RTH-149 Cell Line, a Useful Tool to Decipher Molecular Mechanisms Related to Fish Nutrition
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatments
2.2. Protein Extraction and Western Blot Analysis
2.3. Autophagy Flux Assay
2.4. RNA Extraction and RT-qPCR Analyses
2.5. Statistical Analysis
3. Results
3.1. The GCN 2 Pathway
3.2. Autophagy
3.3. mTOR
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2020: Sustainability in Action; The State of World Fisheries and Aquaculture (SOFIA); FAO: Rome, Italy, 2020; ISBN 978-92-5-132692-3. [Google Scholar]
- Naylor, R.L.; Hardy, R.W.; Bureau, D.P.; Chiu, A.; Elliott, M.; Farrell, A.P.; Forster, I.; Gatlin, D.M.; Goldburg, R.J.; Hua, K.; et al. Feeding aquaculture in an era of finite resources. Proc. Natl. Acad. Sci. USA 2009, 106, 15103–15110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaushik, S.J.; Covès, D.; Dutto, G.; Blanc, D. Almost total replacement of fish meal by plant protein sources in the diet of a marine teleost, the European seabass, Dicentrarchus labrax. Aquaculture 2004, 230, 391–404. [Google Scholar] [CrossRef]
- Vilhelmsson, O.T.; Martin, S.A.M.; Médale, F.; Kaushik, S.J.; Houlihan, D.F. Dietary plant-protein substitution affects hepatic metabolism in rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 2004, 92, 71–80. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roques, S.; Deborde, C.; Richard, N.; Sergent, L.; Kurz, F.; Skiba-Cassy, S.; Fauconneau, B.; Moing, A. Characterizing alternative feeds for rainbow trout (O-mykiss) by H-1 NMR metabolomics. Metabolomics 2018, 14, 155. [Google Scholar] [CrossRef] [Green Version]
- Daniel, N. A review on replacing fish meal in aqua feeds using plant protein sources. Int. J. Fish. Aquat. Stud. 2018, 6, 164–179. [Google Scholar]
- de Francesco, M.; Parisi, G.; Medale, F.; Lupi, P.; Kaushik, S.J.; Poli, B.M. Effect of long-term feeding with a plant protein mixture based diet on growth and body/fillet quality traits of large rainbow trout (Oncorhynchus mykiss). Aquaculture 2004, 236, 413–429. [Google Scholar] [CrossRef] [Green Version]
- Sanford, K.K.; Earle, W.R.; Likely, G.D. The growth in vitro of single isolated tissue cells. J. Natl. Cancer Inst. 1948, 9, 229–246. [Google Scholar] [PubMed]
- Scherer, W.F.; Syverton, J.T.; Gey, G.O. Studies on the propagation in vitro of poliomyelitis viruses. J. Exp. Med. 1953, 97, 695–710. [Google Scholar] [CrossRef] [Green Version]
- Madin, S.H.; Andriese, P.C.; Darby, N.B. The in vitro cultivation of tissues of domestic and laboratory animals. Am. J. Vet. Res. 1957, 18, 932–941. [Google Scholar]
- The Principles of Humane Experimental Technique. Med. J. Aust. 1960, 1, 500. [CrossRef]
- Bairoch, A. The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018, 29, 25–38. [Google Scholar] [CrossRef] [PubMed]
- Wolf, K.; Quimby, M.C. Established eurythermic line of fish cells in vitro. Science 1962, 135, 1065–1066. [Google Scholar] [CrossRef] [PubMed]
- Bols, N.C.; Pham, P.H.; Dayeh, V.R.; Lee, L.E.J. Invitromatics, invitrome, and invitroomics: Introduction of three new terms for in vitro biology and illustration of their use with the cell lines from rainbow trout. In Vitro Cell. Dev. Biol. Anim. 2017, 53, 383–405. [Google Scholar] [CrossRef]
- Kim, J.; Guan, K.-L. mTOR as a central hub of nutrient signalling and cell growth. Nat. Cell Biol. 2019, 21, 63–71. [Google Scholar] [CrossRef] [PubMed]
- Hara, K.; Yonezawa, K.; Weng, Q.P.; Kozlowski, M.T.; Belham, C.; Avruch, J. Amino acid sufficiency and mTOR regulate p70 S6 kinase and eIF-4E BP1 through a common effector mechanism. J. Biol. Chem. 1998, 273, 14484–14494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hosokawa, N.; Hara, T.; Kaizuka, T.; Kishi, C.; Takamura, A.; Miura, Y.; Iemura, S.; Natsume, T.; Takehana, K.; Yamada, N.; et al. Nutrient-dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy. Mol. Biol. Cell 2009, 20, 1981–1991. [Google Scholar] [CrossRef] [Green Version]
- Saha, S.; Panigrahi, D.P.; Patil, S.; Bhutia, S.K. Autophagy in health and disease: A comprehensive review. Biomed. Pharm. 2018, 104, 485–495. [Google Scholar] [CrossRef]
- Pakos-Zebrucka, K.; Koryga, I.; Mnich, K.; Ljujic, M.; Samali, A.; Gorman, A.M. The integrated stress response. EMBO Rep. 2016, 17, 1374–1395. [Google Scholar] [CrossRef] [Green Version]
- Lannan, C.N.; Winton, J.R.; Fryer, J.L. Fish cell lines: Establishment and characterization of nine cell lines from salmonids. In Vitro 1984, 20, 671–676. [Google Scholar] [CrossRef]
- Ravishankar, B.; Liu, H.; Shinde, R.; Chaudhary, K.; Xiao, W.; Bradley, J.; Koritzinsky, M.; Madaio, M.P.; McGaha, T.L. The amino acid sensor GCN2 inhibits inflammatory responses to apoptotic cells promoting tolerance and suppressing systemic autoimmunity. Proc. Natl. Acad. Sci. USA 2015, 112, 10774–10779. [Google Scholar] [CrossRef] [Green Version]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A.; Abedin, M.J.; Abeliovich, H.; Acevedo Arozena, A.; Adachi, H.; Adams, C.M.; Adams, P.D.; Adeli, K.; et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 2016, 12, 1–222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alami-Durante, H.; Medale, F.; Cluzeaud, M.; Kaushik, S.J. Skeletal muscle growth dynamics and expression of related genes in white and red muscles of rainbow trout fed diets with graded levels of a mixture of plant protein sources as substitutes for fishmeal. Aquaculture 2010, 303, 50–58. [Google Scholar] [CrossRef]
- Belghit, I.; Skiba-Cassy, S.; Geurden, I.; Dias, K.; Surget, A.; Kaushik, S.; Panserat, S.; Seiliez, I. Dietary methionine availability affects the main factors involved in muscle protein turnover in rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 2014, 112, 493–503. [Google Scholar] [CrossRef] [Green Version]
- Lansard, M.; Panserat, S.; Plagnes-Juan, E.; Seiliez, I.; Skiba-Cassy, S. Integration of insulin and amino acid signals that regulate hepatic metabolism-related gene expression in rainbow trout: Role of TOR. Amino Acids 2010, 39, 801–810. [Google Scholar] [CrossRef] [PubMed]
- Seiliez, I.; Gutierrez, J.; Salmerón, C.; Skiba-Cassy, S.; Chauvin, C.; Dias, K.; Kaushik, S.; Tesseraud, S.; Panserat, S. An in vivo and in vitro assessment of autophagy-related gene expression in muscle of rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. Part. B: Biochem. Mol. Biol. 2010, 157, 258–266. [Google Scholar] [CrossRef]
- Seiliez, I.; Belghit, I.; Gao, Y.; Skiba-Cassy, S.; Dias, K.; Cluzeaud, M.; Rémond, D.; Hafnaoui, N.; Salin, B.; Camougrand, N.; et al. Looking at the metabolic consequences of the colchicine-based in vivo autophagic flux assay. Autophagy 2016, 12, 343–356. [Google Scholar] [CrossRef] [Green Version]
- Segner, H.; Blair, J.; Wirtz, G.; Miller, M. Cultured Trout Liver-Cells-Utilization of Substrates and Response to Hormones. In Vitro Cell. Dev. Biol.-Anim 1994, 30A, 306–311. [Google Scholar] [CrossRef]
- Froehlich, J.M.; Seiliez, I.; Gabillard, J.-C.; Biga, P.R. Preparation of Primary Myogenic Precursor Cell/Myoblast Cultures from Basal Vertebrate Lineages. J. Vis. Exp. 2014, e51354. [Google Scholar] [CrossRef]
- Pereira, C.; Vijayan, M.; Moon, T. In-Vitro Hepatocyte Metabolism of Alanine and Glucose and the Response to Insulin in Fed and Fasted Rainbow-Trout. J. Exp. Zool. 1995, 271, 425–431. [Google Scholar] [CrossRef]
- Buzzi, M.; Henderson, R.J.; Sargent, J.R. The desaturation and elongation of linolenic acid and eicosapentaenoic acid by hepatocytes and liver microsomes from rainbow trout (Oncorhynchus mykiss) fed diets containing fish oil or olive oil. Biochim. Biophys. Acta-Lipids Lipid Metab. 1996, 1299, 235–244. [Google Scholar] [CrossRef]
- Bower, N.I.; Johnston, I.A. Paralogs of Atlantic salmon myoblast determination factor genes are distinctly regulated in proliferating and differentiating myogenic cells. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2010, 298, R1615–R1626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garcia de la Serrana, D.; Codina, M.; Capilla, E.; Jimenez-Amilburu, V.; Navarro, I.; Du, S.-J.; Johnston, I.A.; Gutierrez, J. Characterisation and expression of myogenesis regulatory factors during in vitro myoblast development and in vivo fasting in the gilthead sea bream (Sparus aurata). Comp. Biochem. Physiol. A-Mol. Integr. Physiol. 2014, 167, 90–99. [Google Scholar] [CrossRef] [PubMed]
- Cleveland, B.M. In vitro and in vivo effects of phytoestrogens on protein turnover in rainbow trout (Oncorhynchus mykiss) white muscle. Comp. Biochem. Physiol. C-Toxicol. Pharm. 2014, 165, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Cleveland, B.M.; Weber, G.M. Effects of insulin-like growth factor-I, insulin, and leucine on protein turnover and ubiquitin ligase expression in rainbow trout primary myocytes. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2010, 298, R341–R350. [Google Scholar] [CrossRef] [Green Version]
- Su, N.; Kilberg, M.S. C/EBP Homology Protein (CHOP) Interacts with Activating Transcription Factor 4 (ATF4) and Negatively Regulates the Stress-dependent Induction of the Asparagine Synthetase Gene. J. Biol. Chem. 2008, 283, 35106–35117. [Google Scholar] [CrossRef] [Green Version]
- B’chir, W.; Maurin, A.-C.; Carraro, V.; Averous, J.; Jousse, C.; Muranishi, Y.; Parry, L.; Stepien, G.; Fafournoux, P.; Bruhat, A. The eIF2 alpha/ATF4 pathway is essential for stress-induced autophagy gene expression. Nucleic Acids Res. 2013, 41, 7683–7699. [Google Scholar] [CrossRef] [Green Version]
- Kaizuka, T.; Morishita, H.; Hama, Y.; Tsukamoto, S.; Matsui, T.; Toyota, Y.; Kodama, A.; Ishihara, T.; Mizushima, T.; Mizushima, N. An Autophagic Flux Probe that Releases an Internal Control. Mol. Cell 2016, 64, 835–849. [Google Scholar] [CrossRef] [Green Version]
- Nicklin, P.; Bergman, P.; Zhang, B.; Triantafellow, E.; Wang, H.; Nyfeler, B.; Yang, H.; Hild, M.; Kung, C.; Wilson, C.; et al. Bidirectional transport of amino acids regulates mTOR and autophagy. Cell 2009, 136, 521–534. [Google Scholar] [CrossRef] [Green Version]
- Beaumatin, F.; O’Prey, J.; Barthet, V.J.A.; Zunino, B.; Parvy, J.-P.; Bachmann, A.M.; O’Prey, M.; Kania, E.; Gonzalez, P.S.; Macintosh, R.; et al. mTORC1 Activation Requires DRAM-1 by Facilitating Lysosomal Amino Acid Efflux. Mol. Cell 2019, 76, 163–176.e8. [Google Scholar] [CrossRef] [Green Version]
- Seiliez, I.; Gabillard, J.-C.; Riflade, M.; Sadoul, B.; Dias, K.; Averous, J.; Tesseraud, S.; Skiba, S.; Panserat, S. Amino acids downregulate the expression of several autophagy-related genes in rainbow trout myoblasts. Autophagy 2012, 8, 364–375. [Google Scholar] [CrossRef]
- Seiliez, I.; Gabillard, J.-C.; Skiba-Cassy, S.; Garcia-Serrana, D.; Gutiérrez, J.; Kaushik, S.; Panserat, S.; Tesseraud, S. An in vivo and in vitro assessment of TOR signaling cascade in rainbow trout (Oncorhynchus mykiss). Am. J. Physiol. Regul. Integr. Comp. Physiol. 2008, 295, R329–R335. [Google Scholar] [CrossRef] [Green Version]
- Lansard, M.; Panserat, S.; Plagnes-Juan, E.; Dias, K.; Seiliez, I.; Skiba-Cassy, S. L-leucine, L-methionine, and L-lysine are involved in the regulation of intermediary metabolism-related gene expression in rainbow trout hepatocytes. J. Nutr. 2011, 141, 75–80. [Google Scholar] [CrossRef] [Green Version]
- Manifava, M.; Smith, M.; Rotondo, S.; Walker, S.; Niewczas, I.; Zoncu, R.; Clark, J.; Ktistakis, N.T. Dynamics of mTORC1 activation in response to amino acids. Elife 2016, 5, e19960. [Google Scholar] [CrossRef] [PubMed]
- Gorissen, S.H.M.; Crombag, J.J.R.; Senden, J.M.G.; Waterval, W.A.H.; Bierau, J.; Verdijk, L.B.; van Loon, L.J.C. Protein content and amino acid composition of commercially available plant-based protein isolates. Amino Acids 2018, 50, 1685–1695. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ketola, H.G. Requirement for dietary lysine and arginine by fry of rainbow trout. J. Anim. Sci. 1983, 56, 101–107. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward Primer | Reverse Primer |
---|---|---|
asns | 5′-CTGCACACGGTCTGGAGCTG-3′ | 5′-GGATCTCGTCTGGGATCAGGTT-3′ |
chop | 5′-CGACAATGTCCAACAACCTG-3′ | 5′-ACGAGGAGAACGAGGTGCTA-3′ |
xbp1 | 5′- TGCAACCAAGCCAATTCTTC -3′ | 5′-GCGAGAACTTCGTCTTCCAG-3′ |
edem1 | 5′-GAACATCCAAACGGGACAGT-3′ | 5′-TGAGAAGAGGGAGGGAGTCA-3′ |
lc3b | 5′-GAAACAGTTTGACCTGCGTGAA-3′ | 5′-TCTCTCAATGATGACCGGAATCT-3′ |
sqstm1 | 5′-AGCCCACTGGGTATCGATGT-3′ | 5′-GGTCACGTGAGTCCATTCCT-3′ |
atg4b | 5′-TATGCGCTTCCGAAAGTTGTC-3′ | 5′-CAGGATCGTTGGGGTTCTGC-3′ |
atg12 | 5′-GATGGAGGCCAATGAACAGC-3′ | 5′-GCGTTTGAACTGAAAAGGGCTAA-3′ |
atp6v1a | 5′-CTGTTTAATTTCTGAAGATCTAGCC-3′ | 5′-GATCTCTCCCACCAGCTCAC-3′ |
ctsd | 5′-CAGACATCGCCTGCTTGCTT-3′ | 5′-CAGGATGCCGTCAAACTTCG-3′ |
ef1 | 5′-TCCTCTTGGTCGTTTCGCTG-3′ | 5′-ACCCGAGGGACATCCTGTG-3′ |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morin, G.; Pinel, K.; Dias, K.; Seiliez, I.; Beaumatin, F. RTH-149 Cell Line, a Useful Tool to Decipher Molecular Mechanisms Related to Fish Nutrition. Cells 2020, 9, 1754. https://doi.org/10.3390/cells9081754
Morin G, Pinel K, Dias K, Seiliez I, Beaumatin F. RTH-149 Cell Line, a Useful Tool to Decipher Molecular Mechanisms Related to Fish Nutrition. Cells. 2020; 9(8):1754. https://doi.org/10.3390/cells9081754
Chicago/Turabian StyleMorin, Guillaume, Karine Pinel, Karine Dias, Iban Seiliez, and Florian Beaumatin. 2020. "RTH-149 Cell Line, a Useful Tool to Decipher Molecular Mechanisms Related to Fish Nutrition" Cells 9, no. 8: 1754. https://doi.org/10.3390/cells9081754
APA StyleMorin, G., Pinel, K., Dias, K., Seiliez, I., & Beaumatin, F. (2020). RTH-149 Cell Line, a Useful Tool to Decipher Molecular Mechanisms Related to Fish Nutrition. Cells, 9(8), 1754. https://doi.org/10.3390/cells9081754