A Case of Adaptive Laboratory Evolution (ALE): Biodegradation of Furfural by Pseudomonas pseudoalcaligenes CECT 5344
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Media and Growth Conditions
2.2. Preparation of Cell-free Extracts
2.3. Enzymatic Assays
2.4. Chromatographic Separation of FDH and FFADH
2.5. Analytical Methods
2.5.1. HPLC
2.5.2. DNA Manipulation
2.5.3. PCR Reaction Conditions
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Tavoni, M.; Kriegler, E.; Riahi, K.; van Vuuren, D.P.; Aboumahboub, T.; Bowen, A.; Calvin, K.; Campiglio, E.; Kober, T.; Jewell, J.; et al. Post-2020 climate agreements in the major economies assessed in the light of global models. Nat. Clim. Chang. 2014, 5, 119. [Google Scholar] [CrossRef]
- Gray, K.A.; Zhao, L.; Emptage, M. Bioethanol. Curr. Opin. Chem. Biol. 2006, 10, 141–146. [Google Scholar] [CrossRef]
- Blasco, R.; Castillo, F. Acerca de la biotecnología ambiental. Arbor 2014, 190, a157. [Google Scholar] [CrossRef][Green Version]
- Luque-Almagro, V.M.; Huertas, M.J.; Martinez-Luque, M.; Moreno-Vivian, C.; Roldan, M.D.; Garcia-Gil, L.J.; Castillo, F.; Blasco, R. Bacterial degradation of cyanide and its metal complexes under alkaline conditions. Appl. Environ. Microbiol. 2005, 71, 940–947. [Google Scholar] [CrossRef] [PubMed]
- Akcil, A. Destruction of cyanide in gold mill effluents: Biological versus chemical treatments. Biotechnol. Adv. 2003, 21, 501–511. [Google Scholar] [CrossRef]
- Akcil, A.; Mudder, T. Microbial destruction of cyanide wastes in gold mining: Process review. Biotechnol. Lett. 2003, 25, 445–450. [Google Scholar] [CrossRef] [PubMed]
- Baxter, J.; Cummings, S.P. The current and future applications of microorganism in the bioremediation of cyanide contamination. Antonie Leeuwenhoek 2006, 90, 1–17. [Google Scholar] [CrossRef]
- Raybuck, S.A. Microbes and microbial enzymes for cyanide degradation. Biodegradation 1992, 3, 3–18. [Google Scholar] [CrossRef]
- Luque-Almagro, V.M.; Acera, F.; Igeño, M.I.; Wibberg, D.; Roldán, M.D.; Sáez, L.P.; Hennig, M.; Quesada, A.; Huertas, M.J.; Blom, J.; et al. Draft whole genome sequence of the cyanide-degrading bacterium Pseudomonas pseudoalcaligenes CECT5344. Environ. Microbiol. 2013, 15, 253–270. [Google Scholar] [CrossRef]
- Barakat, A.; Monlau, F.; Steyer, J.-P.; Carrere, H. Effect of lignin-derived and furan compounds found in lignocellulosic hydrolysates on biomethane production. Bioresour. Technol. 2012, 104, 90–99. [Google Scholar] [CrossRef]
- Palmqvist, E.; Hahn-Hägerdal, B. Fermentation of lignocellulosic hydrolysates. II: Inhibitors and mechanisms of inhibition. Bioresour. Technol. 2000, 74, 25–33. [Google Scholar] [CrossRef]
- Alvira, P.; Tomas-Pejo, E.; Ballesteros, M.; Negro, M.J. Pretreatment technologies for an efficient bioethanol production process based on enzymatic hydrolysis: A review. Bioresour. Technol. 2010, 101, 4851–4861. [Google Scholar] [CrossRef] [PubMed]
- Ortu, E.; Caboni, P. Levels of 5-hydroxymethylfurfural, furfural, 2-furoic acid in sapa syrup, Marsala wine and bakery products. Int. J. Food Prop. 2017, 20, S2543–S2551. [Google Scholar] [CrossRef]
- Zhang, J.; Zhu, Z.; Wang, X.; Wang, N.; Wang, W.; Bao, J. Biodetoxification of toxins generated from lignocellulose pretreatment using a newly isolated fungus, Amorphotheca resinae ZN1, and the consequent ethanol fermentation. Biotechnol. Biofuels 2010, 3, 26. [Google Scholar] [CrossRef]
- Ran, H.; Zhang, J.; Gao, Q.; Lin, Z.; Bao, J. Analysis of biodegradation performance of furfural and 5-hydroxymethylfurfural by Amorphotheca resinae ZN1. Biotechnol. Biofuels 2014, 7, 51. [Google Scholar] [CrossRef]
- Wierckx, N.; Koopman, F.; Bandounas, L.; Winde, J.H.d.; Ruijssenaars, H.J. Isolation and characterization of Cupriavidus basilensis HMF14 for biological removal of inhibitors from lignocellulosic hydrolysate. Microb. Biotechnol. 2010, 3, 336–343. [Google Scholar] [CrossRef]
- Wierckx, N.; Koopman, F.; Ruijssenaars, H.; de Winde, J. Microbial degradation of furanic compounds: Biochemistry, genetics, and impact. Appl. Microbiol. Biotechnol. 2011, 92, 1095–1105. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Han, B.; Ezeji, T.C. Biotransformation of furfural and 5-hydroxymethyl furfural (HMF) by Clostridium acetobutylicum ATCC 824 during butanol fermentation. N. Biotechnol. 2012, 29, 345–351. [Google Scholar] [CrossRef] [PubMed]
- Koopman, F.; Wierckx, N.; de Winde, J.H.; Ruijssenaars, H.J. Efficient whole-cell biotransformation of 5-(hydroxymethyl)furfural into FDCA, 2,5-furandicarboxylic acid. Bioresour. Technol. 2010, 101, 6291–6296. [Google Scholar] [CrossRef]
- Liu, Z.L.; Slininger, P.J.; Dien, B.S.; Berhow, M.A.; Kurtzman, C.P.; Gorsich, S.W. Adaptive response of yeasts to furfural and 5-hydroxymethylfurfural and new chemical evidence for HMF conversion to 2,5-bis-hydroxymethylfuran. J. Ind. Microbiol. Biotechnol. 2004, 31, 345–352. [Google Scholar] [CrossRef]
- Taherzadeh, M.J.; Gustafsson, L.; Niklasson, C.; Liden, G. Physiological effects of 5-hydroxymethylfurfural on Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 2000, 53, 701–708. [Google Scholar] [CrossRef] [PubMed]
- Zheng, D.; Bao, J.; Lu, J.; Lv, Q. Biodegradation of furfural by Bacillus subtilis strain DS3. J. Environ. Biol. 2015, 36, 727–732. [Google Scholar] [PubMed]
- Koenig, K.; Andreesen, J.R. Xanthine dehydrogenase and 2-furoyl-coenzyme A dehydrogenase from Pseudomonas putida Fu1: Two molybdenum-containing dehydrogenases of novel structural composition. J. Bacteriol. 1990, 172, 5999–6009. [Google Scholar] [CrossRef] [PubMed]
- Koopman, F.; Wierckx, N.; de Winde, J.H.; Ruijssenaars, H.J. Identification and characterization of the furfural and 5-(hydroxymethyl)furfural degradation pathways of Cupriavidus basilensis HMF14. Proc. Natl. Acad. Sci. USA 2010, 107, 4919–4924. [Google Scholar] [CrossRef] [PubMed]
- Nichols, N.N.; Mertens, J.A. Identification and transcriptional profiling of Pseudomonas putida genes involved in furoic acid metabolism. FEMS Microbiol. Lett. 2008, 284, 52–57. [Google Scholar] [CrossRef] [PubMed]
- Koenig, K.; Andreesen, J.R. Molybdenum Involvement in Aerobic Degradation of 2-Furoic Acid by Pseudomonas putida Fu1. Appl. Environ. Microbiol. 1989, 55, 1829–1834. [Google Scholar] [PubMed]
- Quesada, A.; Guijo, M.I.; Merchan, F.; Blazquez, B.; Igeño, M.I.; Blasco, R. Essential role of cytochrome bd-related oxidase in cyanide resistance of Pseudomonas pseudoalcaligenes CECT5344. Appl. Environ. Microbiol. 2007, 73, 5118–5124. [Google Scholar] [CrossRef]
- Sambrook, J.; Russel, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory: New York, NY, USA, 2001. [Google Scholar]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Becker, A.; Schmidt, M.; Jäger, W.; Pühler, A. New gentamicin-resistance and lacZ promoter-probe cassettes suitable for insertion mutagenesis and generation of transcriptional fusions. Gene 1995, 162, 37–39. [Google Scholar] [CrossRef]
- Winkler, J.; Reyes, L.H.; Kao, K.C. Adaptive Laboratory Evolution for Strain Engineering. Syst. Metab. Eng. 2013, 985, 211–222. [Google Scholar]
- Abdulrashid, N.; Clark, D.P. Isolation and genetic analysis of mutations allowing the degradation of furans and thiophenes by Escherichia coli. J. Bacteriol. 1987, 169, 1267–1271. [Google Scholar] [CrossRef] [PubMed]
- Guarnieri, M.T.; Ann Franden, M.; Johnson, C.W.; Beckham, G.T. Conversion and assimilation of furfural and 5-(hydroxymethyl)furfural by Pseudomonas putida KT2440. Metab. Eng. Commun. 2017, 4, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Conrad, T.M.; Lewis, N.E.; Palsson, B.O. Microbial laboratory evolution in the era of genome-scale science. Mol. Syst. Biol. 2011, 7, 509. [Google Scholar] [CrossRef] [PubMed]
- Dragosits, M.; Mattanovich, D. Adaptive laboratory evolution—Principles and applications for biotechnology. Microb. Cell Factories 2013, 12, 64. [Google Scholar] [CrossRef] [PubMed]
- Wibberg, D.; Luque-Almagro, V.M.; Igeño, M.I.; Bremges, A.; Roldán, M.D.; Merchán, F.; Sáez, L.P.; Guijo, M.I.; Manso, M.I.; Macías, D.; et al. Complete genome sequence of the cyanide-degrading bacterium Pseudomonas pseudoalcaligenes CECT5344. J. Biotechnol. 2014, 175, 67–68. [Google Scholar] [CrossRef] [PubMed]
- Schleif, R. AraC protein, regulation of the l-arabinose operon in Escherichia coli, and the light switch mechanism of AraC action. FEMS Microbiol. Rev. 2010, 34, 779–796. [Google Scholar] [CrossRef] [PubMed]
- Worsey, M.J.; Williams, P.A. Metabolism of toluene and xylenes by Pseudomonas (putida (arvilla) mt-2: Evidence for a new function of the TOL plasmid. J. Bacteriol. 1975, 124, 7–13. [Google Scholar] [PubMed]
- Almeida, J.R.; Bertilsson, M.; Gorwa-Grauslund, M.F.; Gorsich, S.; Liden, G. Metabolic effects of furaldehydes and impacts on biotechnological processes. Appl. Microbiol. Biotechnol. 2009, 82, 625–638. [Google Scholar] [CrossRef] [PubMed]
- Daddaoua, A.; Krell, T.; Ramos, J.-L. Regulation of Glucose Metabolism in Pseudomonas: The phosphorylative branch and entner-doudoroff enzymes are regulated by a repressor containing a sugar isomerase domain. J. Biol. Chem. 2009, 284, 21360–21368. [Google Scholar] [CrossRef] [PubMed]
- Blevins, W.T.; Feary, T.W.; Phibbs, P.V., Jr. 6-Phosphogluconate dehydratase deficiency in pleiotropic carbohydrate-negative mutant strains of Pseudomonas aeruginosa. J. Bacteriol. 1975, 121, 942–949. [Google Scholar]
- Mohd Azhar, S.H.; Abdulla, R.; Jambo, S.A.; Marbawi, H.; Gansau, J.A.; Mohd Faik, A.A.; Rodrigues, K.F. Yeasts in sustainable bioethanol production: A review. Biochem. Biophys. Rep. 2017, 10, 52–61. [Google Scholar] [CrossRef] [PubMed]
- Hurd, C.D.; Isenhour, L.L. Pentose reacions. I. Furfural formation. J. Am. Chem. Soc. 1932, 54, 317–330. [Google Scholar] [CrossRef]
- Hu, L.; Lin, L.; Wu, Z.; Zhou, S.; Liu, S. Recent advances in catalytic transformation of biomass-derived 5-hydroxymethylfurfural into the innovative fuels and chemicals. Renew. Sustain. Energy Rev. 2017, 74, 230–257. [Google Scholar] [CrossRef]
- De Mello, F.d.S.B.; Coradini, A.L.V.; Tizei, P.A.G.; Carazzolle, M.F.; Pereira, G.A.G.; Teixeira, G.S. Static microplate fermentation and automated growth analysis approaches identified a highly-aldehyde resistant Saccharomyces cerevisiae strain. Biomass Bioenergy 2019, 120, 49–58. [Google Scholar] [CrossRef]
- Nagamatsu, S.T.; Teixeira, G.S.; de Mello, F.d.S.B.; Tizei, P.A.G.; Nakagawa, B.T.G.; de Carvalho, L.M.; Pereira, G.A.G.; Carazzolle, M.F. Genome Assembly of a Highly Aldehyde-Resistant Saccharomyces cerevisiae SA1-Derived Industrial Strain. Microbiol. Resour. Announc. 2019, 8, e00071. [Google Scholar] [CrossRef] [PubMed]
- Gallegos, M.T.; Schleif, R.; Bairoch, A.; Hofmann, K.; Ramos, J.L. Arac/XylS family of transcriptional regulators. Microbiol. Mol. Biol. Rev. 1997, 61, 393–410. [Google Scholar] [PubMed]
- Nogales, J.; Canales, A.; Jimenez-Barbero, J.; Serra, B.; Pingarron, J.M.; Garcia, J.L.; Diaz, E. Unravelling the gallic acid degradation pathway in bacteria: The gal cluster from Pseudomonas putida. Mol. Microbiol. 2011, 79, 359–374. [Google Scholar] [CrossRef] [PubMed]
- Maslov, S.; Krishna, S.; Pang, T.Y.; Sneppen, K. Toolbox model of evolution of prokaryotic metabolic networks and their regulation. Proc. Natl. Acad. Sci. USA 2009, 106, 9743–9748. [Google Scholar] [CrossRef] [PubMed]
- Igeño, M.I.; Sánchez-Clemente, R.; Población, A.G.; Guijo, M.I.; Merchán, F.; Blasco, R. Biodegradation of 5-(Hydroxymethyl)-furfural and Furan Derivatives. Proceedings 2018, 2, 1283. [Google Scholar] [CrossRef]
- Kang, E.-S.; Chae, D.W.; Kim, B.; Kim, Y.G. Efficient preparation of DHMF and HMFA from biomass-derived HMF via a Cannizzaro reaction in ionic liquids. J. Ind. Eng. Chem. 2012, 18, 174–177. [Google Scholar] [CrossRef]
- Deng, J.; Liu, X.; Li, C.; Jiang, Y.; Zhu, J. Synthesis and properties of a bio-based epoxy resin from 2,5-furandicarboxylic acid (FDCA). RSC Adv. 2015, 5, 15930–15939. [Google Scholar] [CrossRef]
Name | Sequence (5′→3′) | Description |
---|---|---|
edd9U | CCGCGTTGTTGAAGTGACCGA | Amplification of edd gene |
edd730L | GCCCGGATCCATGAAGGAAGC | Amplification of edd gene (BamHI). |
edd1140U | CTACACCCGGGATCCCTTCCT | Amplification of edd gene (BamHI). |
edd1737L | CGCATGAAGGCGAACAACTCG | Amplification of edd gene |
araC157U | CCGGGGCCCGACCGCAATGTG | Amplification of araC gene (ApaI) |
araC823L | GGGCCCGTCCACTACCCGCTG | Amplification of araC gene (ApaI) |
Bacterial Strain | Growth Rate (h−1) | Lag Time (h) | Maximal A600 nm | ||||||
---|---|---|---|---|---|---|---|---|---|
FFA 1 | F 2 | FA 3 | FFA | F | FA | FFA | F | FA | |
P. pseudoalcaligenes R1 | 0.14 | 0.02 | 0.19 | 40 | 125 | 48 | 0.68 | 0.59 | 0.39 |
P. pseudoalcaligenes R1D | 0.34 | 0.29 | 0.34 | 2 | 13 | <1 | 0.72 | 0.55 | 0.41 |
C. basilensis HMF14 4 | 0.22 | 0.22 | 0.29 | - | - | <1 | 1.1 | 1.09 | 0.99 |
P. putida S12 5 | - | 0.3 | - | - | - | - | - | - | - |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Igeño, M.I.; Macias, D.; Blasco, R. A Case of Adaptive Laboratory Evolution (ALE): Biodegradation of Furfural by Pseudomonas pseudoalcaligenes CECT 5344. Genes 2019, 10, 499. https://doi.org/10.3390/genes10070499
Igeño MI, Macias D, Blasco R. A Case of Adaptive Laboratory Evolution (ALE): Biodegradation of Furfural by Pseudomonas pseudoalcaligenes CECT 5344. Genes. 2019; 10(7):499. https://doi.org/10.3390/genes10070499
Chicago/Turabian StyleIgeño, M. Isabel, Daniel Macias, and Rafael Blasco. 2019. "A Case of Adaptive Laboratory Evolution (ALE): Biodegradation of Furfural by Pseudomonas pseudoalcaligenes CECT 5344" Genes 10, no. 7: 499. https://doi.org/10.3390/genes10070499
APA StyleIgeño, M. I., Macias, D., & Blasco, R. (2019). A Case of Adaptive Laboratory Evolution (ALE): Biodegradation of Furfural by Pseudomonas pseudoalcaligenes CECT 5344. Genes, 10(7), 499. https://doi.org/10.3390/genes10070499