Ascorbic Acid Promotes Functional Restoration after Spinal Cord Injury Partly by Epigenetic Modulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Models
2.2. Preparation and Administration of AA
2.3. Histology
2.4. Immunohistochemistry (IHC)
2.5. Axon Quantification
2.6. Functional Assessment
2.7. Genomic DNA Preparation and Dot Blot Assay
2.8. RNA Isolation, Quantitative Real-Time PCR (qRT-PCR), and Functional Enrichment Analysis
2.9. Statistics
3. Results
3.1. SCI Induces Alteration of 5mC and 5hmC Levels in the Brain Motor Cortex
3.2. Altered 5hmC Levels and Gene Expression in the Brain Motor Cortex after SCI
3.3. AA Improves Functional Recovery and Axonal Sprouting after SCI
3.4. AA Enhances 5hmC Formation by Upregulating Tet1 and Tet2
3.5. AA Induces Changes in Gene Expression within the Brain after SCI
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Cholewa-Waclaw, J.; Bird, A.; von Schimmelmann, M.; Schaefer, A.; Yu, H.; Song, H.; Madabhushi, R.; Tsai, L.H. The Role of Epigenetic Mechanisms in the Regulation of Gene Expression in the Nervous System. J. Neurosci. 2016, 36, 11427–11434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camarena, V.; Wang, G. The epigenetic role of vitamin C in health and disease. Cell Mol. Life Sci. 2016, 73, 1645–1658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Veron, N.; Peters, A.H. Epigenetics: Tet proteins in the limelight. Nature 2011, 473, 293–294. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Cullen, J.J.; Buettner, G.R. Ascorbic acid: Chemistry, biology and the treatment of cancer. Biochim. Biophys. Acta 2012, 1826, 443–457. [Google Scholar] [CrossRef] [Green Version]
- Young, J.I.; Zuchner, S.; Wang, G. Regulation of the Epigenome by Vitamin C. Annu. Rev. Nutr. 2015, 35, 545–564. [Google Scholar] [CrossRef] [Green Version]
- Pietronigro, D.D.; Hovsepian, M.; Demopoulos, H.B.; Flamm, E.S. Loss of ascorbic acid from injured feline spinal cord. J. Neurochem. 1983, 41, 1072–1076. [Google Scholar] [CrossRef]
- Yan, M.; Yang, M.; Shao, W.; Mao, X.G.; Yuan, B.; Chen, Y.F.; Ye, Z.X.; Liang, W.; Luo, Z.J. High-dose ascorbic acid administration improves functional recovery in rats with spinal cord contusion injury. Spinal Cord 2014, 52, 803–808. [Google Scholar] [CrossRef] [Green Version]
- Kook, S.Y.; Lee, K.M.; Kim, Y.; Cha, M.Y.; Kang, S.; Baik, S.H.; Lee, H.; Park, R.; Mook-Jung, I. High-dose of vitamin C supplementation reduces amyloid plaque burden and ameliorates pathological changes in the brain of 5XFAD mice. Cell Death Dis. 2014, 5, e1083. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.G.; Xiu, R.J.; Xu, Z.W.; Yin, Y.X.; Feng, Y.; Cao, X.C.; Wang, P.S. Protective effects of Vitamin C against spinal cord injury-induced renal damage through suppression of NF-kappaB and proinflammatory cytokines. Neurol Sci. 2015, 36, 521–526. [Google Scholar] [CrossRef]
- Hong, J.Y.; Lee, S.H.; Lee, S.C.; Kim, J.W.; Kim, K.P.; Kim, S.M.; Tapia, N.; Lim, K.T.; Kim, J.; Ahn, H.S.; et al. Therapeutic potential of induced neural stem cells for spinal cord injury. J. Biol. Chem. 2014, 289, 32512–32525. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.W.; Mahapatra, C.; Hong, J.Y.; Kim, M.S.; Leong, K.W.; Kim, H.W.; Hyun, J.K. Functional Recovery of Contused Spinal Cord in Rat with the Injection of Optimal-Dosed Cerium Oxide Nanoparticles. Adv. Sci. (Weinh) 2017, 4, 1700034. [Google Scholar] [CrossRef] [PubMed]
- Hong, J.Y.; Seo, Y.; Davaa, G.; Kim, H.W.; Kim, S.H.; Hyun, J.K. Decellularized brain matrix enhances macrophage polarization and functional improvements in rat spinal cord injury. Acta Biomater. 2020, 101, 357–371. [Google Scholar] [CrossRef] [PubMed]
- Taylor, L.; Jones, L.; Tuszynski, M.H.; Blesch, A. Neurotrophin-3 gradients established by lentiviral gene delivery promote short-distance axonal bridging beyond cellular grafts in the injured spinal cord. J. Neurosci. 2006, 26, 9713–9721. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, B.; Wang, X.L.; Huang, Y.; Chen, L.H.; Cheng, R.X.; Zhou, F.M.; Guo, R.; Li, J.C.; Liu, T. Peripheral and spinal 5-HT receptors participate in cholestatic itch and antinociception induced by bile duct ligation in rats. Sci. Rep. 2016, 6, 36286. [Google Scholar] [CrossRef] [Green Version]
- DePaul, M.A.; Lin, C.Y.; Silver, J.; Lee, Y.S. Combinatory repair strategy to promote axon regeneration and functional recovery after chronic spinal cord injury. Sci. Rep. 2017, 7, 9018. [Google Scholar] [CrossRef] [Green Version]
- Basso, D.M.; Beattie, M.S.; Bresnahan, J.C. Graded histological and locomotor outcomes after spinal cord contusion using the NYU weight-drop device versus transection. Exp. Neurol. 1996, 139, 244–256. [Google Scholar] [CrossRef] [Green Version]
- Park, W.B.; Kim, S.Y.; Lee, S.H.; Kim, H.W.; Park, J.S.; Hyun, J.K. The effect of mesenchymal stem cell transplantation on the recovery of bladder and hindlimb function after spinal cord contusion in rats. BMC Neurosci. 2010, 11, 119. [Google Scholar] [CrossRef] [Green Version]
- Zhao, M.; Wang, J.; Liao, W.; Li, D.; Li, M.; Wu, H.; Zhang, Y.; Gershwin, M.E.; Lu, Q. Increased 5-hydroxymethylcytosine in CD4(+) T cells in systemic lupus erythematosus. J. Autoimmun. 2016, 69, 64–73. [Google Scholar] [CrossRef] [PubMed]
- Ono, R.; Taki, T.; Taketani, T.; Taniwaki, M.; Kobayashi, H.; Hayashi, Y. LCX, leukemia-associated protein with a CXXC domain, is fused to MLL in acute myeloid leukemia with trilineage dysplasia having t(10;11)(q22;q23). Cancer Res. 2002, 62, 4075–4080. [Google Scholar]
- Lorsbach, R.B.; Moore, J.; Mathew, S.; Raimondi, S.C.; Mukatira, S.T.; Downing, J.R. TET1, a member of a novel protein family, is fused to MLL in acute myeloid leukemia containing the t(10;11)(q22;q23). Leukemia 2003, 17, 637–641. [Google Scholar] [CrossRef] [Green Version]
- Tahiliani, M.; Koh, K.P.; Shen, Y.; Pastor, W.A.; Bandukwala, H.; Brudno, Y.; Agarwal, S.; Iyer, L.M.; Liu, D.R.; Aravind, L.; et al. Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 2009, 324, 930–935. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ito, S.; Shen, L.; Dai, Q.; Wu, S.C.; Collins, L.B.; Swenberg, J.A.; He, C.; Zhang, Y. Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine. Science 2011, 333, 1300–1303. [Google Scholar] [CrossRef] [Green Version]
- Singh, A.K.; Zhao, B.; Liu, X.; Wang, X.; Li, H.; Qin, H.; Wu, X.; Ma, Y.; Horne, D.; Yu, X. Selective targeting of TET catalytic domain promotes somatic cell reprogramming. Proc. Natl. Acad. Sci. USA 2020, 117, 3621–3626. [Google Scholar] [CrossRef]
- Yang, J.; Bashkenova, N.; Zang, R.; Huang, X.; Wang, J. The roles of TET family proteins in development and stem cells. Development 2020, 147. [Google Scholar] [CrossRef]
- Wang, R.; Gao, X.; Yu, L. The prognostic impact of tet oncogene family member 2 mutations in patients with acute myeloid leukemia: A systematic-review and meta-analysis. BMC Cancer 2019, 19, 389. [Google Scholar] [CrossRef] [PubMed]
- Ticozzi, N.; Vance, C.; Leclerc, A.L.; Keagle, P.; Glass, J.D.; McKenna-Yasek, D.; Sapp, P.C.; Silani, V.; Bosco, D.A.; Shaw, C.E.; et al. Mutational analysis reveals the FUS homolog TAF15 as a candidate gene for familial amyotrophic lateral sclerosis. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2011, 156B, 285–290. [Google Scholar] [CrossRef]
- Fan, G.; Martinowich, K.; Chin, M.H.; He, F.; Fouse, S.D.; Hutnick, L.; Hattori, D.; Ge, W.; Shen, Y.; Wu, H.; et al. DNA methylation controls the timing of astrogliogenesis through regulation of JAK-STAT signaling. Development 2005, 132, 3345–3356. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, S.; Meletis, K.; Fu, D.; Jhaveri, S.; Jaenisch, R. Ablation of de novo DNA methyltransferase Dnmt3a in the nervous system leads to neuromuscular defects and shortened lifespan. Dev. Dyn. 2007, 236, 1663–1676. [Google Scholar] [CrossRef] [PubMed]
- Globisch, D.; Munzel, M.; Muller, M.; Michalakis, S.; Wagner, M.; Koch, S.; Bruckl, T.; Biel, M.; Carell, T. Tissue distribution of 5-hydroxymethylcytosine and search for active demethylation intermediates. PLoS ONE 2010, 5, e15367. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.; Wang, J.; Su, Y.; Guerrero, C.; Zeng, Y.; Mitra, D.; Brooks, P.J.; Fisher, D.E.; Song, H.; Wang, Y. Quantitative assessment of Tet-induced oxidation products of 5-methylcytosine in cellular and tissue DNA. Nucleic Acids Res 2013, 41, 6421–6429. [Google Scholar] [CrossRef]
- Kaas, G.A.; Zhong, C.; Eason, D.E.; Ross, D.L.; Vachhani, R.V.; Ming, G.L.; King, J.R.; Song, H.; Sweatt, J.D. TET1 controls CNS 5-methylcytosine hydroxylation, active DNA demethylation, gene transcription, and memory formation. Neuron 2013, 79, 1086–1093. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Wei, W.; Zhao, Q.Y.; Widagdo, J.; Baker-Andresen, D.; Flavell, C.R.; D’Alessio, A.; Zhang, Y.; Bredy, T.W. Neocortical Tet3-mediated accumulation of 5-hydroxymethylcytosine promotes rapid behavioral adaptation. Proc. Natl. Acad. Sci. USA 2014, 111, 7120–7125. [Google Scholar] [CrossRef] [Green Version]
- Mi, Y.; Gao, X.; Dai, J.; Ma, Y.; Xu, L.; Jin, W. A Novel Function of TET2 in CNS: Sustaining Neuronal Survival. Int. J. Mol. Sci. 2015, 16, 21846–21857. [Google Scholar] [CrossRef] [Green Version]
- Rudenko, A.; Dawlaty, M.M.; Seo, J.; Cheng, A.W.; Meng, J.; Le, T.; Faull, K.F.; Jaenisch, R.; Tsai, L.H. Tet1 is critical for neuronal activity-regulated gene expression and memory extinction. Neuron 2013, 79, 1109–1122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Yao, B.; Chen, L.; Kang, Y.; Li, Y.; Cheng, Y.; Li, L.; Lin, L.; Wang, Z.; Wang, M.; et al. Ten-eleven translocation 2 interacts with forkhead box O3 and regulates adult neurogenesis. Nat. Commun. 2017, 8, 15903. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Su, Y.; Shin, J.; Zhong, C.; Guo, J.U.; Weng, Y.L.; Gao, F.; Geschwind, D.H.; Coppola, G.; Ming, G.L.; et al. Tet3 regulates synaptic transmission and homeostatic plasticity via DNA oxidation and repair. Nat. Neurosci. 2015, 18, 836–843. [Google Scholar] [CrossRef] [Green Version]
- Lv, X.; Jiang, H.; Liu, Y.; Lei, X.; Jiao, J. MicroRNA-15b promotes neurogenesis and inhibits neural progenitor proliferation by directly repressing TET3 during early neocortical development. EMBO Rep. 2014, 15, 1305–1314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, H.; Miao, Z.; Wang, H.; Tao, Y.; Yang, J.; Cai, J.; Wang, J.; Wang, Y. DNA hydroxymethylation mediated traumatic spinal injury by influencing cell death-related gene expression. J. Cell Biochem. 2018, 119, 9295–9302. [Google Scholar] [CrossRef] [PubMed]
- Weng, Y.L.; Joseph, J.; An, R.; Song, H.; Ming, G.L. Epigenetic regulation of axonal regenerative capacity. Epigenomics 2016, 8, 1429–1442. [Google Scholar] [CrossRef]
- Weng, Y.L.; An, R.; Cassin, J.; Joseph, J.; Mi, R.; Wang, C.; Zhong, C.; Jin, S.G.; Pfeifer, G.P.; Bellacosa, A.; et al. An Intrinsic Epigenetic Barrier for Functional Axon Regeneration. Neuron 2017, 94, 337–346. [Google Scholar] [CrossRef] [Green Version]
- Barker, S.J.; Tsai, L.H. MethyLock: DNA Demethylation Is the Epigenetic Key to Axon Regeneration. Neuron 2017, 94, 221–223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kruse, F.; Bosse, F.; Vogelaar, C.F.; Brazda, N.; Kury, P.; Gasis, M.; Muller, H.W. Cortical gene expression in spinal cord injury and repair: Insight into the functional complexity of the neural regeneration program. Front. Mol. Neurosci. 2011, 4, 26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mukhamedshina, Y.O.; Akhmetzyanova, E.R.; Martynova, E.V.; Khaiboullina, S.F.; Galieva, L.R.; Rizvanov, A.A. Systemic and Local Cytokine Profile following Spinal Cord Injury in Rats: A Multiplex Analysis. Front. Neurol. 2017, 8, 581. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boato, F.; Rosenberger, K.; Nelissen, S.; Geboes, L.; Peters, E.M.; Nitsch, R.; Hendrix, S. Absence of IL-1beta positively affects neurological outcome, lesion development and axonal plasticity after spinal cord injury. J. Neuroinflamm. 2013, 10, 6. [Google Scholar] [CrossRef]
- Liu, X.; Williams, P.R.; He, Z. SOCS3: A common target for neuronal protection and axon regeneration after spinal cord injury. Exp. Neurol. 2015, 263, 364–367. [Google Scholar] [CrossRef]
- Winkler, C.; Yao, S. The midkine family of growth factors: Diverse roles in nervous system formation and maintenance. Br. J. Pharmacol. 2014, 171, 905–912. [Google Scholar] [CrossRef] [Green Version]
- Lo, U.; Selvaraj, V.; Plane, J.M.; Chechneva, O.V.; Otsu, K.; Deng, W. p38alpha (MAPK14) critically regulates the immunological response and the production of specific cytokines and chemokines in astrocytes. Sci. Rep. 2014, 4, 7405. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baker, B.J.; Akhtar, L.N.; Benveniste, E.N. SOCS1 and SOCS3 in the control of CNS immunity. Trends Immunol. 2009, 30, 392–400. [Google Scholar] [CrossRef] [Green Version]
- Carow, B.; Rottenberg, M.E. SOCS3, a Major Regulator of Infection and Inflammation. Front. Immunol. 2014, 5, 58. [Google Scholar] [CrossRef] [Green Version]
- Huang, Z.; Wang, Y.; Hu, G.; Zhou, J.; Mei, L.; Xiong, W.C. YAP Is a Critical Inducer of SOCS3, Preventing Reactive Astrogliosis. Cereb. Cortex. 2016, 26, 2299–2310. [Google Scholar] [CrossRef] [Green Version]
- Fraser, M.M.; Zhu, X.; Kwon, C.H.; Uhlmann, E.J.; Gutmann, D.H.; Baker, S.J. Pten loss causes hypertrophy and increased proliferation of astrocytes in vivo. Cancer Res. 2004, 64, 7773–7779. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.Y.; Choi, H.Y.; Yune, T.Y. Fluoxetine and vitamin C synergistically inhibits blood-spinal cord barrier disruption and improves functional recovery after spinal cord injury. Neuropharmacology 2016, 109, 78–87. [Google Scholar] [CrossRef] [PubMed]
- Hosseini, M.; Sarveazad, A.; Babahajian, A.; Baikpour, M.; Vaccaro, A.R.; Chapman, J.R.; Yousefifard, M.; Rahimi-Movaghar, V. Effect of vitamins C and E on recovery of motor function after spinal cord injury: Systematic review and meta-analysis of animal studies. Nutr. Rev. 2019. [Google Scholar] [CrossRef] [PubMed]
- Gilgun-Sherki, Y.; Rosenbaum, Z.; Melamed, E.; Offen, D. Antioxidant therapy in acute central nervous system injury: Current state. Pharmacol. Rev. 2002, 54, 271–284. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Li, Y.; Fan, Z.; Wang, X.; Li, Z.; Wen, J.; Deng, J.; Tan, D.; Pan, M.; Hu, X.; et al. Ascorbic Acid Facilitates Neural Regeneration After Sciatic Nerve Crush Injury. Front. Cell Neurosci. 2019, 13, 108. [Google Scholar] [CrossRef]
- Tyurin, V.A.; Tyurina, Y.Y.; Borisenko, G.G.; Sokolova, T.V.; Ritov, V.B.; Quinn, P.J.; Rose, M.; Kochanek, P.; Graham, S.H.; Kagan, V.E. Oxidative stress following traumatic brain injury in rats: Quantitation of biomarkers and detection of free radical intermediates. J. Neurochem. 2000, 75, 2178–2189. [Google Scholar] [CrossRef] [Green Version]
- Visavadiya, N.P.; Patel, S.P.; VanRooyen, J.L.; Sullivan, P.G.; Rabchevsky, A.G. Cellular and subcellular oxidative stress parameters following severe spinal cord injury. Redox. Biol. 2016, 8, 59–67. [Google Scholar] [CrossRef] [Green Version]
- Hausmann, O.N. Post-traumatic inflammation following spinal cord injury. Spinal Cord 2003, 41, 369–378. [Google Scholar] [CrossRef]
- Sestili, M.A. Possible adverse health effects of vitamin C and ascorbic acid. Semin. Oncol. 1983, 10, 299–304. [Google Scholar]
- Mallory, M.A.; Sthapanachai, C.; Kowdley, K.V. Iron overload related to excessive vitamin C intake. Ann. Intern Med. 2003, 139, 532–533. [Google Scholar] [CrossRef] [Green Version]
- Torti, S.V.; Torti, F.M. Iron and cancer: More ore to be mined. Nat. Rev. Cancer 2013, 13, 342–355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Porto, G.; De Sousa, M. Iron overload and immunity. World J. Gastroenterol. 2007, 13, 4707–4715. [Google Scholar] [CrossRef] [PubMed]
- Schaible, U.E.; Kaufmann, S.H. Iron and microbial infection. Nat. Rev. Microbiol. 2004, 2, 946–953. [Google Scholar] [CrossRef] [PubMed]
- Nasr, S.H.; Kashtanova, Y.; Levchuk, V.; Markowitz, G.S. Secondary oxalosis due to excess vitamin C intake. Kidney Int. 2006, 70, 1672. [Google Scholar] [CrossRef] [Green Version]
- Blaschke, K.; Ebata, K.T.; Karimi, M.M.; Zepeda-Martinez, J.A.; Goyal, P.; Mahapatra, S.; Tam, A.; Laird, D.J.; Hirst, M.; Rao, A.; et al. Vitamin C induces Tet-dependent DNA demethylation and a blastocyst-like state in ES cells. Nature 2013, 500, 222–226. [Google Scholar] [CrossRef]
- Yin, R.; Mao, S.Q.; Zhao, B.; Chong, Z.; Yang, Y.; Zhao, C.; Zhang, D.; Huang, H.; Gao, J.; Li, Z.; et al. Ascorbic acid enhances Tet-mediated 5-methylcytosine oxidation and promotes DNA demethylation in mammals. J. Am. Chem. Soc. 2013, 135, 10396–10403. [Google Scholar] [CrossRef]
- Wang, T.; Chen, K.; Zeng, X.; Yang, J.; Wu, Y.; Shi, X.; Qin, B.; Zeng, L.; Esteban, M.A.; Pan, G.; et al. The histone demethylases Jhdm1a/1b enhance somatic cell reprogramming in a vitamin-C-dependent manner. Cell Stem. Cell 2011, 9, 575–587. [Google Scholar] [CrossRef] [Green Version]
- Yi, C.; Jia, G.; Hou, G.; Dai, Q.; Zhang, W.; Zheng, G.; Jian, X.; Yang, C.G.; Cui, Q.; He, C. Iron-catalysed oxidation intermediates captured in a DNA repair dioxygenase. Nature 2010, 468, 330–333. [Google Scholar] [CrossRef]
- Gorres, K.L.; Raines, R.T. Prolyl 4-hydroxylase. Crit. Rev. Biochem. Mol. Biol. 2010, 45, 106–124. [Google Scholar] [CrossRef]
- Bayraktar, G.; Kreutz, M.R. The Role of Activity-Dependent DNA Demethylation in the Adult Brain and in Neurological Disorders. Front. Mol. Neurosci. 2018, 11, 169. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer | Reverse Primer |
---|---|---|
Cd44 | gctatctgtgcagccaacaa | aagaggagctgaggcattga |
IL-1β | cacctctcaagcagagcacag | gggttccatggtgaagtcaac |
IL-6 | accacccacaacagaccagt | cagaattgccattgcacaac |
TNF-α | ctcaagccctggtatgagcc | ggctgggtagagaacggatg |
Mapk14 | gagctgttgaccggaagaac | tgagataagcagggggtgtc |
Socs3 | ccccgctttgactgtgtact | ctgctcctgaacctcaaagg |
Igf1 | cacactgacatgcccaagac | gggaggctcctcctacattc |
Mdk | cctgaagaaggctcggtaca | ctttcttggctttggccttt |
Tuba1a | cactacaccattggcaagga | gctgtggaaaaccaagaagc |
Klf4 | ctttcctgccagaccagatg | ggtttctcgcctgtgtgagt |
Ntrk2 | caagctgacgagtttgtcca | gagccacatgatgtcacagg |
Sema3a | ttctggatgaggaacggagt | tggccacacaatcttttgaa |
PTEN | acaagaggccctggattttt | gggtcctgagttggaggagt |
Rock2 | agccccctgcaaagtttatt | caccaaccgactaacccatt |
Wnt4 | cctttgcagtgacaagagca | ctgaccactggaaaccctgt |
Wnt5a | gcagcacagtggacaacact | tcatggcatttaccactcca |
DNMT1 | gtgtgcgggaatgtgctcgct | cagtggtggtggcacagcgt |
DNMT3a | agcaaagtgaggaccattaccacca | tgtgtagtggacagggaagcca |
DNMT3b | tggcaaggatgacgttctgtggt | ctggcacactccaggaccttcc |
Tet1 | ggcttgcagacactgatgaa | gaaacacagtcgcctcttcc |
Tet2 | ggggttggagcaagtacaaa | cgggtgtgtgtcatttgaag |
Tet3 | agtgggtgatccgaagacac | gccaggatcaagatgacgat |
GAPDH | cactgagcatctccctcaca | gagggtgcagcgaactttat |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hong, J.Y.; Davaa, G.; Yoo, H.; Hong, K.; Hyun, J.K. Ascorbic Acid Promotes Functional Restoration after Spinal Cord Injury Partly by Epigenetic Modulation. Cells 2020, 9, 1310. https://doi.org/10.3390/cells9051310
Hong JY, Davaa G, Yoo H, Hong K, Hyun JK. Ascorbic Acid Promotes Functional Restoration after Spinal Cord Injury Partly by Epigenetic Modulation. Cells. 2020; 9(5):1310. https://doi.org/10.3390/cells9051310
Chicago/Turabian StyleHong, Jin Young, Ganchimeg Davaa, Hyunjin Yoo, Kwonho Hong, and Jung Keun Hyun. 2020. "Ascorbic Acid Promotes Functional Restoration after Spinal Cord Injury Partly by Epigenetic Modulation" Cells 9, no. 5: 1310. https://doi.org/10.3390/cells9051310
APA StyleHong, J. Y., Davaa, G., Yoo, H., Hong, K., & Hyun, J. K. (2020). Ascorbic Acid Promotes Functional Restoration after Spinal Cord Injury Partly by Epigenetic Modulation. Cells, 9(5), 1310. https://doi.org/10.3390/cells9051310