Characterization of Two Novel Intronic Variants Affecting Splicing in FBN1-Related Disorders
Abstract
:1. Introduction
2. Materials and Methods
2.1. Clinical Description: Individual 1
2.2. Clinical Description: Individual 2
2.3. Genomic DNA Extraction
2.4. Genetic Testing (Sanger Sequencing): Individual 1
2.5. Genetic Testing (Next-Generation Sequencing): Individual 2
2.6. Variant Designation
2.7. In Silico Prediction
2.8. RNA Extraction and Reverse Transcription–Polymerase Chain Reaction
3. Results
3.1. Individual 1
3.2. Individual 2
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Ramirez, F.; Dietz, H.C. Fibrillin-rich microfibrils: Structural determinants of morphogenetic and homeostatic events. J. Cell Physiol. 2007, 213, 326–330. [Google Scholar] [CrossRef] [PubMed]
- Verstraeten, A.; Alaerts, M.; Van Laer, L.; Loeys, B. Marfan Syndrome and Related Disorders: 25 Years of Gene Discovery. Hum. Mutat. 2016, 37, 524–531. [Google Scholar] [CrossRef] [PubMed]
- Sakai, L.Y.; Keene, D.R. Fibrillin protein pleiotropy: Acromelic dysplasias. Matrix Biol 2018, 80, 6–13. [Google Scholar] [CrossRef] [PubMed]
- Collod-Beroud, G.; Le Bourdelles, S.; Ades, L.; Ala-Kokko, L.; Booms, P.; Boxer, M.; Child, A.; Comeglio, P.; De Paepe, A.; Hyland, J.C.; et al. Update of the UMD-FBN1 mutation database and creation of an FBN1 polymorphism database. Hum. Mutat. 2003, 22, 199–208. [Google Scholar] [CrossRef] [PubMed]
- Frederic, M.Y.; Lalande, M.; Boileau, C.; Hamroun, D.; Claustres, M.; Beroud, C.; Collod-Beroud, G. UMD-predictor, a new prediction tool for nucleotide substitution pathogenicity-application to four genes: FBN1, FBN2, TGFBR1, and TGFBR2. Hum. Mutat. 2009, 30, 952–959. [Google Scholar] [CrossRef] [PubMed]
- Faivre, L.; Collod-Beroud, G.; Callewaert, B.; Child, A.; Binquet, C.; Gautier, E.; Loeys, B.L.; Arbustini, E.; Mayer, K.; Arslan-Kirchner, M.; et al. Clinical and mutation-type analysis from an international series of 198 probands with a pathogenic FBN1 exons 24-32 mutation. Eur. J. Hum. Genet. 2009, 17, 491–501. [Google Scholar] [CrossRef] [PubMed]
- Aubart, M.; Gazal, S.; Arnaud, P.; Benarroch, L.; Gross, M.S.; Buratti, J.; Boland, A.; Meyer, V.; Zouali, H.; Hanna, N.; et al. Association of modifiers and other genetic factors explain Marfan syndrome clinical variability. Eur. J. Hum. Genet. 2018, 26, 1759–1772. [Google Scholar] [CrossRef] [Green Version]
- Ergoren, M.C.; Turkgenc, B.; Terali, K.; Rodoplu, O.; Verstraeten, A.; Van Laer, L.; Mocan, G.; Loeys, B.; Tetik, O.; Temel, S.G. Identification and characterization of a novel FBN1 gene variant in an extended family with variable clinical phenotype of Marfan syndrome. Connect. Tissue Res. 2019, 60, 146–154. [Google Scholar] [CrossRef]
- Wagner, A.H.; Zaradzki, M.; Arif, R.; Remes, A.; Muller, O.J.; Kallenbach, K. Marfan syndrome: A therapeutic challenge for long-term care. Biochem. Pharmacol. 2019, 164, 53–63. [Google Scholar] [CrossRef]
- Zeyer, K.A.; Reinhardt, D.P. Engineered mutations in fibrillin-1 leading to Marfan syndrome act at the protein, cellular and organismal levels. Mutat. Res. Rev. Mutat. Res. 2015, 765, 7–18. [Google Scholar] [CrossRef]
- Campens, L.; Renard, M.; Callewaert, B.; Coucke, P.; De Backer, J.; De Paepe, A. New insights into the molecular diagnosis and management of heritable thoracic aortic aneurysms and dissections. Pol. Arch. Med. Wewn. 2013, 123, 693–700. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef] [PubMed]
- Jensen, S.A.; Aspinall, G.; Handford, P.A. C-terminal propeptide is required for fibrillin-1 secretion and blocks premature assembly through linkage to domains cbEGF41-43. Proc. Natl. Acad. Sci. USA 2014, 111, 10155–10160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matyas, G.; Alonso, S.; Patrignani, A.; Marti, M.; Arnold, E.; Magyar, I.; Henggeler, C.; Carrel, T.; Steinmann, B.; Berger, W. Large genomic fibrillin-1 (FBN1) gene deletions provide evidence for true haploinsufficiency in Marfan syndrome. Hum. Genet. 2007, 122, 23–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Judge, D.P.; Biery, N.J.; Keene, D.R.; Geubtner, J.; Myers, L.; Huso, D.L.; Sakai, L.Y.; Dietz, H.C. Evidence for a critical contribution of haploinsufficiency in the complex pathogenesis of Marfan syndrome. J. Clin. Investig. 2004, 114, 172–181. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takeda, N.; Inuzuka, R.; Maemura, S.; Morita, H.; Nawata, K.; Fujita, D.; Taniguchi, Y.; Yamauchi, H.; Yagi, H.; Kato, M.; et al. Impact of Pathogenic FBN1 Variant Types on the Progression of Aortic Disease in Patients With Marfan Syndrome. Circ. Genom. Precis. Med. 2018, 11, e002058. [Google Scholar] [CrossRef] [Green Version]
- Dietz, H.C.; Valle, D.; Francomano, C.A.; Kendzior, R.J., Jr.; Pyeritz, R.E.; Cutting, G.R. The skipping of constitutive exons in vivo induced by nonsense mutations. Science 1993, 259, 680–683. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.J.; Han, P.; Zheng, J.; Hu, F.Y.; Zhu, Y.; Xie, J.S.; Guo, J.; Zhang, Z.; Dong, J.; Zheng, G.Y.; et al. Exon 47 skipping of fibrillin-1 leads preferentially to cardiovascular defects in patients with thoracic aortic aneurysms and dissections. J. Mol. Med. 2013, 91, 37–47. [Google Scholar] [CrossRef]
- Wypasek, E.; Potaczek, D.P.; Hydzik, M.; Stapor, R.; Raczkowska-Muraszko, M.; Weiss, J.; Maugeri, A.; Undas, A. Detection and a functional characterization of the novel FBN1 intronic mutation underlying Marfan syndrome: Case presentation. Clin. Chem. Lab. Med. 2018, 56, 87–91. [Google Scholar] [CrossRef]
- Torrado, M.; Maneiro, E.; Trujillo-Quintero, J.P.; Evangelista, A.; Mikhailov, A.T.; Monserrat, L. A Novel Heterozygous Intronic Mutation in the FBN1 Gene Contributes to FBN1 RNA Missplicing Events in the Marfan Syndrome. BioMed Res. Int. 2018, 2018, 3536495. [Google Scholar] [CrossRef]
- Isken, O.; Maquat, L.E. Quality control of eukaryotic mRNA: safeguarding cells from abnormal mRNA function. Genes Dev. 2007, 21, 1833–1856. [Google Scholar] [CrossRef] [PubMed]
- Le Goff, C.; Mahaut, C.; Wang, L.W.; Allali, S.; Abhyankar, A.; Jensen, S.; Zylberberg, L.; Collod-Beroud, G.; Bonnet, D.; Alanay, Y.; et al. Mutations in the TGFbeta binding-protein-like domain 5 of FBN1 are responsible for acromicric and geleophysic dysplasias. Am. J. Hum. Genet. 2011, 89, 7–14. [Google Scholar] [CrossRef] [PubMed]
Individual | Primer | Sequence | Amplicon Size (pb) | Application |
---|---|---|---|---|
Individual 1 | FBN1_Int56-57_F | TTTTGAGCCATGTGAACAGATT | 320 | DNA |
FBN1_EX57_R | AAACCCATCATTACACTCACAGG | |||
FBN1_EX55_F | ATATGTGCTCAGAGAAGACCGTA | 262 | cDNA | |
FBN1_EX57_R | AAACCCATCATTACACTCACAGG | |||
Individual 2 | FBN1_Int61-62_F | TCCGAGTTATCCTTCTAATTTTCT | 313 | DNA |
FBN1_EX62_R | TATCTCATAGAGGCTGATGATGAAG | |||
FBN1_EX61_F | GCAACCAAGCAACACAACTG | 254 | cDNA | |
FBN1_EX63_R | TTACCCTCACACTCGTCCAC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fusco, C.; Morlino, S.; Micale, L.; Ferraris, A.; Grammatico, P.; Castori, M. Characterization of Two Novel Intronic Variants Affecting Splicing in FBN1-Related Disorders. Genes 2019, 10, 442. https://doi.org/10.3390/genes10060442
Fusco C, Morlino S, Micale L, Ferraris A, Grammatico P, Castori M. Characterization of Two Novel Intronic Variants Affecting Splicing in FBN1-Related Disorders. Genes. 2019; 10(6):442. https://doi.org/10.3390/genes10060442
Chicago/Turabian StyleFusco, Carmela, Silvia Morlino, Lucia Micale, Alessandro Ferraris, Paola Grammatico, and Marco Castori. 2019. "Characterization of Two Novel Intronic Variants Affecting Splicing in FBN1-Related Disorders" Genes 10, no. 6: 442. https://doi.org/10.3390/genes10060442