Next Article in Journal
Transcription Factor Action Orchestrates the Complex Expression Pattern of CRABS CLAW in Arabidopsis
Previous Article in Journal
Pairwise Correlation Analysis of the Alzheimer’s Disease Neuroimaging Initiative (ADNI) Dataset Reveals Significant Feature Correlation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regulatory Single Nucleotide Polymorphism of the Bovine IFITM3 Gene Induces Differential Transcriptional Capacities of Hanwoo and Holstein Cattle

1
Korea Zoonosis Research Institute, Jeonbuk National University, Iksan 54531, Korea
2
Department of Bioactive Material Sciences and Institute for Molecular Biology and Genetics, Jeonbuk National University, Jeonju 54896, Korea
*
Author to whom correspondence should be addressed.
Genes 2021, 12(11), 1662; https://doi.org/10.3390/genes12111662
Submission received: 2 July 2021 / Revised: 11 October 2021 / Accepted: 19 October 2021 / Published: 21 October 2021
(This article belongs to the Section Animal Genetics and Genomics)

Abstract

:
Interferon-induced transmembrane protein 3 (IFITM3), a crucial effector of the host’s innate immune system, prohibits an extensive range of viruses. Previous studies have reported that single nucleotide polymorphisms (SNPs) of the IFITM3 gene are associated with the expression level and length of the IFITM3 protein and can impact susceptibility to infectious viruses and the severity of infection with these viruses. However, there have been no studies on polymorphisms of the bovine IFITM3 gene. In the present study, we finely mapped the bovine IFITM3 gene and annotated the identified polymorphisms. We investigated polymorphisms of the bovine IFITM3 gene in 108 Hanwoo and 113 Holstein cattle using direct sequencing and analyzed genotype, allele, and haplotype frequencies and linkage disequilibrium (LD) between the IFITM3 genes of the two cattle breeds. In addition, we analyzed transcription factor-binding sites and transcriptional capacity using PROMO and luciferase assays, respectively. Furthermore, we analyzed the effect of a nonsynonymous SNP of the IFITM3 gene using PolyPhen-2, PANTHER, and PROVEAN. We identified 23 polymorphisms in the bovine IFITM3 gene and found significantly different genotype, allele, and haplotype frequency distributions and LD scores between polymorphisms of the bovine IFITM3 gene in Hanwoo and Holstein cattle. In addition, the ability to bind the transcription factor Nkx2-1 and transcriptional capacities were significantly different depending on the c.-193T > C allele. Furthermore, nonsynonymous SNP (F121L) was predicted to be benign. To the best of our knowledge, this is the first genetic study of bovine IFITM3 polymorphisms.

1. Introduction

Interferon-induced transmembrane protein 3 (IFITM3), a downstream effector of the interferon signal pathway in the host innate immune system, plays a protective role against several kinds of infectious viruses, including influenza A viruses (IAVs), Ebola virus (EBOV), Marburg virus (MARV), severe acute respiratory syndrome coronavirus (SARS-CoV), dengue virus (DEV), West Nile virus (WNV), Zika virus (ZIKV), foot-and-mouth disease virus (FMDV), African swine fever virus (ASFV), and SARS-CoV-2 [1,2,3,4,5,6]. Although the length and topology of the IFITM3 protein differ slightly among species, the antiviral capacity of the IFITM3 protein is related to the CD225 domain, which is well conserved between species and significantly correlated with the expression level and integrity of the IFITM3 protein [7,8,9,10,11].
In a previous study, a splicing variant inducing the single nucleotide polymorphism (SNP) rs12252 was shown to be associated with the severity of pandemic influenza A 2009 virus infection. The C allele of the rs12252 SNP was suggested to generate a truncated isoform of the IFITM3 protein (Δ21 IFITM3) and reduce antiviral capacity [3,12]. In addition, the rs34481144 SNP, which is located on exon 1 of the IFITM3 gene, was found to be related to a mechanism by which the transcription of the IFITM3 gene is downregulated [13,14]. An allele inducing transcriptional variation was shown to cause the severity of pandemic influenza A 2009 virus infection. Furthermore, rs6598045 SNP, which is located on the proximal promoter region of the IFITM3 gene, is correlated with a mechanism by which transcription of the IFITM3 gene is regulated [1]. Susceptibility to pandemic influenza A 2009 virus infection was significantly increased with the T allele of the SNP rs6598045, and a difference in transcriptional capacity was also detected. In chicken, the c.298C > A (L100M) SNP was found to induce a variation in the topology of the IFITM3 protein and increased the length of transmembrane domain 2 (TM2) [2]. In addition, the IFITM3 gene is expressed in primordial germ cells (PGCs), and IFITM3 protein plays a pivotal role in germline development via PGCs localization [15]. However, although several polymorphisms of the IFITM3 gene in various species are strongly associated with antiviral capacity and genetic features of the IFITM3 protein, polymorphisms of the bovine IFITM3 gene have not been investigated thus far.
In the present study, we investigated the bovine IFITM3 gene in Hanwoo and Holstein cattle by using direct sequencing and compared the genotype and allele frequencies of the IFITM3 gene in the two cattle breeds. In addition, we analyzed linkage disequilibrium (LD) and haplotype frequency of polymorphisms of the bovine IFITM3 gene. We also assessed differences in a transcription factor-binding site and transcriptional capacity based on an allele of the IFITM3 gene with a regulatory SNP using PROMO and luciferase assays, respectively [16]. Furthermore, we annotated the effect of a nonsynonymous SNP of the IFITM3 gene using PolyPhen-2, PANTHER, and PROVEAN [17,18,19].

2. Materials and Methods

2.1. Ethical Statement

Tissue samples from 221 cattle of 2 breeds (108 Hanwoo and 113 Holstein cattle) were provided from slaughterhouses in the Republic of Korea. All experimental procedures were approved by the Institute of Animal Care and Use Committee of Chonbuk National University (CBNU 2018-079).

2.2. Genetic Analysis of the IFITM3 Gene

Genomic DNA was extracted from 20 mg of brain tissue sample using a HiYield genomic DNA mini kit (Real Biotech Corporation, Banqiao Taiwan). Polymerase chain reaction (PCR) was carried out to amplify the bovine IFITM3 gene using BioFACT™ Taq DNA Polymerase (BioFACT, Daejeon, Korea). Information on bovine IFITM3 gene-specific primers and experimental conditions is provided in Table 1. The PCR mixture contained 2.5 µL of 10× Taq DNA polymerase reaction buffer, 1 µL of genomic DNA, 10 pmol of each primer, 0.5 µL of a 0.2 µM dNTP mixture, 0.2 µL of 0.04 units of Taq DNA polymerase, and sterile deionized water in a total volume of 25 µL. PCR amplicons were directly sequenced by using an ABI 3730 sequencer (ABI, Foster City, California, USA), and sequencing electropherograms were visualized by using Finch TV software (Geospiza, Inc., Seattle, WA, USA).

2.3. In Silico Analysis

PROMO was utilized to analyze transcription factor-binding sites. Two major haplotypes based on alleles containing regulatory SNPs in the proximal promoter sequences of the IFITM3 gene were inputted and analyzed. The effect of the polymorphisms of the bovine IFITM3 gene was evaluated by PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/ (accessed on 3 March 2021)), PANTHER (http://www.pantherdb.org/ (accessed on 3 March 2021)), PROVEAN (http://provean.jcvi.org/index.php (accessed on 3 March 2021)), and AMYCO (http://bioinf.uab.es/amycov04/ (accessed on 3 March 2021)).

2.4. Cell Culture

Embryonic bovine tracheal (EBtr) cells were provided by the Korea Cell Line Bank and maintained in Eagle’s minimum essential medium (ATCC, Manassas, VA, USA). In order to prepare the complete growth medium, 10% (v/v) fetal bovine serum (Gibco, Gaithersburg, MD, USA) was added. EBtr cells were cultured at 37°C in a humidified atmosphere of 5% CO2 (v/v) in air.

2.5. Plasmids and Luciferase Assay

The promoter sequences based on alleles of the IFITM3 gene were synthesized and inserted into the pGL4.10 [luc2] vector (Promega, Fitchburg, WI, USA). Plasmid construction and preparation followed standard protocols. The plasmids were transfected using Lipofectamine (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The transfected cells were incubated for 30 h, and the promoter activity of the IFITM3 gene was measured with a Glomax 20/20 luminometer (Promega, Fitchburg, WI, USA) using a luciferase assay system (Promega, Fitchburg, WI, USA).

2.6. Statistical Analysis

Statistical analyses were performed using SAS version 9.4 (July 2013, SAS Institute, Inc., Cary, NC, USA). The differences in genotype and allele frequencies of the IFITM3 gene between cattle breeds were compared using the χ2 test. The Hardy–Weinberg equilibrium (HWE) test and haplotype and LD analyses of 23 polymorphisms of the bovine IFITM3 gene were performed using Haploview version 4.2 (September 2009, Broad Institute, Cambridge, MA, USA). Luciferase assays were carried out in three independent experiments, and statistical significance was determined by p-value calculated by two-tailed Student’s t-test for single comparisons. The symbol “***” indicates p < 0.001.

3. Results

3.1. Identification of Polymorphisms of the Bovine IFITM3 Gene

In order to investigate polymorphisms of the bovine IFITM3 gene, we performed direct sequencing with IFITM3 gene-specific primers in 108 Hanwoo and 113 Holstein cattle (Table 1). We identified a total of 23 polymorphisms of the bovine IFITM3 gene, including 1 nonsynonymous SNP (c.361T > C, p.Phe121Leu) and 2 insertion/deletion polymorphisms (c.249+350_351delCA and c.249+395delG) (Figure 1).

3.2. Comparison of Genotype and Allele Frequencies of Polymorphisms of the Bovine IFITM3 Gene among Cattle Breeds

We investigated the differences in allele and genotype frequencies of the bovine IFITM3 gene between Hanwoo and Holstein cattle. In brief, a total of 19 polymorphisms showed significantly different genotype and allele distributions between Hanwoo and Holstein cattle: c.-193T > C, c.249+36G > C, c.249+39T > G, c.249+320G > C, c.249+350_351delCA, c.249+359G > A, c.249+367G > A, c.249+372C > T, c.249+395delG, c.249+398G > C, c.249+399C > A, c.249+400A > G, c.249+401G > T, c.249+402T > G, c.249+405G > A, c.249+455G > T, c.249+472G > C, c.361T > C and c.396C > T. Among the 23 polymorphisms, the c.136C > T, c.249+350_351delCA, c.249+372C > T, c.249+395delG, c.249+455G > T, and c.249+472G > C polymorphisms were specific to Hanwoo cattle. In addition, the c.249+320G > C, c.249+64C > A, c.249+359G > A, and c.396C > T polymorphisms were specific to Holstein cattle (Table 2).

3.3. LD and Haplotype Analyses of the Bovine IFITM3 Gene

Since breed-specific polymorphisms were identified, we carried out LD analysis of the 23 polymorphisms of the bovine IFITM3 gene in Hanwoo and Holstein cattle. The LD scores for the Hanwoo and Holstein cattle are shown in Table 3 and Table 4, respectively. In brief, 27 high LD scores were identified in Hanwoo cattle, including two Hanwoo-specific LD scores (between c.249+320G > C and c.249+367G > A and between c.249+395delG and c.249+472G > C). In addition, 26 high LD scores were identified in Holstein cattle, including one Holstein-specific LD score (between c.105C > G and c.249+32G > C).
We also examined the haplotype distribution of the 23 polymorphisms of the bovine IFITM3 gene in Hanwoo and Holstein cattle. Detailed information on the haplotype distributions of bovine IFITM3 gene polymorphisms in Hanwoo and Holstein cattle is provided in Table 5 and Table 6, respectively. In summary, a total of 12 major haplotypes were identified in Hanwoo cattle (Table 5). Among the 12 haplotypes, the TCCGCGCGWtGGCWtGCAGTGGGCC haplotype had the highest frequency (14.8%), followed by the CCCGGTCGWtGGCWtGCAGTGGGCC (11.6%) and CCCGGTCGDelGACWtCAGTGAGGTC (7.9%) haplotypes. In Holstein cattle, a total of six major haplotypes were identified (Table 6). Among these six haplotypes, the TCCGCGCGWtGGCWtGCAGTGGGCC haplotype had the highest frequency (43.4%), followed by the CCCGGTCGWtGGCWtGCAGTGGGCC (16.4%) and TCCGCGCGWtAGCWtGCAGTGGGCC (9.7%) haplotypes.

3.4. The Transcription Factor-Binding Capacity of the Bovine IFITM3 Gene

We found two regulatory SNPs in the proximal promoter region of the bovine IFITM3 gene, and c.-193T > C showed significantly different genotypes and allele distributions in Hanwoo and Holstein cattle (Table 2). We analyzed the transcription factor-binding capacity of the bovine IFITM3 gene according to the c.-193T > C alleles using PROMO. Interestingly, the haplotype with the T allele and the haplotype with the C allele differed in their ability to bind transcription factor Nkx2-1 (Figure 2).

3.5. Promoter Activities Based on Alleles of Regulatory SNPs in the Proximal Promoter Region of the Bovine IFITM3 Gene

We investigated the differences in promoter activity according to the alleles of promoter SNPs, which showed different genotype and allele frequencies in Hanwoo and Holstein cattle (Table 2). The T-type promoter, which contained the T allele of c.-193T > C, was more prevalent in Hanwoo cattle. The C-type promoter, which contained the C allele of c.-193T > C, was more prevalent in Holstein cattle. Notably, the C-type promoter significantly increased the expression level of mRNA compared to that of the T-type promoter (Figure 3).

3.6. In Silico Annotation of a Nonsynonymous SNP of the Bovine IFITM3 Gene

The impact of the nonsynonymous SNP c.361T > C (F121L) of the bovine IFITM3 gene identified in this study was analyzed by PolyPhen-2, PANTHER, and PROVEAN. Notably, the F121L mutation was predicted to be benign by all three programs (Table 7).

4. Discussion

Previous studies have reported that overexpression of the IFITM3 protein inhibits an extensive range of viruses under experimental conditions [20,21,22]. This propensity has been consistently reported under natural conditions. The duck species that are known to be resistant to avian influenza virus showed elevated expressions of the IFITM3 protein compared to that in the chicken species that are known to be susceptible to avian influenza virus. In addition, the genetic polymorphisms of Ross chickens, a kind of broiler, were significantly different from those of Dekalb White chickens, a kind of layer. Broilers show more resistance to viral infection than layers, a notable feature of the IFITM3 gene [2]. In humans, the SNPs rs34481144 and rs6598045 of the human IFITM3 gene, which are related to the modulated expression of this gene, showed prominent associations with the severity and susceptibility of pandemic influenza A 2009 virus infection, respectively [1,13,14]. In addition, the SNP rs12252, which influences the length of the IFITM3 protein, was found to be related to susceptibility to pandemic influenza A 2009 virus infection. Furthermore, recent studies have reported that the IFITM3 protein is also involved in not only immune-related functions but also embryogenesis and feed efficiency [15,23].
Thus, in the present study, we investigated polymorphisms of the bovine IFITM3 gene, which can affect the expression level or function of the IFITM3 protein. We found a total of 23 polymorphisms in the bovine IFITM3 gene. In addition, Hanwoo and Holstein cattle showed significantly different genotype and allele frequencies and breed-specific polymorphisms (Table 2). The LD scores and haplotype frequencies of the polymorphisms also showed different distributions between the two cattle breeds (Table 3, Table 4, Table 5 and Table 6). These results indicate that the IFITM3 genes in Hanwoo and Holstein cattle have significantly different genetic properties, including genotype, allele, and haplotype frequencies and LD scores. In addition, we annotated a regulatory SNP (c.-193T > C) and a nonsynonymous SNP (c.361T > C, F121L) of the bovine IFITM3 gene. Strikingly, the C-type haplotype with the C allele of c.-193T > C and the T-type haplotype with the T allele of c.-193T > C differed in their ability to bind transcription factor Nkx2-1, and the C-type haplotype exhibited elevated expression of the IFITM3 gene compared to the T-type haplotype (Figure 3). Since the T allele is frequently observed in Holstein cattle while the C allele is frequently observed in Hanwoo cattle, this result suggests a significant difference in the expression of the bovine IFITM3 gene between the cattle breeds. Indeed, Nkx2-1, a member of the Nkx-homeodomain factor family, is related to the regulation of organ development. In addition, Nkx2-1 is associated with several diseases, including benign hereditary chorea, choreoathetosis, congenital hypothyroidism, and neonatal respiratory distress. Furthermore, Nkx2-1 has a function in organ development, and it is involved in morphogenesis [24,25]. Since the IFITM3 protein is also related to cellular developmental processes, further investigation of the relationship between IFITM3 and Nkx2-1 is highly desirable in the future. We also annotated a nonsynonymous SNP (c.361T > C, F121L) by using in silico annotation tools. The F121L mutation was predicted to be benign (Table 7). Since several viruses have been reported to be associated with the IFITM3 gene, future study of the characterization of the bovine IFITM3 gene in other local cattle breeds is highly desirable.

5. Conclusions

In conclusion, we finely mapped the bovine IFITM3 gene and annotated regulatory and nonsynonymous SNPs. We identified 23 polymorphisms of the bovine IFITM3 gene and significantly different genotype, allele, and haplotype distributions and LD scores for these polymorphisms of the bovine IFITM3 gene between Hanwoo and Holstein cattle. In addition, transcription factor-binding ability and transcriptional capacity were significantly different depending on regulatory SNP alleles. A nonsynonymous SNP (F121L) was predicted to be benign. To the best of our knowledge, this is the first genetic report of bovine IFITM3 polymorphisms.

Author Contributions

Y.-C.K. and B.-H.J. conceived and designed the experiments. Y.-C.K. and M.-J.J. performed the experiments. Y.-C.K., M.-J.J. and B.-H.J. analyzed the data. Y.-C.K. and B.-H.J. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Basic Science Program through the National Research Foundation (NRF) of Korea funded by the Ministry of Education, Science, and Technology (2021R1A2C1013213). This research was supported by the Basic Science Research Program through the National Research Foundation (NRF) of Korea funded by the Ministry of Education (2017R1A6A1A03015876).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available on reasonable request. Requests may be made to bhjeong@jbnu.ac.kr.

Acknowledgments

This work was supported by a grant from the NRF (National Research Foundation of Korea) funded by the Korean Government (NRF-2019-Fostering Core Leaders of the Future Basic Science Program/Global Ph.D. Fellowship Program).

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

IFITM3Interferon-induced transmembrane protein 3
SNPsSingle nucleotide polymorphisms
LDLinkage disequilibrium
IAVsInfluenza A viruses
EBOVEbola virus
MARVMarburg virus
SARS-CoVSevere acute respiratory syndrome coronavirus
DEVDengue virus
WNVWest Nile virus
ZIKVZika virus
FMDVFoot-and-mouth disease virus
ASFVAfrican swine fever virus
COVID-19Coronavirus disease 2019

References

  1. Kim, Y.C.; Jeong, M.J.; Jeong, B.H. Strong association of regulatory single nucleotide polymorphisms (SNPs) of the IFITM3 gene with influenza H1N1 2009 pandemic virus infection. Cell. Mol. Immunol. 2020, 17, 662–664. [Google Scholar] [CrossRef]
  2. Kim, Y.C.; Jeong, M.J.; Jeong, B.H. Genetic characteristics and polymorphisms in the chicken interferon-induced transmembrane protein (IFITM3) gene. Vet. Res. Commun. 2019, 43, 203–214. [Google Scholar] [CrossRef]
  3. Everitt, A.R.; Clare, S.; Pertel, T.; John, S.P.; Wash, R.S.; Smith, S.E.; Chin, C.R.; Feeley, E.M.; Sims, J.S.; Adams, D.J.; et al. IFITM3 restricts the morbidity and mortality associated with influenza. Nature 2012, 484, 519–523. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Kim, Y.C.; Jeong, B.H. Strong Correlation between the Case Fatality Rate of COVID-19 and the rs6598045 Single Nucleotide Polymorphism (SNP) of the Interferon-Induced Transmembrane Protein 3 (IFITM3) Gene at the Population-Level. Genes 2020, 12, 42. [Google Scholar] [CrossRef] [PubMed]
  5. Kim, Y.C.; Jeong, B.H. Ethnic variation in risk genotypes based on single nucleotide polymorphisms (SNPs) of the interferon-inducible transmembrane 3 (IFITM3) gene, a susceptibility factor for pandemic 2009 H1N1 influenza A virus. Immunogenetics 2020, 72, 447–453. [Google Scholar] [CrossRef]
  6. Xu, J.; Qian, P.; Wu, Q.; Liu, S.; Fan, W.; Zhang, K.; Wang, R.; Zhang, H.; Chen, H.; Li, X. Swine interferon-induced transmembrane protein, sIFITM3, inhibits foot-and-mouth disease virus infection in vitro and in vivo. Antiviral. Res. 2014, 109, 22–29. [Google Scholar] [CrossRef] [PubMed]
  7. Zani, A.; Yount, J.S. Antiviral Protection by IFITM3 In Vivo. Curr. Clin. Microbiol. Rep. 2018, 5, 229–237. [Google Scholar] [CrossRef] [Green Version]
  8. Bedford, J.G.; O’Keeffe, M.; Reading, P.C.; Wakim, L.M. Rapid interferon independent expression of IFITM3 following T cell activation protects cells from influenza virus infection. PLoS ONE 2019, 14, e0210132. [Google Scholar] [CrossRef]
  9. John, S.P.; Chin, C.R.; Perreira, J.M.; Feeley, E.M.; Aker, A.M.; Savidis, G.; Smith, S.E.; Elia, A.E.; Everitt, A.R.; Vora, M.; et al. The CD225 domain of IFITM3 is required for both IFITM protein association and inhibition of influenza A virus and dengue virus replication. J. Virol. 2013, 87, 7837–7852. [Google Scholar] [CrossRef] [Green Version]
  10. Kim, Y.C.; Jeong, B.H. Genetic association between the rs12252 SNP of the Interferon-Induced transmembrane protein gene and Influenza A Virus Infection in the Korean population. Mol. Cell. Toxicol. 2021, 17, 51–57. [Google Scholar] [CrossRef]
  11. Kim, Y.C.; Jeong, B.H. No Correlation of the Disease Severity of Influenza A Virus Infection with the rs12252 Polymorphism of the Interferon-Induced Transmembrane Protein 3 Gene. Intervirology 2017, 60, 69–74. [Google Scholar] [CrossRef]
  12. Zhang, Y.H.; Zhao, Y.; Li, N.; Peng, Y.C.; Giannoulatou, E.; Jin, R.H.; Yan, H.P.; Wu, H.; Liu, J.H.; Liu, N.; et al. Interferon-induced transmembrane protein-3 genetic variant rs12252-C is associated with severe influenza in Chinese individuals. Nat. Commun. 2013, 4, 1418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Allen, E.K.; Randolph, A.G.; Bhangale, T.; Dogra, P.; Ohlson, M.; Oshansky, C.M.; Zamora, A.E.; Shannon, J.P.; Finkelstein, D.; Dressen, A.; et al. SNP-mediated disruption of CTCF binding at the IFITM3 promoter is associated with risk of severe influenza in humans. Nat. Med. 2017, 23, 975–983. [Google Scholar] [CrossRef]
  14. David, S.; Correia, V.; Antunes, L.; Faria, R.; Ferrao, J.; Faustino, P.; Nunes, B.; Maltez, F.; Lavinha, J.; Rebelo de Andrade, H. Population genetics of IFITM3 in Portugal and Central Africa reveals a potential modifier of influenza severity. Immunogenetics 2018, 70, 169–177. [Google Scholar] [CrossRef]
  15. Tanaka, S.S.; Yamaguchi, Y.L.; Tsoi, B.; Lickert, H.; Tam, P.P. IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct roles in mouse primordial germ cell homing and repulsion. Dev. Cell 2005, 9, 745–756. [Google Scholar] [CrossRef]
  16. Messeguer, X.; Escudero, R.; Farre, D.; Nunez, O.; Martinez, J.; Alba, M.M. PROMO: Detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 2002, 18, 333–334. [Google Scholar] [CrossRef]
  17. Adzhubei, I.; Jordan, D.M.; Sunyaev, S.R. Predicting functional effect of human missense mutations using PolyPhen-2. Curr. Protoc. Hum. Genet. 2013, 7, 7–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Tang, H.; Thomas, P.D. PANTHER-PSEP: Predicting disease-causing genetic variants using position-specific evolutionary preservation. Bioinformatics 2016, 32, 2230–2232. [Google Scholar] [CrossRef] [PubMed]
  19. Choi, Y.; Chan, A.P. PROVEAN web server: A tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics 2015, 31, 2745–2747. [Google Scholar] [CrossRef] [Green Version]
  20. Xuan, Y.; Wang, L.N.; Li, W.; Zi, H.R.; Guo, Y.; Yan, W.J.; Chen, X.B.; Wei, P.M. IFITM3 rs12252 T>C polymorphism is associated with the risk of severe influenza: A meta-analysis. Epidemiol. Infect. 2015, 143, 2975–2984. [Google Scholar] [CrossRef] [PubMed]
  21. Lee, N.; Cao, B.; Ke, C.; Lu, H.; Hu, Y.; Tam, C.H.T.; Ma, R.C.W.; Guan, D.; Zhu, Z.; Li, H.; et al. IFITM3, TLR3, and CD55 Gene SNPs and Cumulative Genetic Risks for Severe Outcomes in Chinese Patients With H7N9/H1N1pdm09 Influenza. J. Infect. Dis. 2017, 216, 97–104. [Google Scholar] [CrossRef]
  22. Weidner, J.M.; Jiang, D.; Pan, X.B.; Chang, J.; Block, T.M.; Guo, J.T. Interferon-induced cell membrane proteins, IFITM3 and tetherin, inhibit vesicular stomatitis virus infection via distinct mechanisms. J. Virol. 2010, 84, 12646–12657. [Google Scholar] [CrossRef] [Green Version]
  23. Kern, R.J.; Lindholm-Perry, A.K.; Freetly, H.C.; Snelling, W.M.; Kern, J.W.; Keele, J.W.; Miles, J.R.; Foote, A.P.; Oliver, W.T.; Kuehn, L.A.; et al. Transcriptome differences in the rumen of beef steers with variation in feed intake and gain. Gene 2016, 586, 12–26. [Google Scholar] [CrossRef] [PubMed]
  24. Minoo, P.; Su, G.; Drum, H.; Bringas, P.; Kimura, S. Defects in tracheoesophageal and lung morphogenesis in Nkx2.1(-/-) mouse embryos. Dev. Biol. 1999, 209, 60–71. [Google Scholar] [CrossRef] [Green Version]
  25. Yuan, B.; Li, C.; Kimura, S.; Engelhardt, R.T.; Smith, B.R.; Minoo, P. Inhibition of distal lung morphogenesis in Nkx2.1(-/-) embryos. Dev. Dyn. 2000, 217, 180–190. [Google Scholar] [CrossRef]
Figure 1. Gene map and polymorphisms of the bovine interferon-induced transmembrane protein 3 (IFITM3) gene on chromosome 29. The open reading frames (ORFs) in exon 1 and exon 2 are marked with black blocks, and white blocks represent the 5′ and 3′ untranslated regions (UTRs). The outlined horizontal bars indicate the sequenced regions. The 23 novel polymorphisms found in this study are indicated by arrows above the gene.
Figure 1. Gene map and polymorphisms of the bovine interferon-induced transmembrane protein 3 (IFITM3) gene on chromosome 29. The open reading frames (ORFs) in exon 1 and exon 2 are marked with black blocks, and white blocks represent the 5′ and 3′ untranslated regions (UTRs). The outlined horizontal bars indicate the sequenced regions. The 23 novel polymorphisms found in this study are indicated by arrows above the gene.
Genes 12 01662 g001
Figure 2. Analysis of the transcription factor-binding abilities of 2 haplotypes of the proximal promoter sequence of the bovine IFITM3 gene. (A) The transcription factor-binding site according to c.-193T > C allele. Red boxes and arrows indicate differences in the transcription-binding sites of the haplotype of -193T > C with the T allele and the haplotype of -193T > C with the C allele. (B) Magnified view of the locus containing c.-193T > C region showing differences in Nkx2-1 binding between the haplotype with the T allele of -193T > C and the haplotype with the C allele of -193T > C.
Figure 2. Analysis of the transcription factor-binding abilities of 2 haplotypes of the proximal promoter sequence of the bovine IFITM3 gene. (A) The transcription factor-binding site according to c.-193T > C allele. Red boxes and arrows indicate differences in the transcription-binding sites of the haplotype of -193T > C with the T allele and the haplotype of -193T > C with the C allele. (B) Magnified view of the locus containing c.-193T > C region showing differences in Nkx2-1 binding between the haplotype with the T allele of -193T > C and the haplotype with the C allele of -193T > C.
Genes 12 01662 g002
Figure 3. Promoter activity of the bovine IFITM3 gene. Promoter activities of the bovine IFITM3 gene with 2 promoter types. The symbol “***”, indicates p < 0.001. RLUs indicate relative luciferase light units. NC indicates negative control.
Figure 3. Promoter activity of the bovine IFITM3 gene. Promoter activities of the bovine IFITM3 gene with 2 promoter types. The symbol “***”, indicates p < 0.001. RLUs indicate relative luciferase light units. NC indicates negative control.
Genes 12 01662 g003
Table 1. Detailed information on specific primer sets used for polymerase chain reaction (PCR).
Table 1. Detailed information on specific primer sets used for polymerase chain reaction (PCR).
Name Size Annealing Temperature
F1_FGGCATTTAACGGGTGGATTCAG774 bp62 °C
F1_RCATGCAGCAGAACAACACACA
F2_FGCCAGAGAAAGGATGGGAGA692 bp61 °C
F2_RTGAAGGACAGTGACGAGAGG
Table 2. Genotype and allele frequencies of bovine IFITM3 gene polymorphisms in two cattle breeds.
Table 2. Genotype and allele frequencies of bovine IFITM3 gene polymorphisms in two cattle breeds.
PolymorphismBreedGenotype Frequency, n (%)p-ValueAllele Frequency, n (%)p-ValueHWE
c.-193C > T CCCTTT CT
Hanwoo72 (66.67)34 (31.48)2 (1.85)<0.0001178 (82.41)38 (17.59)<0.00010.3729
Holstein11 (9.73)46 (40.71)56 (49.56) 68 (30.09)158 (69.91) 0.7306
c.-136C > T CCCTTT CT
Hanwoo107 (99.07)1 (0.93)0 (0)0.4887215 (99.54)1 (0.46)0.48870.9614
Holstein113 (100)0 (0)0 (0) 226 (100)0 (0) 0
c.105C > G CCCGGG CG
(p.Pro35Pro)Hanwoo107 (99.07)1 (0.93)0 (0)1.0215 (99.54)1 (0.46)1.00.9614
Holstein111 (98.23)2 (1.77)0 (0) 224 (99.12)2 (0.88) 0.9244
c.249+32G > C GGGCCC GC
Hanwoo108 (100)0 (0)0 (0)1.0216 (100)0 (0)1.00
Holstein112 (99.12)1 (0.88)0 (0) 225 (99.56)1 (0.44) 0.9623
c.249+36G > C GGGCCC GC
Hanwoo41 (37.96)50 (46.3)17 (15.74)<0.0001132 (61.11)84 (38.89)<0.00010.7872
Holstein12 (10.62)45 (39.82)56 (49.56) 69 (30.53)157 (69.47) 0.5153
c.249+39T > G TTTGGG TG
Hanwoo41 (37.96)50 (46.3)17 (15.74)<0.0001132 (61.11)84 (38.89)<0.00010.7872
Holstein12 (10.62)45 (39.82)56 (49.56) 69 (30.53)157 (69.47) 0.5153
c.249+64C > A CCCAAA CA
Hanwoo108 (100)0 (0)0 (0)1.0216 (100)0 (0)1.00
Holstein112 (99.12)1 (0.88)0 (0) 225 (99.56)1 (0.44) 0.9623
c.249+320G > C GGGCCC GC
Hanwoo67 (62.04)40 (37.04)1 (0.92)<0.0001174 (80.56)42 (19.44)<0.00010.0582
Holstein103 (91.15)10 (8.85)0 (0) 216 (95.58)10 (4.42) 0.6226
c.249+350_351delCA WT/WTWT/DELDEL/DEL WTDEL
Hanwoo77 (71.3)31 (28.7)0 (0)<0.0001185 (85.65)31 (14.35)<0.00010.0816
Holstein113 (100)0 (0)0 (0) 226 (100)0 (0) 0
c.249+359G > A GGGAAA GA
Hanwoo108 (100)0 (0)0 (0)<0.0001216 (100)0 (0)<0.00010
Holstein74 (65.49)39 (34.51)0 (0) 187 (82.74)39 (17.26) 0.0401
c.249+367G > A GGGAAA GA
Hanwoo22 (20.37)85 (78.7)1 (0.93)<0.0001129 (59.72)87 (40.28)<0.0001p < 0.0001
Holstein82 (72.57)31 (27.43)0 (0) 195 (86.28)31 (13.72) 0.091
c.249+372C > T CCCTTT CT
Hanwoo81 (75)26 (24.07)1 (0.93)<0.0001188 (87.04)28 (12.96)<0.00010.4871
Holstein113 (100)0 (0)0 (0) 226 (100)0 (0) 0
c.249+395delG WT/WTWT/DELDEL/DEL WTDEL
Hanwoo90 (83.33)18 (16.67)0 (0)<0.0001198 (91.67)18 (8.33)<0.00010.3448
Holstein113 (100)0 (0)0 (0) 226 (100)0 (0) 0
c.249+398G > C GGGCCC GC
Hanwoo15 (13.89)91 (84.26)2 (1.85)<0.0001121 (56.02)95 (43.98)<0.0001p < 0.0001
Holstein76 (67.26)37 (32.74)0 (0) 189 (83.63)37 (16.37) 0.0374
c.249+399C > A CCCAAA CA
Hanwoo12 (11.11)96 (88.89)0 (0)<0.0001120 (55.56)96 (44.44)<0.0001p < 0.0001
Holstein86 (76.11)27 (23.89)0 (0) 199 (88.05)27 (11.95) 0.1492
c.249+400A > G AAAGGG AG
Hanwoo27 (25)81 (75)0 (0)<0.0001135 (62.5)81 (37.5)<0.0001p < 0.0001
Holstein89 (78.76)24 (21.24)0 (0) 202 (89.38)24 (10.62) 0.2066
c.249+401G > T GGGTTT GT
Hanwoo26 (24.07)82 (75.93)0 (0)<0.0001134 (62.04)82 (37.96)<0.0001p < 0.0001
Holstein88 (77.88)25 (22.12)0 (0) 201 (88.94)25 (11.06) 0.1861
c.249+402T > G TTTGGG TG
Hanwoo21 (19.44)87 (80.56)0 (0)<0.0001129 (59.72)87 (40.28)<0.0001p < 0.0001
Holstein85 (75.22)28 (24.78)0 (0) 198 (87.61)28 (12.39) 0.1328
c.249+405G > A GGGAAA GA
Hanwoo12 (11.11)92 (85.19)4 (3.7)<0.0001116 (53.7)100 (46.3)<0.0001p < 0.0001
Holstein80 (70.8)33 (29.2)0 (0) 193 (85.4)33 (14.6) 0.691
c.249+455G > T GGGTTT GT
Hanwoo31 (28.7)67 (62.04)10 (9.26)<0.0001129 (59.72)87 (40.28)<0.00010.0026
Holstein113 (100)0 (0)0 (0) 226 (100)0 (0) 0
c.249+472G > C GGGCCC GC
Hanwoo83 (76.85)25 (23.15)0 (0)<0.0001191 (88.43)25 (11.57)<0.00010.1738
Holstein113 (100)0 (0)0 (0) 226 (100)0 (0) 0
c.361T > C TTTCCC TC
(p.Phe121Leu)Hanwoo39 (36.11)46 (42.59)23 (21.3)<0.0001124 (57.41)92 (42.59)<0.00010.1799
Holstein0 (0)14 (12.39)99 (87.61) 14 (6.19)212 (93.81) 0.4827
c.396C > T CCCTTT CT
(p.Ile132Ile)Hanwoo108 (100)0 (0)0 (0)<0.01216 (100)0 (0)<0.010
Holstein103 (91.15)10 (8.85)0 (0) 216 (95.58)10 (4.42) 0.6226
Table 3. Linkage disequilibrium (LD) scores among 23 polymorphisms of the bovine IFITM3 gene in Hanwoo.
Table 3. Linkage disequilibrium (LD) scores among 23 polymorphisms of the bovine IFITM3 gene in Hanwoo.
P1P2P3P4P5P6P7P8P9P10P11P12P13P14P15P16P17P18P19P20P21P22P23
P1-----------------------
P20.022----------------------
P30.0010---------------------
P4-----------------------
P50.3350.0070.003--------------------
P60.3350.0070.003-1------------------
P7-----------------------
P80.0010.0190.019-0.0010.001-----------------
P90.0360.0010.001-0.1070.107-0---------------
P10-----------------------
P110.0720.0070.007-0.0440.044-0.358 *0.156--------------
P120.0320.0010.001-0.0950.095-0.0360.268-0.131------------
P130.01900-0.1430.143-0.0220.015-0.0610.013-----------
P140.1680.0060.006-0.0910.091-0.1750.132-0.6340.0440.071----------
P150.1710.0060.006-0.0810.081-0.2560.209-0.730.0840.0730.907---------
P160.1280.0080.008-0.0560.056-0.3180.234-0.7750.1210.0550.6510.75--------
P170.1310.0080.008-0.0580.058-0.3110.229-0.7920.1160.0560.6660.7650.98-------
P180.1440.0070.007-0.050.05-0.2730.248-0.7710.1310.0610.7460.8430.890.907------
P190.1260.0060.005-0.1210.121-0.2340.194-0.7080.1230.0780.7990.8910.6960.710.745-----
P200.1110.0070.003-0.0010.001-0.1110.248-0.2480.1770.1020.2120.3040.3210.3290.3320.236----
P210.0280.0010.001-00-0.0320.012-0.0880.1390.306 *0.1030.1050.0790.080.0880.0280.194---
P220.2260.0060.006-0.2630.263-0.0380.101-0.0010.1110.0670.0160.0140.0070.0070.0120.0280.240.097--
P23-----------------------
P1: c.-193T > C; P2: c.-136C > T; P3: c.105C > G; P4: c.249+32G > C; P5: c.249+36G > C; P6: c.249+39T > G; P7: c.249+64C > A; P8: c.249+320G > C; P9: c.249+350_351delCA; P10: c.249+359G > A; P11: c.249+367G > A; P12: c.249+372C > T; P13: c.249+395delG; P14: c.249+398G > C; P15: c.249+399C > A; P16: c.249+400A > G; P17: c.249+401G > T; P18: c.249+402T > G; P19: c.249+405G > A; P20: c.249+455G > T; P21: c.249+472G > C; P22: c.361T > C; P23: c.396C > T. Bold text indicates strong LD with > 0.3 value. * indicate Hanwoo-specific strong LD scores.
Table 4. Linkage disequilibrium (LD) scores among 23 polymorphisms of the bovine IFITM3 gene in Holstein cattle.
Table 4. Linkage disequilibrium (LD) scores among 23 polymorphisms of the bovine IFITM3 gene in Holstein cattle.
P1P2P3P4P5P6P7P8P9P10P11P12P13P14P15P16P17P18P19P20P21P22P23
P1-----------------------
P2-----------------------
P30.021----------------------
P40.01-0.498 *--------------------
P50.897-0.020.01-------------------
P60.897-0.020.011------------------
P70.002-000.0020.002-----------------
P80.01-000.0120.0120----------------
P9-----------------------
P100.04-0.0020.0010.0440.0440.0210.01-- ------------
P110.008-0.0060.0280.0090.0090.0280.22-0.005-------------
P12-----------------------
P13-----------------------
P140.018-0.0020.0010.0210.0210.0010.175-0.0110.568------------
P150.013-0.0010.0010.0140.0140.0010.261-0.0010.709--0.693---------
P160.021-0.0010.0010.0220.0220.0010.301-0.0020.604--0.6070.876--------
P170.024-0.0010.0010.0250.0250.0010.287-00.571--0.6350.8340.867-------
P180.03-0.0010.0010.0320.0320.0010.25-00.61--0.5970.8790.840.799------
P190.005-0.0050.0260.0060.0060.0010.203-0.0010.726--0.5720.6560.5580.5260.562-----
P20-----------------------
P21-----------------------
P220.065-0.00100.0630.06300.001-0.0140.01--0.0120.0090.0080.0080.0090.011----
P230.001-000.0010.00100.002-0.0020.007--0.0090.0060.0060.0060.0070.008----
P1: c.-193T > C; P2: c.-136C > T; P3: c.105C > G; P4: c.249+32G > C; P5: c.249+36G > C; P6: c.249+39T > G; P7: c.249+64C > A; P8: c.249+320G > C; P9: c.249+350_351delCA; P10: c.249+359G > A; P11: c.249+367G > A; P12: c.249+372C > T; P13: c.249+395delG; P14: c.249+398G > C; P15: c.249+399C > A; P16: c.249+400A > G; P17: c.249+401G > T; P18: c.249+402T > G; P19: c.249+405G > A; P20: c.249+455G > T; P21: c.249+472G > C; P22: c.361T > C; P23: c.396C > T. Bold text indicates strong LD with > 0.3 value. * indicates Holstein cattle-specific strong LD scores.
Table 5. Haplotype frequencies of bovine IFITM3 gene polymorphisms in Hanwoo.
Table 5. Haplotype frequencies of bovine IFITM3 gene polymorphisms in Hanwoo.
P1P2P3P4P5P6P7P8P9P10P11P12P13P14P15P16P17P18P19P20P21P22P23Hanwoo
(n = 216)
TCCGCGCGWtGGCWtGCAGTGGGCC32 (0.148)
CCCGGTCGWtGGCWtGCAGTGGGCC25 (0.116)
CCCGGTCGDelGACWtCAGTGAGGTC17 (0.079)
CCCGGTCGWtGGCWtGCAGTGTGTC14 (0.065)
CCCGGTCGWtGACWtCAGTGAGGTC10 (0.046)
CCCGGTCCWtGACWtCAGTGAGGCC9 (0.042)
CCCGGTCCWtGGCWtGCAGTGTGTC8 (0.037)
CCCGGTCGWtGGTWtGCAGTGTCTC8 (0.037)
CCCGCGCCWtGACWtCAGTGAGGCC7 (0.032)
CCCGCGCGWtGGCDelGCAGTGTCTC7 (0.032)
CCCGCGCGWtGGCWtGCAGTGTGTC6 (0.028)
CCCGGTCGDelGATWtCAGTGAGGTC5 (0.023)
Others * 68 (0.315)
P1: c.-193T > C; P2: c.-136C > T; P3: c.105C > G; P4: c.249+32G > C; P5: c.249+36G > C; P6: c.249+39T > G; P7: c.249+64C > A; P8: c.249+320G > C; P9: c.249+350_351delCA; P10: c.249+359G > A; P11: c.249+367G > A; P12: c.249+372C > T; P13: c.249+395delG; P14: c.249+398G > C; P15: c.249+399C > A; P16: c.249+400A > G; P17: c.249+401G > T; P18: c.249+402T > G; P19: c.249+405G > A; P20: c.249+455G > T; P21: c.249+472G > C; P22: c.361T > C; P23: c.396C > T. * Others contain rare haplotypes with frequency < 0.02.
Table 6. Haplotype frequencies of bovine IFITM3 gene polymorphisms in Holstein cattle.
Table 6. Haplotype frequencies of bovine IFITM3 gene polymorphisms in Holstein cattle.
P1P2P3P4P5P6P7P8P9P10P11P12P13P14P15P16P17P18P19P20P21P22P23Holstein
(n = 226)
TCCGCGCGWtGGCWtGCAGTGGGCC98 (0.434)
CCCGGTCGWtGGCWtGCAGTGGGCC37 (0.164)
TCCGCGCGWtAGCWtGCAGTGGGCC22 (0.097)
TCCGCGCCWtGACWtCAGTGAGGCC8 (0.035)
CCCGGTCGWtGGCWtGCAGTGGGTC7 (0.031)
TCCGCGCGWtAACWtCAGTGAGGCC5 (0.022)
Others * 49 (0.217)
P1: c.-193T > C; P2: c.-136C > T; P3: c.105C > G; P4: c.249+32G > C; P5: c.249+36G > C; P6: c.249+39T > G; P7: c.249+64C > A; P8: c.249+320G > C; P9: c.249+350_351delCA; P10: c.249+359G > A; P11: c.249+367G > A; P12: c.249+372C > T; P13: c.249+395delG; P14: c.249+398G > C; P15: c.249+399C > A; P16: c.249+400A > G; P17: c.249+401G > T; P18: c.249+402T > G; P19: c.249+405G > A; P20: c.249+455G > T; P21: c.249+472G > C; P22: c.361T > C; P23: c.396C > T. * Others contain rare haplotypes with frequency < 0.02.
Table 7. In silico annotations of polymorphism of the bovine IFITM3 gene.
Table 7. In silico annotations of polymorphism of the bovine IFITM3 gene.
PolymorphismMethodsScorePrediction
c.361T > C (F121L)PolyPhen-20.001Benign
PANTHER2Probably benign
PROVEAN−0.357Neutral
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kim, Y.-C.; Jeong, M.-J.; Jeong, B.-H. Regulatory Single Nucleotide Polymorphism of the Bovine IFITM3 Gene Induces Differential Transcriptional Capacities of Hanwoo and Holstein Cattle. Genes 2021, 12, 1662. https://doi.org/10.3390/genes12111662

AMA Style

Kim Y-C, Jeong M-J, Jeong B-H. Regulatory Single Nucleotide Polymorphism of the Bovine IFITM3 Gene Induces Differential Transcriptional Capacities of Hanwoo and Holstein Cattle. Genes. 2021; 12(11):1662. https://doi.org/10.3390/genes12111662

Chicago/Turabian Style

Kim, Yong-Chan, Min-Ju Jeong, and Byung-Hoon Jeong. 2021. "Regulatory Single Nucleotide Polymorphism of the Bovine IFITM3 Gene Induces Differential Transcriptional Capacities of Hanwoo and Holstein Cattle" Genes 12, no. 11: 1662. https://doi.org/10.3390/genes12111662

APA Style

Kim, Y.-C., Jeong, M.-J., & Jeong, B.-H. (2021). Regulatory Single Nucleotide Polymorphism of the Bovine IFITM3 Gene Induces Differential Transcriptional Capacities of Hanwoo and Holstein Cattle. Genes, 12(11), 1662. https://doi.org/10.3390/genes12111662

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop