Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct
Abstract
1. Introduction
2. Materials and Methods
2.1. cDNA Construction of Rat SNX27
2.2. Purification of Recombinant SNX27 Protein
2.3. Purification of Recombinant His6X-FLAG-AQP2c Fusion Protein
2.4. Interaction of Recombinant SNX27 Proteins and AQP2c Protein In Vitro
2.5. Co-Immunoprecipitation
2.6. Immunofluorescence Microscopy and Quantification of Co-Localization
2.7. Primary Culture of Inner Medullary Collecting Duct (IMCD) Cells from the Rat Kidney
2.8. Real-Time Quantitative PCR
2.9. Semiquantitative Immunoblotting in mpkCCDc14 Cells with SNX27 Knockdown
2.10. Cell Surface Biotinylation Assay
2.11. Lithium-Induced Nephrogenic Diabetes Insipidus in Rats
2.12. Statistical Analysis
3. Results
3.1. Interaction between AQP2 and SNX27
3.2. Immunocytochemistry and Immunohistochemistry of AQP2 and SNX27 in HeLa Cells and Rat Kidneys
3.3. Changes in AQP2 Protein Abundance in mpkCCDc14 Cells with siRNA-Mediated SNX27 Knockdown
3.4. Changes in dDAVP-Induced Cell Surface Expression of AQP2 in mpkCCDc14 Cells with siRNA-Mediated Knockdown of SNX27
3.5. Autophagy in mpkCCDc14 Cells with siRNA-Mediated Knockdown of SNX27 and Changes in SNX27 Protein Abundance in Lithium-Induced Nephrogenic Diabetes Insipidus
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Jung, H.J.; Kwon, T.H. Molecular mechanisms regulating aquaporin-2 in kidney collecting duct. Am. J. Physiol. Renal Physiol. 2016, 311, F1318–F1328. [Google Scholar] [CrossRef] [PubMed]
- Knepper, M.A.; Kwon, T.H.; Nielsen, S. Molecular physiology of water balance. N. Engl. J. Med. 2015, 372, 1349–1358. [Google Scholar] [CrossRef]
- Fenton, R.A.; Pedersen, C.N.; Moeller, H.B. New insights into regulated aquaporin-2 function. Curr. Opin. Nephrol. Hypertens. 2013, 22, 551–558. [Google Scholar] [CrossRef]
- Promeneur, D.; Kwon, T.H.; Frokiaer, J.; Knepper, M.A.; Nielsen, S. Vasopressin V(2)-receptor-dependent regulation of AQP2 expression in Brattleboro rats. Am. J. Physiol. Renal Physiol. 2000, 279, F370–F382. [Google Scholar] [CrossRef] [PubMed]
- Ranieri, M.; Di Mise, A.; Tamma, G.; Valenti, G. Vasopressin-aquaporin-2 pathway: Recent advances in understanding water balance disorders. F1000Research 2019, 8. [Google Scholar] [CrossRef] [PubMed]
- Kwon, T.H.; Nielsen, J.; Moller, H.B.; Fenton, R.A.; Nielsen, S.; Frokiaer, J. Aquaporins in the kidney. Handb. Exp. Pharmacol. 2009, 95–132. [Google Scholar] [CrossRef]
- Hoffert, J.D.; Fenton, R.A.; Moeller, H.B.; Simons, B.; Tchapyjnikov, D.; McDill, B.W.; Yu, M.J.; Pisitkun, T.; Chen, F.; Knepper, M.A. Vasopressin-stimulated increase in phosphorylation at Ser269 potentiates plasma membrane retention of aquaporin-2. J. Biol. Chem. 2008, 283, 24617–24627. [Google Scholar] [CrossRef] [PubMed]
- Nedvetsky, P.I.; Tamma, G.; Beulshausen, S.; Valenti, G.; Rosenthal, W.; Klussmann, E. Regulation of aquaporin-2 trafficking. Handb. Exp. Pharmacol. 2009, 133–157. [Google Scholar] [CrossRef]
- Cheung, P.W.; Bouley, R.; Brown, D. Targeting the Trafficking of Kidney Water Channels for Therapeutic Benefit. Annu. Rev. Pharmacol. Toxicol. 2020, 60, 175–194. [Google Scholar] [CrossRef]
- Jung, H.J.; Kwon, T.H. New insights into the transcriptional regulation of aquaporin-2 and the treatment of X-linked hereditary nephrogenic diabetes insipidus. Kidney Res. Clin. Pract. 2019, 38, 145–158. [Google Scholar] [CrossRef]
- Sandoval, P.C.; Slentz, D.H.; Pisitkun, T.; Saeed, F.; Hoffert, J.D.; Knepper, M.A. Proteome-wide measurement of protein half-lives and translation rates in vasopressin-sensitive collecting duct cells. J. Am. Soc. Nephrol. 2013, 24, 1793–1805. [Google Scholar] [CrossRef] [PubMed]
- Moeller, H.B.; Aroankins, T.S.; Slengerik-Hansen, J.; Pisitkun, T.; Fenton, R.A. Phosphorylation and ubiquitylation are opposing processes that regulate endocytosis of the water channel aquaporin-2. J. Cell Sci. 2014, 127, 3174–3183. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Moeller, H.B.; Stevens, D.A.; Sanchez-Hodge, R.; Childers, G.; Kortenoeven, M.L.A.; Cheng, L.; Rosenbaek, L.L.; Rubel, C.; Patterson, C.; et al. CHIP Regulates Aquaporin-2 Quality Control and Body Water Homeostasis. J. Am. Soc. Nephrol. 2018, 29, 936–948. [Google Scholar] [CrossRef]
- Lee, Y.J.; Lee, J.E.; Choi, H.J.; Lim, J.S.; Jung, H.J.; Baek, M.C.; Frokiaer, J.; Nielsen, S.; Kwon, T.H. E3 ubiquitin-protein ligases in rat kidney collecting duct: Response to vasopressin stimulation and withdrawal. Am. J. Physiol. Renal Physiol. 2011, 301, F883–F896. [Google Scholar] [CrossRef]
- Noda, Y.; Horikawa, S.; Furukawa, T.; Hirai, K.; Katayama, Y.; Asai, T.; Kuwahara, M.; Katagiri, K.; Kinashi, T.; Hattori, M.; et al. Aquaporin-2 trafficking is regulated by PDZ-domain containing protein SPA-1. FEBS Lett. 2004, 568, 139–145. [Google Scholar] [CrossRef] [PubMed]
- Boone, M.; Deen, P.M. Physiology and pathophysiology of the vasopressin-regulated renal water reabsorption. Pflugers Arch. 2008, 456, 1005–1024. [Google Scholar] [CrossRef]
- Moeller, H.B.; Olesen, E.T.; Fenton, R.A. Regulation of the water channel aquaporin-2 by posttranslational modification. Am. J. Physiol. Renal Physiol. 2011, 300, F1062–F1073. [Google Scholar] [CrossRef]
- Kuwahara, M.; Asai, T.; Terada, Y.; Sasaki, S. The C-terminal tail of aquaporin-2 determines apical trafficking. Kidney Int. 2005, 68, 1999–2009. [Google Scholar] [CrossRef]
- Wang, P.J.; Lin, S.T.; Liu, S.H.; Kuo, K.T.; Hsu, C.H.; Knepper, M.A.; Yu, M.J. Vasopressin-induced serine 269 phosphorylation reduces Sipa1l1 (signal-induced proliferation-associated 1 like 1)-mediated aquaporin-2 endocytosis. J. Biol. Chem. 2017, 292, 7984–7993. [Google Scholar] [CrossRef]
- Seaman, M.N. The retromer complex—Endosomal protein recycling and beyond. J. Cell Sci. 2012, 125, 4693–4702. [Google Scholar] [CrossRef]
- Hierro, A.; Rojas, A.L.; Rojas, R.; Murthy, N.; Effantin, G.; Kajava, A.V.; Steven, A.C.; Bonifacino, J.S.; Hurley, J.H. Functional architecture of the retromer cargo-recognition complex. Nature 2007, 449, 1063–1067. [Google Scholar] [CrossRef] [PubMed]
- Abubakar, Y.S.; Zheng, W.; Olsson, S.; Zhou, J. Updated Insight into the Physiological and Pathological Roles of the Retromer Complex. Int. J. Mol. Sci. 2017, 18, 1601. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.S.; Choi, H.J.; Park, E.J.; Park, H.J.; Kwon, T.H. Depletion of vacuolar protein sorting-associated protein 35 is associated with increased lysosomal degradation of aquaporin-2. Am. J. Physiol. Renal Physiol. 2016, 311, F1294–F1307. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.L.; Su, S.H.; Wong, K.Y.; Yang, C.W.; Liu, C.F.; Yu, M.J. Rab7 involves Vps35 to mediate AQP2 sorting and apical trafficking in the collecting duct cells. Am. J. Physiol. Renal Physiol. 2020. [Google Scholar] [CrossRef]
- Van Weering, J.R.; Cullen, P.J. Membrane-associated cargo recycling by tubule-based endosomal sorting. Semin. Cell Dev. Biol. 2014, 31, 40–47. [Google Scholar] [CrossRef]
- Ghai, R.; Bugarcic, A.; Liu, H.; Norwood, S.J.; Skeldal, S.; Coulson, E.J.; Li, S.S.; Teasdale, R.D.; Collins, B.M. Structural basis for endosomal trafficking of diverse transmembrane cargos by PX-FERM proteins. Proc. Natl. Acad. Sci. USA 2013, 110, E643–E652. [Google Scholar] [CrossRef]
- Steinberg, F.; Gallon, M.; Winfield, M.; Thomas, E.C.; Bell, A.J.; Heesom, K.J.; Tavare, J.M.; Cullen, P.J. A global analysis of SNX27-retromer assembly and cargo specificity reveals a function in glucose and metal ion transport. Nat. Cell Biol. 2013, 15, 461–471. [Google Scholar] [CrossRef]
- Temkin, P.; Lauffer, B.; Jager, S.; Cimermancic, P.; Krogan, N.J.; von Zastrow, M. SNX27 mediates retromer tubule entry and endosome-to-plasma membrane trafficking of signalling receptors. Nat. Cell Biol. 2011, 13, 715–721. [Google Scholar] [CrossRef]
- McGarvey, J.C.; Xiao, K.; Bowman, S.L.; Mamonova, T.; Zhang, Q.; Bisello, A.; Sneddon, W.B.; Ardura, J.A.; Jean-Alphonse, F.; Vilardaga, J.P.; et al. Actin-Sorting Nexin 27 (SNX27)-Retromer Complex Mediates Rapid Parathyroid Hormone Receptor Recycling. J. Biol. Chem. 2016, 291, 10986–11002. [Google Scholar] [CrossRef]
- Gallon, M.; Clairfeuille, T.; Steinberg, F.; Mas, C.; Ghai, R.; Sessions, R.B.; Teasdale, R.D.; Collins, B.M.; Cullen, P.J. A unique PDZ domain and arrestin-like fold interaction reveals mechanistic details of endocytic recycling by SNX27-retromer. Proc. Natl. Acad. Sci. USA 2014, 111, E3604–E3613. [Google Scholar] [CrossRef]
- Shinde, S.R.; Maddika, S. PTEN Regulates Glucose Transporter Recycling by Impairing SNX27 Retromer Assembly. Cell Rep. 2017, 21, 1655–1666. [Google Scholar] [CrossRef] [PubMed]
- Singh, V.; Yang, J.; Cha, B.; Chen, T.E.; Sarker, R.; Yin, J.; Avula, L.R.; Tse, M.; Donowitz, M. Sorting nexin 27 regulates basal and stimulated brush border trafficking of NHE3. Mol. Biol. Cell 2015, 26, 2030–2043. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.J.; Jung, H.J.; Kwon, T.H. Extracellular pH affects phosphorylation and intracellular trafficking of AQP2 in inner medullary collecting duct cells. Am. J. Physiol. Renal Physiol. 2015, 308, F737–F748. [Google Scholar] [CrossRef] [PubMed]
- Chou, C.L.; Christensen, B.M.; Frische, S.; Vorum, H.; Desai, R.A.; Hoffert, J.D.; de Lanerolle, P.; Nielsen, S.; Knepper, M.A. Non-muscle myosin II and myosin light chain kinase are downstream targets for vasopressin signaling in the renal collecting duct. J. Biol. Chem. 2004, 279, 49026–49035. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, J.; Kwon, T.H.; Frokiaer, J.; Knepper, M.A.; Nielsen, S. Maintained ENaC trafficking in aldosterone-infused rats during mineralocorticoid and glucocorticoid receptor blockade. Am. J. Physiol. Renal Physiol. 2007, 292, F382–F394. [Google Scholar] [CrossRef]
- Song, K.; Gras, C.; Capin, G.; Gimber, N.; Lehmann, M.; Mohd, S.; Puchkov, D.; Rodiger, M.; Wilhelmi, I.; Daumke, O.; et al. A SEPT1-based scaffold is required for Golgi integrity and function. J. Cell Sci. 2019, 132. [Google Scholar] [CrossRef]
- Lee, S.; Chang, J.; Blackstone, C. FAM21 directs SNX27-retromer cargoes to the plasma membrane by preventing transport to the Golgi apparatus. Nat. Commun. 2016, 7, 10939. [Google Scholar] [CrossRef]
- Jung, H.J.; Kim, S.Y.; Choi, H.J.; Park, E.J.; Lim, J.S.; Frokiaer, J.; Nielsen, S.; Kwon, T.H. Tankyrase-mediated beta-catenin activity regulates vasopressin-induced AQP2 expression in kidney collecting duct mpkCCDc14 cells. Am. J. Physiol. Renal Physiol. 2015, 308, F473–F486. [Google Scholar] [CrossRef]
- Kim, J.E.; Jung, H.J.; Lee, Y.J.; Kwon, T.H. Vasopressin-regulated miRNAs and AQP2-targeting miRNAs in kidney collecting duct cells. Am. J. Physiol. Renal Physiol. 2015, 308, F749–F764. [Google Scholar] [CrossRef]
- Tingskov, S.J.; Hu, S.; Frokiaer, J.; Kwon, T.H.; Wang, W.; Norregaard, R. Tamoxifen attenuates development of lithium-induced nephrogenic diabetes insipidus in rats. Am. J. Physiol. Renal Physiol. 2018, 314, F1020–F1025. [Google Scholar] [CrossRef]
- Tingskov, S.J.; Kwon, T.H.; Frokiaer, J.; Norregaard, R. Tamoxifen Decreases Lithium-Induced Natriuresis in Rats With Nephrogenic Diabetes Insipidus. Front Physiol. 2018, 9, 903. [Google Scholar] [CrossRef] [PubMed]
- Kimura, S.; Noda, T.; Yoshimori, T. Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy 2007, 3, 452–460. [Google Scholar] [CrossRef] [PubMed]
- Gong, R.; Wang, P.; Dworkin, L. What we need to know about the effect of lithium on the kidney. Am. J. Physiol. Renal Physiol. 2016, 311, F1168–F1171. [Google Scholar] [CrossRef] [PubMed]
- Motoi, Y.; Shimada, K.; Ishiguro, K.; Hattori, N. Lithium and autophagy. ACS Chem. Neurosci. 2014, 5, 434–442. [Google Scholar] [CrossRef] [PubMed]
- Stephenson, E.M. Locomotory invasion of human cervical epithelium and avian fibroblasts by HeLa cells in vitro. J. Cell Sci. 1982, 57, 293–314. [Google Scholar] [PubMed]
- Cui, Y.; Carosi, J.M.; Yang, Z.; Ariotti, N.; Kerr, M.C.; Parton, R.G.; Sargeant, T.J.; Teasdale, R.D. Retromer has a selective function in cargo sorting via endosome transport carriers. J. Cell Biol. 2019, 218, 615–631. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Wang, X.; Fujioka, H.; Hoppel, C.; Whone, A.L.; Caldwell, M.A.; Cullen, P.J.; Liu, J.; Zhu, X. Parkinson’s disease-associated mutant VPS35 causes mitochondrial dysfunction by recycling DLP1 complexes. Nat. Med. 2016, 22, 54–63. [Google Scholar] [CrossRef]
- Binda, C.S.; Nakamura, Y.; Henley, J.M.; Wilkinson, K.A. Sorting nexin 27 rescues neuroligin 2 from lysosomal degradation to control inhibitory synapse number. Biochem. J. 2019, 476, 293–306. [Google Scholar] [CrossRef]
- Kvainickas, A.; Orgaz, A.J.; Nagele, H.; Diedrich, B.; Heesom, K.J.; Dengjel, J.; Cullen, P.J.; Steinberg, F. Retromer- and WASH-dependent sorting of nutrient transporters requires a multivalent interaction network with ANKRD50. J. Cell Sci. 2017, 130, 382–395. [Google Scholar] [CrossRef]
- Clairfeuille, T.; Mas, C.; Chan, A.S.; Yang, Z.; Tello-Lafoz, M.; Chandra, M.; Widagdo, J.; Kerr, M.C.; Paul, B.; Merida, I.; et al. A molecular code for endosomal recycling of phosphorylated cargos by the SNX27-retromer complex. Nat. Struct. Mol. Biol. 2016, 23, 921–932. [Google Scholar] [CrossRef]
- Yang, Z.; Follett, J.; Kerr, M.C.; Clairfeuille, T.; Chandra, M.; Collins, B.M.; Teasdale, R.D. Sorting nexin 27 (SNX27) regulates the trafficking and activity of the glutamine transporter ASCT2. J. Biol. Chem. 2018, 293, 6802–6811. [Google Scholar] [CrossRef] [PubMed]
- Klionsky, D.J.; Emr, S.D. Autophagy as a regulated pathway of cellular degradation. Science 2000, 290, 1717–1721. [Google Scholar] [CrossRef] [PubMed]
- Timmer, R.T.; Sands, J.M. Lithium intoxication. J. Am. Soc. Nephrol. 1999, 10, 666–674. [Google Scholar] [PubMed]
- Kwon, T.H.; Laursen, U.H.; Marples, D.; Maunsbach, A.B.; Knepper, M.A.; Frokiaer, J.; Nielsen, S. Altered expression of renal AQPs and Na(+) transporters in rats with lithium-induced NDI. Am. J. Physiol. Renal Physiol. 2000, 279, F552–F564. [Google Scholar] [CrossRef]
- Nielsen, J.; Kwon, T.H.; Christensen, B.M.; Frokiaer, J.; Nielsen, S. Dysregulation of renal aquaporins and epithelial sodium channel in lithium-induced nephrogenic diabetes insipidus. Semin. Nephrol. 2008, 28, 227–244. [Google Scholar] [CrossRef]
- Christensen, B.M.; Kim, Y.H.; Kwon, T.H.; Nielsen, S. Lithium treatment induces a marked proliferation of primarily principal cells in rat kidney inner medullary collecting duct. Am. J. Physiol. Renal Physiol. 2006, 291, F39–F48. [Google Scholar] [CrossRef]
- Bao, H.; Zhang, Q.; Liu, X.; Song, Y.; Li, X.; Wang, Z.; Li, C.; Peng, A.; Gong, R. Lithium targeting of AMPK protects against cisplatin-induced acute kidney injury by enhancing autophagy in renal proximal tubular epithelial cells. FASEB J. 2019, 33, 14370–14381. [Google Scholar] [CrossRef]
- Khositseth, S.; Uawithya, P.; Somparn, P.; Charngkaew, K.; Thippamom, N.; Hoffert, J.D.; Saeed, F.; Michael Payne, D.; Chen, S.H.; Fenton, R.A.; et al. Autophagic degradation of aquaporin-2 is an early event in hypokalemia-induced nephrogenic diabetes insipidus. Sci. Rep. 2015, 5, 18311. [Google Scholar] [CrossRef]
- Khositseth, S.; Charngkaew, K.; Boonkrai, C.; Somparn, P.; Uawithya, P.; Chomanee, N.; Payne, D.M.; Fenton, R.A.; Pisitkun, T. Hypercalcemia induces targeted autophagic degradation of aquaporin-2 at the onset of nephrogenic diabetes insipidus. Kidney Int. 2017, 91, 1070–1087. [Google Scholar] [CrossRef]
- Christensen, S.; Kusano, E.; Yusufi, A.N.; Murayama, N.; Dousa, T.P. Pathogenesis of nephrogenic diabetes insipidus due to chronic administration of lithium in rats. J. Clin. Investig. 1985, 75, 1869–1879. [Google Scholar] [CrossRef]
- Nedvetsky, P.I.; Stefan, E.; Frische, S.; Santamaria, K.; Wiesner, B.; Valenti, G.; Hammer, J.A., 3rd; Nielsen, S.; Goldenring, J.R.; Rosenthal, W.; et al. A Role of myosin Vb and Rab11-FIP2 in the aquaporin-2 shuttle. Traffic 2007, 8, 110–123. [Google Scholar] [CrossRef] [PubMed]












| Construct | pGEX-4T-1 Vector Primer Sequence (5′-3′) | p3XFLAG-CMV-10 Vector Primer Sequence (5′-3′) | |
|---|---|---|---|
| SNX-Full Length | F | GGTTCCGCGTGGATCCATGGCGGACGAGGACGGG | TGACGATGACAAGCTTATGGCGGACGAGGACGGG |
| R | GATGCGGCCGCTCGAGCTAGGTGGCCACATCCCT | TCGCGGCCGCAAGCTTCTAGGTGGCCACATCCCT | |
| SNX27-Δ(PX+FERM) | F | GGTTCCGCGTGGATCCATGGCGGACGAGGACGGG | TGACGATGACAAGCTTATGGCGGACGAGGACGGG |
| R | GATGCGGCCGCTCGAGCTATGTGTAATCATAAAATGATTG | TCGCGGCCGCAAGCTTCTATGTGTAATCATAAAATGATTGTCCCAAG | |
| SNX27-ΔFERM | F | GGTTCCGCGTGGATCCATGGCGGACGAGGACGGG | TGACGATGACAAGCTTATGGCGGACGAGGACGGG |
| R | GATGCGGCCGCTCGAGCTAATTCTCATCAGATTCTGACAG | TCGCGGCCGCAAGCTTCTAATTCTCATCAGATTCTGACAGGAAC | |
| SNX27-ΔPDZ | F | GGTTCCGCGTGGATCCAAGCAAGCAGTGCCCATA | TGACGATGACAAGCTTATGAAGCAAGCAGTGCCCATA |
| R | GATGCGGCCGCTCGAGCTAGGTGGCCACATCCCT | TCGCGGCCGCAAGCTTCTAGGTGGCCACATCCCT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, H.-J.; Jang, H.-J.; Park, E.; Tingskov, S.J.; Nørregaard, R.; Jung, H.J.; Kwon, T.-H. Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct. Cells 2020, 9, 1208. https://doi.org/10.3390/cells9051208
Choi H-J, Jang H-J, Park E, Tingskov SJ, Nørregaard R, Jung HJ, Kwon T-H. Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct. Cells. 2020; 9(5):1208. https://doi.org/10.3390/cells9051208
Chicago/Turabian StyleChoi, Hyo-Jung, Hyo-Ju Jang, Euijung Park, Stine Julie Tingskov, Rikke Nørregaard, Hyun Jun Jung, and Tae-Hwan Kwon. 2020. "Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct" Cells 9, no. 5: 1208. https://doi.org/10.3390/cells9051208
APA StyleChoi, H.-J., Jang, H.-J., Park, E., Tingskov, S. J., Nørregaard, R., Jung, H. J., & Kwon, T.-H. (2020). Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct. Cells, 9(5), 1208. https://doi.org/10.3390/cells9051208

