google Scholar]
- Wang, Y.; Bao, Z.; Zhu, Y.; Hua, J. Analysis of temperature modulation of plant defense against biotrophic microbes. Mol. Plant-Microbe Interact. 2009, 22, 498–506. [Google Scholar] [CrossRef]
- Barna, B.; Harrach, B.D.; Viczián, O.; Fodor, J. Heat induced susceptibility of barley lines with various types of resistance genes to powdery mildew. Acta Phytopathol. Entomol. Hung. 2014, 49, 177–188. [Google Scholar] [CrossRef]
- Künstler, A.; Bacsó, R.; Albert, R.; Barna, B.; Király, Z.; Hafez, Y.M.; Fodor, J.; Schwarczinger, I.; Király, L. Superoxide (O2.−) accumulation contributes to symptomless (type I) nonhost resistance of plants to biotrophic pathogens. Plant Physiol. Biochem. 2018, 128, 115–125. [Google Scholar] [CrossRef] [PubMed]
- Schweizer, P.; Vallélian-Bindschedler, L.; Mösinger, E. Heat-induced resistance in barley to the powdery mildew fungus Erysiphe graminis f. sp. hordei. Physiol. Mol. Plant Pathol. 1995, 47, 51–66. [Google Scholar] [CrossRef]
- Vallélian-Bindschedler, L.; Schweizer, P.; Mösinger, E.; Métraux, J.P. Heat-induced resistance in barley to powdery mildew (Blumeria graminis f. sp. hordei) is associated with a burst of active oxygen species. Physiol. Mol. Plant Pathol. 1998, 52, 185–199. [Google Scholar] [CrossRef]
- Schwarzbach, E. Heat induced susceptibility of mlo-barley to powdery mildew (Blumeria graminis D.C. f. sp. hordei Marchal). Czech J. Genet. Plant Breed. 2001, 37, 82–87. [Google Scholar]
- Höller, K.; Király, L.; Künstler, A.; Müller, M.; Gullner, G.; Fattinger, M.; Zechmann, B. Enhanced glutathione metabolism is correlated with sulfur-induced resistance in Tobacco mosaic virus-infected genetically susceptible Nicotiana tabacum plants. Mol. Plant-Microbe Interact. 2010, 23, 1448–1459. [Google Scholar] [CrossRef] [PubMed]
- Trujillo, M.; Altschmied, L.; Schweizer, P.; Kogel, K.H.; Hückelhoven, R. Respiratory burst oxidase homologue A of barley contributes to penetration by the powdery mildew fungus Blumeria graminis f. sp. hordei. J. Exp. Bot. 2006, 57, 3781–3791. [Google Scholar] [CrossRef]
- Eichmann, R.; Bischof, M.; Weis, C.; Shaw, J.; Lacomme, C.; Schweizer, P.; Duchkov, D.; Hensel, G.; Kumlehn, J.; Hückelhoven, R. BAX INHIBITOR-1 is required for full susceptibility of barley to powdery mildew. Mol. Plant-Microbe Interact. 2010, 23, 1217–1227. [Google Scholar] [CrossRef]
- Proels, R.K.; Oberhollenzer, K.; Pathuri, I.P.; Hensel, G.; Kumlehn, J.; Hückelhoven, R. RBOHF2 of barley is required for normal development of penetration resistance to the parasitic fungus Blumeria graminis f. sp. hordei. Mol. Plant-Microbe Interact. 2010, 23, 1143–1150. [Google Scholar] [CrossRef] [PubMed]
- Pennington, H.G.; Li, L.; Spanu, P.D. Identification and selection of normalization controls for quantitative transcript analysis in Blumeria graminis. Mol. Plant Pathol. 2016, 17, 625–633. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Samuel, G. Some experiments on inoculating methods with plant viruses, and on local lesions. Ann. Appl. Biol. 1931, 18, 494–507. [Google Scholar] [CrossRef]
- Moury, B.; Gebre Selassie, K.; Marchoux, G.; Daubèze, A.M.; Palloix, A. High temperature effects on hypersensitive resistance to Tomato spotted wilt tospovirus (TSWV) in pepper (Capsicum chinense Jacq.). Eur. J. Plant Pathol. 1998, 104, 489–498. [Google Scholar] [CrossRef]
- Marathe, R.; Anandalakshmi, R.; Liu, Y.; Dinesh-Kumar, S.P. The Tobacco mosaic virus resistance gene. Mol. Plant Pathol. 2002, 3, 167–172. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Burch-Smith, T.; Schiff, M.; Feng, S.; Dinesh-Kumar, S.P. Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J. Biol. Chem. 2004, 279, 2101–2108. [Google Scholar] [CrossRef]
- Zhu, Y.; Qian, W.; Hua, J. Temperature modulates plant defense responses through NB-LRR proteins. PLoS Pathog. 2010, 6, e1000844. [Google Scholar] [CrossRef]
- Menna, A.; Nguyen, D.; Guttman, D.S.; Desveaux, D. Elevated temperature differentially influences effector-triggered immunity outputs in Arabidopsis. Front. Plant Sci. 2015, 6. [Google Scholar] [CrossRef] [PubMed]
- Hückelhoven, R. BAX Inhibitor-1, an ancient cell death suppressor in animals and plants with prokaryotic relatives. Apoptosis 2004, 9, 299–307. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, N.; Lam, E. Bax Inhibitor-1, a conserved cell death suppressor, is a key molecular switch downstream from a variety of biotic and abiotic stress signals in plants. Int. J. Mol. Sci. 2009, 10, 3149–3167. [Google Scholar] [CrossRef]
- Watanabe, N.; Lam, E. Arabidopsis Bax inhibitor-1 functions as an attenuator of biotic and abiotic types of cell death. Plant J. 2006, 45, 884–894. [Google Scholar] [CrossRef] [PubMed]
- Isbat, M.; Zeba, N.; Kim, S.R.; Hong, C.B. A BAX inhibitor-1 gene in Capsicum annuum is induced under various abiotic stresses and endows multi-tolerance in transgenic tobacco. J. Plant Physiol. 2009, 166, 1685–1693. [Google Scholar] [CrossRef] [PubMed]
- Hückelhoven, R.; Dechert, C.; Trujillo, M.; Kogel, K.-H. Differential expression of putative cell death regulator genes in near-isogenic, resistant and susceptible barley lines during interaction with the powdery mildew fungus. Plant Mol. Biol. 2001, 47, 739–748. [Google Scholar] [CrossRef]
- Hückelhoven, R.; Dechert, C.; Kogel, K.-H. Overexpression of barley BAX inhibitor 1 induces breakdown of mlo-mediated penetration resistance to Blumeria graminis. Proc. Natl. Acad. Sci. USA 2003, 100, 5555–5560. [Google Scholar] [CrossRef]
- Eichmann, R.; Dechert, C.; Kogel, K.H.; Hückelhoven, R. Transient over-expression of barley BAX Inhibitor-1 weakens oxidative defence and MLA12-mediated resistance to Blumeria graminis f.sp. hordei. Mol. Plant Pathol. 2006, 7, 543–552. [Google Scholar] [CrossRef] [PubMed]
- Babaeizad, V.; Imani, J.; Kogel, K.H.; Eichmann, R.; Hückelhoven, R. Over-expression of the cell death regulator BAX inhibitor-1 in barley confers reduced or enhanced susceptibility to distinct fungal pathogens. Theor. Appl. Genet. 2009, 118, 455–463. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Tang, C.; Huang, X.; Li, F.; Chen, X.; Zhang, G.; Sun, Y.; Han, D.; Kang, Z. Wheat BAX inhibitor-1 contributes to wheat resistance to Puccinia striiformis. J. Exp. Bot. 2012, 63, 4571–4584. [Google Scholar] [CrossRef] [PubMed]
- Gaguancela, O.A.; Źuñiga, L.P.; Arias, A.V.; Halterman, D.; Flores, F.J.; Johansen, I.E.; Wang, A.; Yamaji, Y.; Verchot, J. The IRE1/bZIP60 pathway and Bax inhibitor 1 suppress systemic accumulation of potyviruses and potexviruses in Arabidopsis and Nicotiana benthamiana plants. Mol. Plant-Microbe Interact. 2016, 29, 750–766. [Google Scholar] [CrossRef]
- Marino, D.; Dunand, C.; Puppo, A.; Pauly, N. A burst of plant NADPH oxidases. Trends Plant Sci. 2012, 17, 9–15. [Google Scholar] [CrossRef]
- Torres, D.P.; Proels, R.K.; Schempp, H.; Hückelhoven, R. Silencing of RBOHF2 causes leaf age–dependent accelerated senescence, salicylic acid accumulation, and powdery mildew resistance in barley. Mol. Plant-Microbe Interact. 2017, 30, 906–918. [Google Scholar] [CrossRef]
- Király, L.; Hafez, Y.M.; Fodor, J.; Király, Z. Suppression of Tobacco mosaic virus-induced hypersensitive-type necrotization in tobacco at high temperature is associated with downregulation of NADPH oxidase and superoxide and stimulation of dehydroascorbate reductase. J. Gen. Virol. 2008, 89, 799–808. [Google Scholar] [CrossRef] [PubMed]
- Babbar, R.; Karpinska, B.; Grover, A.; Foyer, C.H. Heat-induced oxidation of the nuclei and cytosol. Front. Plant Sci. 2021, 11, 2184. [Google Scholar] [CrossRef] [PubMed]
- Xin, M.; Wang, X.; Peng, H.; Yao, Y.; Xie, C.; Han, Y.; Ni, Z.; Sun, Q. Transcriptome comparison of susceptible and resistant wheat in response to powdery mildew infection. Genom. Proteom. Bioinforma. 2012, 10, 94–106. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.-J.; Pedersen, C.; Kwaaitaal, M.; Gregersen, P.L.; Mørch, S.M.; Hanisch, S.; Kristensen, A.; Fuglsang, A.T.; Collinge, D.B.; Thordal-Christensen, H. Interaction of barley powdery mildew effector candidate CSEP0055 with the defence protein PR17c. Mol. Plant Pathol. 2012, 13, 1110–1119. [Google Scholar] [CrossRef]
- Mészáros, K.; Nagy, E.; Bányai, J.; Kunos, V.; Cséplő, M.; Decsi, É.K.; Hoffmann, S.; Hoffmann, B. Investigation of drought tolerance of barley genotypes in a sand pipe system and under field conditions. In Proceedings of the 26th Hungarian Plant Breeding Science Workshop; Bóna, L., Karsai, I., Matuz, J., Pauk, J., Polgár, Z., Veisz, O., Eds.; Journal of Plant Research (Iranian Journal of Biology): Szeged, Hungary, 2020. [Google Scholar]
- Xing, L.; Di, Z.; Yang, W.; Liu, J.; Li, M.; Wang, X.; Cui, C.; Wang, X.; Wang, X.; Zhang, R.; et al. Overexpression of ERF1-V from Haynaldia villosa can enhance the resistance of wheat to powdery mildew and increase the tolerance to salt and drought stresses. Front. Plant Sci. 2017, 8, 1948. [Google Scholar] [CrossRef] [PubMed]






| Accession Number | Gene | Sequence 5′-3′ | Amplicon Length | Primer Efficiency | |
|---|---|---|---|---|---|
| CAUH01004767 | Glyceraldehyde 3-phosphate dehydrogenase (BgGAPDH) | F | GGAGCCGAGTACATAGTAGAGT | 105 bp | 106% |
| R | GGAGGGTGCCG-AAATGATAAC | ||||
| M60175 | Ubiquitin (HvUbi) | F | ACCCTCGCCGA- CTACAACAT | 240 bp | 102% |
| R | AGTAGTGGCGGTCGAAGTG | ||||
| AJ290421 | BAX inhibitor-1 (HvBI-1) | F | ATGTTCTCGGTGCC- AGTCT | 409 bp | 101% |
| R | GGCGTGCTTGATGTAGTC | ||||
| X74940 | Pathogenesis related -1b (HvPR1-b) | F | GGACTACGACTACGGCTCCA | 150 bp | 104% |
| R | GGCTCGTAGTTGCAGGTGAT | ||||
| EU566856.1 | Respiratory burst oxidase homologue F2 (HvRBOHF2) | F | TGCTCGGTCAGCACT | 175 bp | 105% |
| R | TCCGCAATA GAACACTCC | ||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schwarczinger, I.; Kolozsváriné Nagy, J.; Király, L.; Mészáros, K.; Bányai, J.; Kunos, V.; Fodor, J.; Künstler, A. Heat Stress Pre-Exposure May Differentially Modulate Plant Defense to Powdery Mildew in a Resistant and Susceptible Barley Genotype. Genes 2021, 12, 776. https://doi.org/10.3390/genes12050776
Schwarczinger I, Kolozsváriné Nagy J, Király L, Mészáros K, Bányai J, Kunos V, Fodor J, Künstler A. Heat Stress Pre-Exposure May Differentially Modulate Plant Defense to Powdery Mildew in a Resistant and Susceptible Barley Genotype. Genes. 2021; 12(5):776. https://doi.org/10.3390/genes12050776
Chicago/Turabian StyleSchwarczinger, Ildikó, Judit Kolozsváriné Nagy, Lóránt Király, Klára Mészáros, Judit Bányai, Viola Kunos, József Fodor, and András Künstler. 2021. "Heat Stress Pre-Exposure May Differentially Modulate Plant Defense to Powdery Mildew in a Resistant and Susceptible Barley Genotype" Genes 12, no. 5: 776. https://doi.org/10.3390/genes12050776
APA StyleSchwarczinger, I., Kolozsváriné Nagy, J., Király, L., Mészáros, K., Bányai, J., Kunos, V., Fodor, J., & Künstler, A. (2021). Heat Stress Pre-Exposure May Differentially Modulate Plant Defense to Powdery Mildew in a Resistant and Susceptible Barley Genotype. Genes, 12(5), 776. https://doi.org/10.3390/genes12050776

