Next Article in Journal
Development of a Breast-on-a-Chip Microfluidic Model to Assess the Effect of Palbociclib in MCF-7 and T47D Cancer Cells
Next Article in Special Issue
Neutrophil Extracellular Traps in Viral Infections: Regulation, Immune Consequences, and Pathogenic Outcomes
Previous Article in Journal
Administration of Nicotinamide Mononucleotide Mitigates the HIV Nef-Induced Metabolic and Pathological Changes in the Heart
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 15
Issue 5
10.3390/cells15050445
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Glucocorticoid Receptor and Cell Cycle Regulator (E2F2) Cooperatively Transactivate a Cis-Regulatory Module in the HSV-1 Infected Cell Protein 0 (ICP0) Promoter

by
Kaushalya Jayathilake
,
Vanessa Claire Santos
and
Clinton Jones
*
Department of Veterinary Pathobiology, College of Veterinary Medicine, Oklahoma State University, Stillwater, OK 74078, USA
*
Author to whom correspondence should be addressed.
Cells 2026, 15(5), 445; https://doi.org/10.3390/cells15050445
Submission received: 26 January 2026 / Revised: 24 February 2026 / Accepted: 25 February 2026 / Published: 2 March 2026
(This article belongs to the Special Issue Multifaceted Nature of Immune Responses to Viral Infection)
Browse Figures
Review Reports Versions Notes

Abstract

Human alpha-herpesvirus 1 (HSV-1) acute infection culminates in life-long latency in sensory neurons in trigeminal ganglia and certain neurons in the central nervous system. Previously, E2F family members and glucocorticoid receptor (GR) were shown to stimulate HSV-1 and bovine herpesvirus 1 (BoHV-1) replication. Consequently, we hypothesized GR and E2F family members activate certain HSV-l promoters. To test this hypothesis, we determined if four HSV-1 ICP0 cis-regulatory modules (CRM) upstream of the ICP0 promoter were activated by E2F. GR and E2F2, but not E2F1, E2F3a, or E2F3b, cooperatively transactivate the ICP0 CRM-C, but not CRM-A, -B, or -D fragments upstream of a minimal promoter in a luciferase reporter construct. CRM-C sequences contain two E2F consensus binding sites, a GC-rich motif that E2F2 can bind, and a consensus ½ GR response element (GRE) adjacent to the consensus E2F #2 binding site. Mutating the ½ GRE or the 3 E2F binding sites significantly reduced GR- and E2F2-mediated transactivation. Chromatin immunoprecipitation studies revealed E2F2 occupied ICP0 CRM-C sequences during productive infection and mutating the E2F binding sites prevented E2F2 binding. These studies reveal GR and E2F2 transactivate ICP0-promoter activity, which may enhance viral replication in certain cell types.

1. Introduction

HSV-1 acute infection of craniofacial mucosal surfaces culminates in life-long latency in certain neurons located in the trigeminal ganglia (TG), brainstem, and other regions in the central nervous system [1,2,3]. In contrast to lytic infection of permissive cells, viral protein expression in neurons is not readily detected during latency because the genome exists as a silent heterochromatin [4,5,6]. Periodically, HSV-1 reactivates from latency, which increases virus transmission and recurrent disease. Recurrent HSV-1 ocular disease, including herpetic stromal keratitis [7,8], and HSV-induced encephalitis [9,10] are the direct result of reactivation from latency.
E2F family members regulate the mammalian cell cycle [11,12]. These regulatory proteins contain a well-conserved DNA-binding motif; certain family members interact with the tumor suppressor Retinoblastoma (Rb) protein and contain transcriptional activation domains [12]. Rb family members are phosphorylated by cyclin-dependent kinase-cyclin complexes, which release E2F family members. E2F1, E2F2, and E2F3a generally activate transcription whereas E2F3b and E2F4-E2F8 family members impair transcription or have little to no effect on transcription [13,14,15,16]. Consensus E2F binding sites are present in promoters of many genes that regulate cell-cycle progression [13,14]. Previous studies reveal E2F family members mediate replication and gene expression of BoHV-1 [17] and HSV-1 replication in cultured cells [18].
Stress (acute or chronic), UV light, and heat stress increase the incidence of reactivation from latency in humans and mouse models of infection [19,20,21,22,23,24,25,26,27]. Stress generally leads to glucocorticoid receptor (GR) activation, reviewed in [28]. For example, UV light induces GR phosphorylation and transcriptional activation via ligand-independent mechanisms [29,30]. Heat stress also increases cortisol and activates GR [31]. Notably, GR activation correlates with increased HSV-1 gene expression in latently infected neurons [32,33]. Approximately 50% of TG neurons express GR in a rat [34]. Understanding the mechanism by which reactivation from latency occurs is important because acyclovir does not dramatically reduce the episodes of reactivation from latency and there are no HSV-1 vaccines.
The goals of this study are to test whether E2F1, E2F2, or E2F3 transactivate cis-regulatory motifs (CRM) derived from the HSV-1 ICP0 promoter, and if GR enhances E2F-mediated transactivation.

2. Materials and Methods

2.1. Cells and Virus

Murine neuroblastoma (Neuro-2A) was grown in Minimal Essential Media (MEM; Corning, Glendale, AZ, USA) supplemented with 10% fetal bovine serum (FBS). All media contained penicillin (10 U/mL) and streptomycin (100 µg/mL). The HSV-1 McKrae strain was obtained from the late Dr. Steven Wechsler (University of California, Irvine, CA, USA), and stock cultures were prepared in monkey kidney cells (Vero; ATCC, Manassas, VA, USA).

2.2. Plasmids

The respective ICP0 CRM constructs were synthesized by Genscript and inserted into pGL4.23[luc2/minP] (Promega; Madison, WI, USA) at SacI and XhoI unique restriction enzyme sites. The GR-α expression construct was obtained from Dr. John Cidlowski (NIEHS, Research Triangle Park, NC, USA).
Plasmids expressing E2F1 and E2F2 (pCMV-E2F1 and pCMVE2F2, respectively) were obtained from Dr. J. R. Nevins (Duke University, Durham, NC, USA). E2F3a (Plasmid 3790) and E2F3b (Plasmid 37975) were obtained from Addgene (Watertown, MA, USA) via Dr. Jacqueline Lees [35]. All plasmids were prepared from bacterial cultures by alkaline lysis and 2 rounds of cesium chloride centrifugation.

2.3. Transfection and Dual-Luciferase Reporter Assay

Neuro-2A (~6 × 105) were seeded into 60 mm dishes containing MEM with 10% FCS at 24 h prior to transfection. Cells were cotransfected with the designated ICP0 CRM constructs (0.5 ug plasmid DNA) and a plasmid-encoding Renilla luciferase under the control of a minimal herpesvirus thymidine kinase (TK) promoter (50 ng DNA). To maintain equal plasmid amounts in the transfection mixtures, empty expression vector (pCDNA3.1) was added as needed. Neuro-2A cells were incubated in MEM containing 2% charcoal-stripped FBS after transfection. At 24 h after transfection, cell cultures were treated with water-soluble DEX (10 µM; D2915; Sigma; St Louis, Missouri, USA). At 48 h after transfection, cells were harvested, and protein extracts subjected to a dual-luciferase assay using a commercially available kit (E1910; Promega). Luminescence was measured by using a GloMax 20/20 luminometer (E5331; Promega).

2.4. Chromatin Immunoprecipitation

ChIP studies were performed using standard procedures as previously described [1,2,3]. In brief, Neuro-2A cells were grown in 100 mm dishes until ~80% confluency. Cells were infected with HSV-1 (MOI of 1) or transfected with designated ICP0 CRM-C constructs (1.5 μg DNA) and a plasmid that expresses GR-α (3 μg DNA) and/or E2F2 (1.5 μg DNA) using Lipofectamine 3000 (Invitrogen; L3000015; Carlsbad, CA, USA) according to the manufacturer’s instructions. After transfection or infection, MEM with 2% stripped FBS was added to cultures. At 40 h post-transfection or 0, 4 and 8 h post-infection, cells were cross-linked with paraformaldehyde and harvested for ChIP analysis. Cleared samples were immunoprecipitated and incubated with a GR antibody (Cell Signaling, Cat# 3660S; Boston, MA, USA), E2F2 antibody (Invitrogen, Cat# PA5-41473), non-specific isotype control rabbit IgG (Abcam; Cat# ab171870; Cambridge, UK) in radioimmunoprecipitation assay (RIPA) buffer. DNA was purified using phenol-chloroform-isoamyl and amplified by PCR primers ICP0 CRM-C [AACCCCGGTATTCCCCGCCT (F) and AACAGGGGCTTGGCCTGCGT (R)] and ICP0-R0 [CGCTTCCCGGTATGGTAATTAGAAAC (F) and CGTGTGTTCCGCCAAAAAAGCAATTAGC (R)]. ICP0 R0 primer pairs, previously described [36,37], were designed using Strain 17 sequences, which are the same in McKrae. Following agarose gel electrophoresis, DNA bands were quantified using Image Lab software 6.1 for Mac and presented as percent of the input sample.

2.5. Statistical Analysis

All graphs and analyses were made using Microsoft Excel 365 for Mac. Student’s t-test with two-tailed and two-sample unequal variance was performed on the data sets. An * denotes significant difference in construct alone compared to its own cotransfected samples. An # denotes a significant difference in mutant samples compared to the relevant wt CRM cconstruct. The */# denotes a significant difference in p < 0.05, and **/## denotes a significant difference in p < 0.005, as determined by Student’s t-test. NS denotes a non-significant difference.

3. Results

3.1. GR and E2F2 Cooperatively Transactivate the ICP0 CRM-C Fragment

The HSV-1 ICP0 gene is present in the two repeats: hence, two copies of the ICP0 gene are in the viral genome (Figure 1A). An E2F1 siRNA was previously shown to impair BoHV-1 and HSV-1 replication in cultured cells [17,18]. Initial studies revealed E2F2 consistently had a modest level of transactivation on the full-length ICP0 promoter. Since the full-length ICP0 promoter contains numerous binding sites for cellular transcription sites, we predicted this may have dampened the effect of E2F2. Consequently, we tested whether ICP0 CRM fragments (Figure 1B) are transactivated by a plasmid that expresses GR-α and/or E2F1, E2F2, E2F3a, E2F3b in mouse neuroblastoma cells (Neuro-2A). E2F1, E2F2, and E2F3a strongly stimulate transcription compared to the other E2F family members, reviewed in [11,12]. E2F3b was used as a negative control because it is a negative regulator of E2F-dependent transcription, reviewed in [38]. Neuro-2A cells were used for this study because they are readily transfected, have certain neuronal features, and can be differentiated into dopamine-like neurons [39].
Initial studies tested whether ICP0 CRM fragments (Figure 2) were transactivated by E2F1- and/or GR-α-expression plasmids. Twenty-four h after transfection, certain cultures were treated with the synthetic corticosteroid DEX. Following 24h of DEX treatment, cells were collected and luciferase activity measured. Consistent with a previous study [40], GR-α and DEX cooperatively transactivate the ICP0 CRM A and B constructs but E2F1 reduces transcription relative to basal transcriptional activity of the CRM-A and CRM-B (Figure 2A,B). GR and DEX treatment reduced basal promoter activity of ICP0 CRM-C (Figure 2C) and CRM-D constructs (Figure 2D). In summary, E2F-1 impaired GR- and DEX-mediated transactivation of all 4 ICP0 CRM constructs.
Additional studies tested whether E2F2 transactivates the ICP0 CRM constructs. When the GR-α expression plasmid was transfected with E2F2, ICP0 CRM-A and ICP0 CRM-B promoter activity was reduced regardless of DEX treatment (Figure 3A,B). Interestingly, E2F2 transactivated the ICP0 CRM-C construct more than 20-fold but DEX had no effect (Figure 3C). Furthermore, E2F2 and GR-α had an additive effect on the transcriptional activation of the ICP0 CRM-C construct. The ICP0 CRM-D construct was not transactivated by E2F2 regardless of transfection with GR or DEX treatment (Figure 3D).

3.2. E2F3 Isoforms Do Not Transactivate the CRM-C Construct

The E2F3 gene encodes two isoforms, E2f3a and E2f3b, that differ in their N-termini [35]. Although these isoforms have overlapping sequences, E2F3a partially compensates for the loss of E2F1 and E2F3 whereas E2F3b impairs transcription [35,38]. E2F3a or E2F3b did not transactivate the ICP0 CRM-C construct in Neuro-2A cells (Figure 4) or the other ICP0 CRM constructs (data not shown).

3.3. GR-α and/or E2F2 Isoforms Do Not Transactivate the CRM-C Construct in NIH-3T3

Since Neuro-2A cells are mouse neuroblastoma cells and can be differentiated into dopamine-like neurons (36), we tested whether an immortalized mouse fibroblast cell line (NIH-3T3) supported transactivation of the CRM-C construct by GR-α and/or E2F2 (Figure 5). As expected, the CRM-C construct exhibited significantly higher levels of promoter activity relative to the empty vector (EV). When the CRM-C construct was cotransfected with the GR-α expression construct regardless of DEX treatment, promoter activity was reduced in NIH-3T3 cells. When E2F2 was cotransfected with the CRM-C construct, there was a significant reduction in promoter activity regardless of DEX treatment of NIH3T3 cells. Cotransfection of the CRM-C construct with GR and E2F2 regardless of DEX treatment also led to significantly reduced compared to basal CRM-C promoter activity. Consistent with results in Neuro-2A cells, the CRM-A, CRM-B, and CRM-D constructs were not transactivated by E2F2 and GR-α regardless of DEX treatment in NIH-3T3 cells (data not shown). In summary, this study suggests Neuro-2A-specific factors were important for transactivating the CRM-C fragment by GR and E2F2.

3.4. Influence of E2F Binding Sites and ½ GRE on GR- and E2F2-Mediated Transactivation of CRM-C

Examination of CRM-C revealed two consensus E2F binding sites; denoted as #1 and #2 (Figure 6A–C) [41,42]. E2F binding site #3 is a GC-rich motif that contains a consensus Sp1 binding site that was reported to interact with E2F2 [43,44]. A consensus ½ GRE [45] was also adjacent to the E2F2 #2 binding site. A GR monomer was reported to bind this ½ GRE in other promoters and is transactivated by increased stress [45].
Four mutant CRM-C fragments were prepared and tested whether these mutations influenced GR-α and E2F2 mediated transactivation (see Figure 6C–E for the mutants made in the E2F binding sites and ½-GRE). Surprisingly, mutating just the ½ E construct (CRM-C∆1/2GRE) did not significantly reduce basal transcriptional relative to the wt CRM-C construct; however, E2F2-mediated transactivation was significantly reduced (Figure 6F). Mutating all E2F binding sites (CRM-C∆1-3), two binding sites (CRM-C∆1,2) or just the #3 E2F2 binding site (CRM-C∆3) was transactivated by E2F2 significantly less than the wt CRM-C (Figure 6G). Notably, basal transcription was not significantly different between CRM-C∆1-3, CRM-C∆1,2, and CRM-C∆3. This study reveals transactivation by GR and E2F2 is complex and all E2F2 binding sites and the ½ GRE were crucial for transactivation by GR and E2F2.

3.5. E2F2 and GR Occupy the CRM C Region of the ICP0 Promoter During Productive Infection

Chromatin immunoprecipitation (ChIP) studies were performed to determine if GR and E2F2 occupied the ICP0 promoter in productively infected Neuro-2A cells. Within 60 min of incubating virus inoculum with Neuro-2A cells at 37 °C, GR bound to the ICP0 promoter was not significantly different than the isotype-specific antibody used as a negative control using ICP0 CRM-C primers (Figure 7B). However, significantly higher levels of E2F2 occupied the ICP0 promoter versus the isotype-specific antibody using the CRM-C primers. We suggest the infectious virus rapidly entered Neuro-2A cells, uncoating occurred, and low levels of viral DNA were present in the nucleus within 60 min. Consequently, low levels of GR and E2F2 occupied the ICP0 promoter that contains CRM-C sequences. Consequently, significantly higher levels of E2F2 occupying ICP0 promoter sequences were detected 60 min after the virus was incubated with Neuro-2A cells. Notably, significant differences between GR binding to the ICP0 promoter using the CRM-C primers were not observed. R0 primers span ICP0 promoter sequences that include CRM-C sequences, which we suggest is why significantly higher E2F2 and GR occupied the ICP0 promoter relative to the isotype-specific antibody at 0 h after infection (Figure 7D). It was also clear that GR and E2F2 levels bound to ICP0 CRM-C sequences increased at 4 and 8 h after infection, regardless of whether the R0 or CRM-C primers were used for ChIP.

3.6. Comparison of E2F2 and GR Occupying the wt ICP0 CRM-C Construct Versus Mutant ICP0 CRM-C Constructs

Neuro-2A cells were transfected with the ICP0 CRM-C, CRM-C ½GRE, or the CRM-C∆1-3 construct. At 48 h after transfection, cells were collected and ChIP studies performed to compare occupancy of E2F2 and GR in the wt or mutant CRM-C fragments. Binding of GR or E2F2 was significantly higher than the isotype antibody even when E2F2 or GR-α was not over-expressed (Figure 8A). As expected, over-expression of E2F2 lead to significantly higher levels of E2F2 and GR occupying the wt CRM-C fragment (Figure 8B). Over-expressing GR and E2F2 were not significantly different than just over-expressing E2F2 (Figure 8C). Comparing E2F2- and GR-binding wt CRM-C relative to the CRM-C ½ GRE reveals the E2F2 and GR binding to the mutant was significantly reduced relative to the wt CRM-C fragment (Figure 8E). A similar trend was observed when E2F2 and GR were over-expressed and E2F2 or GR occupancy was significantly reduced in the CRM-C ½ GRE construct (Figure 8F).
Comparing the wt CRM-C construct to the CRM-C∆1-3 construct, there was a dramatic reduction in GR and E2F2 occupying the CRM-C∆1-3 construct (Figure 7G). Over-expressing E2F2 (Figure 8H) or GR+E2F2 increased binding of E2F2 or GR to the wt CRM-C construct but had no effect on the CRM-C∆1-3 mutant construct. In fact, binding of E2F2 or GR to the CRM-C∆1-3 construct was not observed. This study reveals binding of E2F2 or GR to the CRM-C∆1-3 construct was not detected, whereas there were low levels of binding to the CRM-C ½GRE construct. Notably, promoter activations of these two mutant constructs by E2F2 and GR were not significantly different.

4. Discussion

The finding that GR and E2F2, but not E2F1, E2F3a, or E2F3b cooperatively transactivated the ICP0 CRM-C construct was unexpected because two consensus E2F binding sites are present in this fragment [41,42] (Figure 6). Furthermore, E2F2 #3 matches a GC-rich motif that E2F2 binds to and stimulates transcription [43,44]. We predicted that E2F1 and E2F3a would have transactivated the ICP0 CRM-C construct because these two E2F family members typically activate transcription [11,12,35]. Mutating the ½ GRE adjacent to the 2nd E2F2 consensus binding site reduced GR- and E2F2-mediated transactivation as efficiently as the construct where all three E2F2 binding sites were mutated. This result implies GR played a pivotal role in E2F2-mediated transactivation. In contrast, mutating one or all E2F2 binding sites resulted in GR and E2F2 binding not being detected (Figure 8G–I), whereas low levels of GR and E2F2 binding were detected when just the ½ GR site was mutated (Figure 8D–F). We suggest that mutating one E2F2 binding site impairs binding of E2F2 to the other E2F2 binding sites and GR is only recruited to the ½ GRE when all E2F2 binding sites are intact. In contrast to the ICP0 promoter, promoters or CRM constructs that drive ICP4, ICP27, or VP16 expression were not transactivated by GR and/or E2F2 regardless of DEX treatment in Neuro-2A cells (unpublished studies, Jayathilake and Jones). Furthermore, these promoters do not contain E2F consensus binding sites. It is reasonable to predict that HSV-1 can replicate in actively growing cells because they express higher levels of E2F2. This prediction can be directly tested because E2F2 knockout mice are available.
Notably, GR and E2F2, but not E2F1, E2F3a, or E2F3b cooperatively transactivate the bovine alphaherpesvirus 1 (BoHV-1) immediate early transcription unit 1 (IETu1) promoter that drives immediate early ICP0 and ICP4 expression [46]. The IEtu1 promoter contains two “whole” GREs [47], and mutating these GREs dramatically reduces promoter activity, including GR- and E2F2-mediated transactivation [46,48]. A 222 bp fragment upstream of the two GREs in the IEtu1 promoter contains four consensus Sp1 binding sites. Mutating these Sp1 binding sites significantly reduced GR- and E2F2-mediated transactivation; however, the effect was not as dramatic compared to mutating the two GREs. Although the CRM-C fragment contains numerous GC or CG motifs that resemble consensus Sp1 binding sites, there are no consensus Sp1 binding sites. Finally, E2F1 transactivates the HSV-1 thymidine kinase (TK) promoter, and transactivation is reduced when the GC-rich motif, not a consensus E2F binding site, is mutated [49]. Unfortunately, E2F2 was not tested for whether it transactivates the TK promoter. The inability of E2F2 and GR-α to transactivate the ICP0 CRM-C construct suggests that a neuronal-specific transcription factor is expressed in Neuro-2 cells, but not NIH 3T3 cells. It is also possible that negative regulators present in NIH-3T3 cells are possible, or novel chromatinization of the CRM-C construct impaired transactivation. Furthermore, it will be interesting to develop a mutant virus that lacks the ½ GRE and E2F2 binding sites in the CRM-C region and test whether this impairs viral replication, viral pathogenesis in a mouse model of infection, and/or the latency reactivation cycle.
Despite having overlapping functions as the E2F activators (E2F1 and E2F3), E2F2 has novel functions that are important for GR-mediated transactivation of the CRM-C fragment and the IEtu1 promoter. For example, E2F1 and E2F2 over-expression in the absence of growth factors will drive cells into the S phase; however, E2F2 does not induce apoptosis in certain cell types, reviewed in [50]. Conversely, E2F1 over-expression induces apoptosis in most cells in the absence of growth factors [13,51]. E2F2, but not E2F1 or E2F3, is required for normal cell-cycle progression from Go to G1, because in-mouse embryonic cells and T-cells lacking E2F2 prematurely enter the G1 and S phase [52]. In keeping with this finding, an independent study concluded E2F2 knockout mice contained more proliferating activated lymphocytes [53]. Tumors develop in certain cell types in the absence of E2F1 and E2F2 expression, suggesting these genes exhibit tumor suppressor activity under certain circumstances [54]. Finally, E2F2 impairs Myc-mediated proliferation and tumor formation [55], confirming E2F2 has tumor suppressor functions.
E2F2 has also been reported to regulate the PI3K/Akt/NF-kB signaling axis, which can induce expression of pro-inflammatory mediators [56,57]. Interestingly, the PI3K/Akt signaling axis is linked to the HSV-1 latency reactivation cycle, reviewed in [58], and appears to play a role in the BoHV-1 latency reactivation cycle [59,60]. Since ICP0 can transactivate all viral promoters [61], enhance chromatin remodeling to stimulate viral gene expression [62,63], and impair innate immune responses [64,65], it is not surprising that ICP0 triggers reactivation from latency of TG neurons [66]. Furthermore, ICP0 has intrinsic E3 ubiquitin ligase activity that is reported to reduce p53 protein levels [67] and other proteins, including promyelocytic leukemia (PML) bodies [67,68,69] that impair viral replication. In summary, transactivation of CRM-C by GR and E2F2 is predicted to stimulate ICP0 promoter activity: consequently, virus replication and reactivation from latency are predicted to be increased.

5. Conclusions

This study reveals that only E2F2 transactivates the ICP0-CRM-C. Surprisingly, E2F1, E2F3a, and E2F3b had no effects on any of the ICP0 CRM fragments. This study confirmed and enhanced our understanding that certain E2F family members, for example E2F2, have novel properties relative to E2F1, E2F3a, and E2F3b. Furthermore, this study reveals GR and E2F2 have an enhanced transactivation of CRM-C, in part because this fragment contains a functional ½ GRE. Despite the ability of HSV-1 to replicate in quiescent cells, cell-cycle factors can stimulate viral gene expression in certain cells, which enhances viral spread in the host.

Author Contributions

Conceptualization, C.J.; methodology, C.J.; software, K.J. and V.C.S.; validation, C.J., K.J. and V.C.S.; formal analysis, K.J. and V.C.S.; investigation, K.J. and V.C.S.; resources, C.J.; data curation, C.J., K.J. and V.C.S.; writing—original draft preparation, C.J.; writing—review and editing, C.J., K.J. and V.C.S.; visualization, K.J. and V.C.S.; supervision, C.J.; project administration, C.J.; funding acquisition, C.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Institute of Neurological Disorders and Stroke of the NIH under award number R01NS111167 CJ, and by the Sitlington Endowment CJ.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article material. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Cabrera, C.V.; Wohlenberg, C.; Openshaw, H.; Rey-Mendez, M.; Puga, A.; Notkins, A.L. Herpes simplex virus DNA sequences in the CNS of latently infected mice. Nature 1980, 288, 228–290. [Google Scholar] [CrossRef] [PubMed]
  2. Fraser, N.W.; Lawrence, W.C.; Wroblewska, Z.; Gilden, D.H.; Koprowski, H. Herpes simplex virus type 1 DNA in human brain tissue. Proc. Natl. Acad. Sci. USA 1981, 78, 6461–6465. [Google Scholar] [CrossRef]
  3. Rock, D.L.; Fraser, N.W. Detection of HSV-1 genome in central nervous system of latently infected mice. Nature 1983, 302, 523–525. [Google Scholar] [CrossRef]
  4. Cliffe, A.R.; Coen, D.M.; Knipe, D.M. Kinetics of Facultative Heterochromatin and Polycomb Group Protein Association with the Herpes Simplex Viral Genome during Establishment of Latent Infection. mBio 2013, 4, e00590-12. [Google Scholar] [CrossRef]
  5. Knipe, D.M.; Cliffe, A. Chromatin control of herpes simplex virus lytic and latent infection. Nat. Rev. Microbiol. 2008, 6, 211–221. [Google Scholar] [CrossRef]
  6. Deshmane, S.L.; Fraser, N.W. During latency, herpes simplex virus type 1 DNA is associated with nucleosomes in a chromatin structure. J. Virol. 1989, 63, 943–947. [Google Scholar] [CrossRef]
  7. Smith, R.E.; McDonald, H.R.; Nesburn, A.B.; Minckler, D.S. Penetrating keratoplasty: Changing indications, 1947 to 1978. Arch. Ophthalmol. 1980, 98, 1226–1229. [Google Scholar] [CrossRef]
  8. Pavan-Langston, D. Herpes simplex of the ocular anterior segment. Curr. Clin. Top. Infect. Dis. 2000, 20, 298–324. [Google Scholar] [PubMed]
  9. Yamada, S.; Kameyama, T.; Nagaya, S.; Hashizume, Y.; Yoshida, M. Relapsing herpes simplex encephalitis: Pathological confirmation of viral reactivation. J. Neurol. Neurosurg. Psychiatry 2002, 74, 262–264. [Google Scholar] [CrossRef]
  10. Sekizawa, T.; Openshaw, H. Encephalitis resulting from reactivation of latent herpes simplex virus in mice. J. Virol. 1984, 50, 263–266. [Google Scholar] [CrossRef] [PubMed]
  11. Attwooll, C.; Denchi, E.L.; Helin, K. The E2F family: Specific functions and overlapping interests. EMBO J. 2004, 23, 4709–4716. [Google Scholar] [CrossRef]
  12. Harbour, J.W.; Dean, D.C. The Rb/E2F pathway: Expanding roles and emerging paradigms. Genes Dev. 2000, 14, 2393–2409. [Google Scholar] [CrossRef]
  13. DeGregori, J.; Kowalik, T.; Nevins, J.R. Cellular targets for activation by the E2F1 transcription factor include DNA synthesis- and G1/S-regulatory genes. Mol. Cell. Biol. 1995, 15, 4215–4224. [Google Scholar] [CrossRef] [PubMed]
  14. Nevins, J.R.; DeGregori, J.; Jakoi, L.; Leone, G. Functional analysis of E2F transcription factor. Methods Enzymol. 1997, 283, 205–219. [Google Scholar]
  15. Ohtani, K.; DeGregori, J.; Nevins, J.R. Regulation of the cyclin E gene by transcription factor E2F1. Proc. Natl. Acad. Sci. USA 1995, 92, 12146–12150. [Google Scholar] [CrossRef] [PubMed]
  16. Christensen, J.; Cloos, P.; Toftegaard, U.; Klinkenberg, D.; Bracken, A.P.; Trinh, E.; Heeran, M.; Di Stefano, L.; Helin, K. Characterization of E2F8, a novel E2F-like cell-cycle regulated repressor of E2F-activated transcription. Nucleic Acids Res. 2005, 33, 5458–5470. [Google Scholar] [CrossRef]
  17. Workman, A.; Jones, C. Bovine herpesvirus 1 productive infection and bICP0 early promoter activity are stimulated by E2F1. J. Virol. 2010, 84, 6308–6317. [Google Scholar] [CrossRef] [PubMed]
  18. Workman, A.; Jones, C. Analysis of the cell cycle regulatory protein (E2F1) after infection of cultured cells with bovine herpesvirus 1 (BHV-1) or herpes simplex virus type 1 (HSV-1). Virus Res. 2011, 160, 66–73. [Google Scholar] [CrossRef]
  19. Glaser, R.; Kiecolt-Glaser, J.K.; Speicher, C.E.; Holliday, J.E. Stress, loneliness, and changes in herpesvirus latency. J. Behav. Med. 1985, 8, 249–260. [Google Scholar] [CrossRef]
  20. Glaser, R.; Kiecolt-Glaser, J.K. Stress-induced immune dysfunction: Implications for health. Nat. Rev. Immunol. 2005, 5, 243–251. [Google Scholar] [CrossRef]
  21. Padgett, D.A.; Sheridan, J.F.; Dorne, J.; Berntson, G.G.; Candelora, J.; Glaser, R. Social stress and the reactivation of latent herpes simplex virus type 1. Proc. Natl. Acad. Sci. USA 1998, 95, 7231–7235. [Google Scholar] [CrossRef]
  22. Cassidy, L.; Meadows, J.; Catalán, J.; Barton, S. Are stress and coping style associated with frequent recurrence of genital hereps? Sex. Transm. Infect. 1997, 73, 263–266. [Google Scholar] [CrossRef]
  23. Rooney, J.F.; Straus, S.E.; Mannix, M.L.; Wohlenberg, C.R.; Banks, S.; Jagannath, S.; Brauer, J.E.; Notkins, A.L. UV light-induced reactivation of herpes simplex virus type 2 and prevention by acyclovir. J. Infect. Dis. 1992, 166, 500–506. [Google Scholar] [CrossRef]
  24. Jones, C. Alphaherpesvirus latency: Its role in disease and survival of the virus in nature. Adv. Virus Res. 1998, 51, 81–133. [Google Scholar]
  25. Jones, C. Herpes simplex virus type 1 and bovine herpesvirus 1 latency. Clin. Microbiol. Rev. 2003, 16, 79–95. [Google Scholar] [CrossRef] [PubMed]
  26. Perng, G.-C.; Jones, C. Towards an understanding of the Herpes Simplex Virus Type 1 latency-reactivation cycle. Interdiscip. Perspect. Infect. Dis. 2010, 2010, 262415. [Google Scholar] [CrossRef]
  27. Jones, C. Human alpha-herpesvirus 1 (HSV-1) viral replication and reactivation from latency are expedited by the glucocorticoid receptor. J. Virol. 2025, 15, e0030325. [Google Scholar] [CrossRef]
  28. Oakley, R.H.; Cidlowski, J.A. The biology of the glucocorticoid receptor: New signaling mechanisms in health and disease. J. Allergy Clin. Immunol. 2013, 132, 1033–1044. [Google Scholar] [CrossRef]
  29. Galliher-Beckley, A.J.; Williams, J.G.; Cidlowski, J.A. Ligand-Independent Phosphorylation of the Glucocorticoid Receptor Integrates Cellular Stress Pathways with Nuclear Receptor Signaling. Mol. Cell. Biol. 2011, 31, 4663–4675. [Google Scholar] [CrossRef] [PubMed]
  30. Davies, L.; Karthikeyan, N.; Lynch, J.T.; Sial, E.-A.; Gkourtsa, A.; Demonacos, C.; Krstic-Demonacos, M. Cross Talk of Signaling Pathways in the Regulation of the Glucocorticoid Receptor Function. Mol. Endocrinol. 2018, 22, 1331–1344. [Google Scholar] [CrossRef] [PubMed]
  31. Brenner, I.; Shek, P.N.; Zamecnik, J.; Shephard, R.J. Stress Hormones and the Immunological Responses to Heat and Exercise. Int. J. Sports Med. 1998, 19, 130–143. [Google Scholar] [CrossRef] [PubMed]
  32. Harrison, K.S.; Zhu, L.; Thunuguntla, P.; Jones, C. Antagonizing the glucocorticoid receptor impairs explant-induced reactivation in mice latently infected with herpes simplex virus 1. J. Virol. 2019, 93, e00418-19. [Google Scholar] [CrossRef]
  33. Harrison, K.S.; Wijesekera, N.; Robinson, A.G.J.; Santos, V.C.; Oakley, R.H.; Cidlowski, J.A.; Jones, C. Impaired Glucocorticoid Receptor Function Attenuates Herpes Simplex Virus 1 Production During Explant-Induced Reactivation from Latency in Female Mice. J. Virol. 2023, 97, e01305-23. [Google Scholar] [CrossRef]
  34. DeLeon, M.; Covenas, R.; Chadi, G.; Narvaez, J.A.; Fuxe, K.; Cintra, A. Subpopulations of primary sensory neurons show coexistence of neuropeptides and glucocorticoid receptors in the rat spinal and trigeminal ganglia. Brain Res. 1994, 14, 338–342. [Google Scholar] [CrossRef]
  35. Danielian, P.S.; Friesenhahn, L.B.; Faust, A.M.; West, J.C.; Caron, A.M.; Bronson, R.T.; Lees, J.A. E2f3a and E2f3b make overlapping but different contributions to total E2f3 activity. Oncogene 2008, 27, 6561–6570. [Google Scholar] [CrossRef]
  36. Whitlow, Z.W.; Kristie, T.M. Recruitment of the transcriptional coactivator HCF-1 to viral immediate-ealy promoters during intiation of reactivation from latency of herpes simplex virus type 1. J. Virol. 2009, 83, 9591–9595. [Google Scholar] [CrossRef]
  37. Ostler, J.B.; Harrison, K.S.; Schroeder, K.; Thunuguntla, P.; Jones, C. The glucocorticoid receptor (GR) stimulates Herpes Simplex Virus 1 productive infection, in part because the infected cell protein 0 (ICP0) promoter is cooperatively transactivated by the GR and Krüppel-like transcription factor 15. J. Virol. 2019, 93, e02063-18. [Google Scholar] [CrossRef]
  38. Emanuele, M.J.; Enrico, T.P.; Mouery, R.D.; Wasserman, D.; Nachum, S.; Tzur, A. Complex Cartography: Regulation of E2F. Transcription Factors by Cyclin F and Ubiquitin. Trends Cell Biol. 2020, 30, 640–652. [Google Scholar] [CrossRef]
  39. Tremblay, R.G.; Sikorska, M.; Sandhu, J.K.; Lanthier, P.; Ribecco-Lutkiewicz, M.; Bani-Yaghoub, M. Differentiation of mouse Neuro-2A cells into dopamine neurons. J. Neurosci. Methods 2010, 186, 60–67. [Google Scholar] [CrossRef] [PubMed]
  40. Wijesekera, N.; Hazell, N.; Jones, C. Independent Cis-Regulatory Modules within the Herpes Simplex Virus 1 Infected Cell Protein 0 (ICP0) Promoter Are Transactivated by Krüppel-like Factor 15 and Glucocorticoid Receptor. Viruses 2022, 14, 1284. [Google Scholar] [CrossRef] [PubMed]
  41. Rabinovich, A.; Jin, V.X.; Rabinovich, R.; Xu, X.; Farnham, P.J. E2F in vivo binding specificity: Comparison of consensus versus nonconsensus binding sites. Genome Res. 2008, 18, 1763–1777. [Google Scholar] [CrossRef]
  42. Burkhart, D.L.; Wirt, S.E.; Zmoos, A.-F.; Kareta, M.S.; Sage, J. Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions. PLoS Genet. 2010, 6, e1001003. [Google Scholar]
  43. Morgunova, E.; Yin, Y.; Jolma, A.; Dave, K.; Schmierer, B.; Popov, A.; Eremina, N.; Nilsson, L.; Taipale, J. Structural insights into the DNA-binding specificity of E2F family transcription factors. Nat. Commun. 2015, 6, 10050. [Google Scholar] [CrossRef] [PubMed]
  44. Yamada, M.; Sato, N.; Taniyama, C.; Ohtani, K.; Arai, K.-I.; Masai, H. A 63-base pair DNA segment containing an Sp1 site but not a canonical E2F site can confer growth-dependent and E2F-mediated transcriptional stimulation of the human ASK gene encoding the regulatory subunit for human Cdc7-related kinase. J. Biol. Chem. 2002, 277, 27668–27681. [Google Scholar] [CrossRef]
  45. Schiller, B.J.; Chodankar, R.; Watson, L.C.; Stallcup, M.R.; Yamamoto, K.R. Glucocorticoid receptor binds half sites as a monomer and regulates specific target genes. Genome Biol. 2014, 15, 418. [Google Scholar] [CrossRef]
  46. El-Mayet, F.S.; Jones, C. A cell cycle regulator, E2F2, and glucocorticoid receptor cooperatively transactivate the bovine alphaherpesvirus 1 immediate early transcription unit 1 promoter. J. Virol. 2024, 98, e0042324. [Google Scholar] [CrossRef]
  47. Kook, I.; Henley, C.; Meyer, F.; Hoffmann, F.G.; Jones, C. Bovine herpesvirus 1 productive infection and the immediate early transcription unit 1 are stimulated by the synthetic corticosteroid dexamethasone. Virology 2015, 484, 377–385. [Google Scholar] [CrossRef] [PubMed]
  48. El-Mayet, F.S.; Sawant, L.; Thunuguntla, P.; Jones, C. Combinatorial effects of the glucocorticoid receptor and Krüppel-like transcription factor 15 on bovine herpesvirus 1 transcription and productive infection. J. Virol. 2017, 91, e00904-17. [Google Scholar] [CrossRef] [PubMed]
  49. Shin, E.K.; Tevosian, S.G.; Yee, A.S. The N-terminal Region of E2F-1 Is Required for Transcriptional Activation of a New Class of Target Promoter. J. Biol. Chem. 1996, 271, 12261–12268. [Google Scholar]
  50. Li, L.; Wang, S.; Zhang, Y.; Pan, J. The E2F transcription factor 2: What do we know? Biosci. Trends 2021, 15, 83–92. [Google Scholar] [CrossRef]
  51. Nip, J.; Strom, D.K.; Fee, B.E.; Zambetti, G.; Cleveland, J.L.; Hiebert, S.W. E2F-1 cooperates with topoisomerase II inhibition and DNA damage to selectively augment p53-independent apoptosis. Mol. Cell. Biol. 1997, 17, 1049–1056. [Google Scholar] [CrossRef][Green Version]
  52. Infante, A.; Laresgoiti, U.; Fernández-Rueda, J.; Fullaondo, A.; Galán, J.; Díaz-Uriarte, R.; Malumbres, M.; Field, S.J.; Zubiaga, A.M. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle 2008, 7, 3915–3927. [Google Scholar] [CrossRef]
  53. Murga, M.; Fernández-Capetillo, O.; Field, S.J.; Moreno, B.; R.-Borlado, L.; Fujiwara, Y.; Balomenos, D.; Vicario, A.; Carrera, A.C.; Orkin, S.H.; et al. Mutation of E2F2 in Mice Causes Enhanced T Lymphocyte Proliferation, Leading to the Development of Autoimmunity. Immunity 2001, 15, 959–970. [Google Scholar] [CrossRef]
  54. Zhu, J.W.; Field, S.J.; Gore, L.; Thompson, M.; Yang, H.; Fujiwara, Y.; Cardiff, R.D.; Greenberg, M.; Orkin, S.H.; DeGregori, J. E2F1 and E2F2 determine thresholds for antigen-induced T-cell proliferation and suppress tumorigenesis. Mol. Cell. Biol. 2001, 21, 8547–8564. [Google Scholar] [CrossRef]
  55. Pusapati, R.V.; Weaks, R.L.; Rounbehler, R.J.; McArthur, M.J.; Johnson, D.G. E2F2 Suppresses Myc-induced Proliferation and Tumorigenesis. Mol. Carcinog. 2011, 49, 152–156. [Google Scholar] [CrossRef] [PubMed]
  56. Kesavardhana, S.; Malireddi, R.K.S.; Kanneganti, T.-D. Caspases in Cell Death, Inflammation, and Gasdermin-Induced Pyroptosis. Annu. Rev. Immunol. 2020, 4, 567–595. [Google Scholar] [CrossRef]
  57. Wang, S.; Wang, L.; Wu, C.; Sun, S.; Pan, J.-H. E2F2 directly regulates the STAT1 and PI3K/AKT/NF-κB pathways to exacerbate the inflammatory phenotype in rheumatoid arthritis synovial fibroblasts and mouse embryonic fibroblasts. Arthritis Res. Ther. 2018, 20, 225. [Google Scholar] [CrossRef] [PubMed]
  58. Wilson, A. Impact of Cultured Neuron Models on alpha-Herpesvirus Latency Research. Viruses 2022, 14, 1209. [Google Scholar] [CrossRef] [PubMed]
  59. Workman, A.; Zhu, L.; Keel, B.N.; Smith, T.P.L.; Jones, C. The Wnt signaling pathway is differentially expressed during the bovine herpesvirus 1 latency-reactivation cycle: Evidence that two proteinkinases associated with neuronal survival, Akt3 and BMPR2, are expressed at higher levels during latency. J. Virol. 2018, 92, e01937-17. [Google Scholar] [CrossRef]
  60. Zhao, J.; Zhu, L.; Wijesekera, N.; Jones, C. Specific Akt family members impair stress mediated transactivation of viral promoters and enhance neuronal differentiation: Important functions for maintaining latency. J. Virol. 2020, 94, e00901-20. [Google Scholar] [CrossRef]
  61. Cai, W.; Schaffer, P.A. Herpes simplex virus type 1 ICP0 regulates expression of immediate-early, early, and late genes in productively infected cells. J. Virol. 1992, 66, 2904–2915. [Google Scholar] [CrossRef] [PubMed]
  62. Cliffe, A.R.; Knipe, D.M. Herpes Simplex Virus ICP0 Promotes both Histone Removal and Acetylation on Viral DNA during Lytic Infection. J. Virol. 2008, 82, 12030–12038. [Google Scholar] [CrossRef] [PubMed]
  63. Poon, A.P.W.; Gu, H.; Roizman, B. ICP0 and the Us3 protein kinase of herpes simplex virus 1 independently block histone deactylation to enable gene expression. Proc. Natl. Acad. Sci. USA 2006, 103, 9993–9998. [Google Scholar] [CrossRef]
  64. Lin, R.; Noyce, R.S.; Collins, S.E.; Everett, R.D.; Mossman, K.L. The herpes simplex virus ICP0 RING finger domain inhibits IRF3- and IRF7-mediated activation of interferon-stimulated genes. J. Virol. 2004, 78, 1675–1684. [Google Scholar] [CrossRef]
  65. Everett, R.D. Effects of interferon and histone deacetylase inhibitors in wt and ICP0-null mutants HSV-1 infection of normal and PML-depleted human fibroblasts. In Proceedings of the 32nd International Herpesvirus Workshop, Asheville, NC, USA, 7–12 July 2007. Abstract 1.06. [Google Scholar]
  66. Halford, W.P.; Kemp, C.D.; Isler, J.A.; Davido, D.J.; Schaffer, P.A. ICP0, ICP4, or VP16 expressed from adenovirus vectors induces reactivation of latent herpes simplex virus type 1 in primary cultures of latently infected trigeminal ganglion cells. J. Virol. 2001, 75, 6143–6153. [Google Scholar] [CrossRef]
  67. Boutell, C.; Everett, R.D. The herpes simplex virus type 1 (HSV-1) regulatory protein ICP0 interacts with and ubiquitinates p53. J. Biol. Chem. 2003, 278, 36596–36602. [Google Scholar] [CrossRef]
  68. Boutell, C.; Sadis, S.; Everett, R.D. Herpes simplex virus type 1 immediate-early protein ICP0 and its isolated RING finger domain act as ubiquitin E3 ligases in vitro. J. Virol. 2002, 76, 841–850. [Google Scholar] [CrossRef]
  69. Maul, G.G.; Everett, R.D. The nuclear location of PML, a cellular member of the C3HC4 zinc- binding domain protein family, is rearranged during herpes simplex virus infection by the C3HC4 viral protein ICP0. J. Gen. Virol. 1994, 75, 1223–1233. [Google Scholar] [CrossRef]
Cells 15 00445 g001
Figure 1. Schematic of HSV-1 genome, location of ICP0 gene, and CRM fragments used for this study. (A): The prototypic HSV-1 genomic structure is shown. The viral repeat regions are shown as open rectangles or gray rectangles. TRL is the terminal long repeat. IRL is the internal (or inverted) long repeat. TRS is the terminal short repeat. IRS is the internal (or inverted) short repeat. Unique long (UL) and unique short (US) regions are each represented by a solid line. Location of ICP0 and other genes in IRL and TRL. (B): Schematic full-length ICP0 and consensus binding sites for the denoted cellular transcription factors. Location of ICP0 CRM fragments (A–D) were inserted upstream of the minimal promoter of the firefly luciferase reporter plasmid, pGL4.24[luc2/minP]. Nucleotide position is given relative to the ICP0 transcription initiation site. The key for binding sites for transcription factors in the ICP0 promoter is shown in (C).
Figure 1. Schematic of HSV-1 genome, location of ICP0 gene, and CRM fragments used for this study. (A): The prototypic HSV-1 genomic structure is shown. The viral repeat regions are shown as open rectangles or gray rectangles. TRL is the terminal long repeat. IRL is the internal (or inverted) long repeat. TRS is the terminal short repeat. IRS is the internal (or inverted) short repeat. Unique long (UL) and unique short (US) regions are each represented by a solid line. Location of ICP0 and other genes in IRL and TRL. (B): Schematic full-length ICP0 and consensus binding sites for the denoted cellular transcription factors. Location of ICP0 CRM fragments (A–D) were inserted upstream of the minimal promoter of the firefly luciferase reporter plasmid, pGL4.24[luc2/minP]. Nucleotide position is given relative to the ICP0 transcription initiation site. The key for binding sites for transcription factors in the ICP0 promoter is shown in (C).
Cells 15 00445 g001
Cells 15 00445 g002
Figure 2. GR and DEX transactivate CRM-A and CRM-B but E2F1 impairs transactivation. (A): Neuro-2A cells were transactivated with the ICP0 CRM-A construct (0.5 μg), glucocorticoid receptor (1 μg) and/or E2F1 (0.5 μg). (B): Neuro-2A cells were transactivated with ICP0 CRM-B construct (0.5 μg) and/or GR construct (1 μg) and/or E2F1 construct (0.5 μg). (C): Neuro-2A cells were transactivated with the ICP0 CRM-C construct (0.5 μg) and/or GR-α (1 μg), and/or E2F1 (0.5 μg). (D): Neuro-2A cells were transfected with the ICP0 CRM-D construct (0.5 μg) and/or the GR-α construct (1 μg), and/or E2F1 construct (0.5 μg). Twenty-four hours after transfection, certain cells were treated with Dexamethasone. After 24 h of Dexamethasone treatment, cells were collected, and luciferase assays conducted. The relative luciferase activity is shown in the figure. An * denotes a significant difference compared to basal levels of the respective ICP0 CRM construct (p < 0.05). The # denotes promoter activity was significantly reduced compared to basal transcription of the respective ICP0 CRM constructs. The */# denotes a significant difference in p < 0.05. The error bars depict the average of three biological replicates of these studies.
Figure 2. GR and DEX transactivate CRM-A and CRM-B but E2F1 impairs transactivation. (A): Neuro-2A cells were transactivated with the ICP0 CRM-A construct (0.5 μg), glucocorticoid receptor (1 μg) and/or E2F1 (0.5 μg). (B): Neuro-2A cells were transactivated with ICP0 CRM-B construct (0.5 μg) and/or GR construct (1 μg) and/or E2F1 construct (0.5 μg). (C): Neuro-2A cells were transactivated with the ICP0 CRM-C construct (0.5 μg) and/or GR-α (1 μg), and/or E2F1 (0.5 μg). (D): Neuro-2A cells were transfected with the ICP0 CRM-D construct (0.5 μg) and/or the GR-α construct (1 μg), and/or E2F1 construct (0.5 μg). Twenty-four hours after transfection, certain cells were treated with Dexamethasone. After 24 h of Dexamethasone treatment, cells were collected, and luciferase assays conducted. The relative luciferase activity is shown in the figure. An * denotes a significant difference compared to basal levels of the respective ICP0 CRM construct (p < 0.05). The # denotes promoter activity was significantly reduced compared to basal transcription of the respective ICP0 CRM constructs. The */# denotes a significant difference in p < 0.05. The error bars depict the average of three biological replicates of these studies.
Cells 15 00445 g002
Cells 15 00445 g003
Figure 3. GR and E2F-2 cooperatively transactivate the ICP0 CRM-C fragment, but not the ICP0 A, B, and D CRM fragments. (A): Neuro-2A cells were transactivated with the ICP0 CRM-A construct (0.5 μg), GR-α expression construct (1 μg) and/or E2F2 (0.5 μg). (B): Neuro-2A cells were transfected with ICP0 CRM-B construct (0.5 μg) and/or GR-α construct (1 μg) and/or E2F2 construct (0.5 μg). (C): Neuro-2A cells were transfected with the ICP0 CRM-C construct (0.5 μg) and/or GR-α construct (1 μg), and/or E2F2 construct (0.5 μg). (D): Neuro-2A cells were transfected with the ICP0 CRM-D construct (0.5 μg) and/or GR-α construct (1 μg), and/or E2F2 construct (0.5 μg). Twenty-four hours after transfection, the denoted cells were treated with Dexamethasone. After 24 h of Dexamethasone treatment, cells were collected, and luciferase assays conducted. Cultures not treated with DEX were collected at the same time as cultures treated with DEX. The relative luciferase activity is shown in the figure. Average, n = 3, * denotes a significant increase in luciferase activity compared to basal activity of the denoted CRM construct. An # denotes a significant reduction (p < 0.05) compared to the wt CRM-C construct cotransfected with GR+DEX (p < 0.05 as determined by Student’s t-test). The */# denotes a significant reduction compared to GR+DEX (A), CRM-B basal promoter activity (B), and CRM-D basal promoter activity. The differences were p < 0.05 as determined by Student’s t-test.
Figure 3. GR and E2F-2 cooperatively transactivate the ICP0 CRM-C fragment, but not the ICP0 A, B, and D CRM fragments. (A): Neuro-2A cells were transactivated with the ICP0 CRM-A construct (0.5 μg), GR-α expression construct (1 μg) and/or E2F2 (0.5 μg). (B): Neuro-2A cells were transfected with ICP0 CRM-B construct (0.5 μg) and/or GR-α construct (1 μg) and/or E2F2 construct (0.5 μg). (C): Neuro-2A cells were transfected with the ICP0 CRM-C construct (0.5 μg) and/or GR-α construct (1 μg), and/or E2F2 construct (0.5 μg). (D): Neuro-2A cells were transfected with the ICP0 CRM-D construct (0.5 μg) and/or GR-α construct (1 μg), and/or E2F2 construct (0.5 μg). Twenty-four hours after transfection, the denoted cells were treated with Dexamethasone. After 24 h of Dexamethasone treatment, cells were collected, and luciferase assays conducted. Cultures not treated with DEX were collected at the same time as cultures treated with DEX. The relative luciferase activity is shown in the figure. Average, n = 3, * denotes a significant increase in luciferase activity compared to basal activity of the denoted CRM construct. An # denotes a significant reduction (p < 0.05) compared to the wt CRM-C construct cotransfected with GR+DEX (p < 0.05 as determined by Student’s t-test). The */# denotes a significant reduction compared to GR+DEX (A), CRM-B basal promoter activity (B), and CRM-D basal promoter activity. The differences were p < 0.05 as determined by Student’s t-test.
Cells 15 00445 g003
Cells 15 00445 g004
Figure 4. GR-α and/or E2F3a or E2F3b do not transactivate the CRM-C construct. Neuro-2A cells were transfected with the ICP0 CRM-C construct (0.5 μg) and/or GR-α construct (1 μg), and/or E2F2 construct (0.5 μg). As denoted, DEX treatment was added to certain cultures. The average of 3 biological replicates were performed. The * and line denotes significant reduction in luciferase activity of the denoted samples when compared with the CRM-C construct, and when the CRM-C construct was cotransfected with GR or GR+DEX.
Figure 4. GR-α and/or E2F3a or E2F3b do not transactivate the CRM-C construct. Neuro-2A cells were transfected with the ICP0 CRM-C construct (0.5 μg) and/or GR-α construct (1 μg), and/or E2F2 construct (0.5 μg). As denoted, DEX treatment was added to certain cultures. The average of 3 biological replicates were performed. The * and line denotes significant reduction in luciferase activity of the denoted samples when compared with the CRM-C construct, and when the CRM-C construct was cotransfected with GR or GR+DEX.
Cells 15 00445 g004
Cells 15 00445 g005
Figure 5. The CRM-C construct was not transactivated by GR-α and/or E2F2 regardless of DEX treatment in NIH 3T3 cells. NIH-3T3 cells were transfected with the ICP0 CRM-C construct (0.5 μg) and/or GR-α construct (1 μg), and/or E2F2 construct (0.5 μg). DEX treatment was added to certain cultures. The average of three biological replicates were performed. The # denotes that the promoter activity of the CRM-C construct was significantly higher than the empty vector (VC). The * denotes a significant difference in luciferase activity compared to basal transcriptional activity of the ICP0 CRM-C construct.
Figure 5. The CRM-C construct was not transactivated by GR-α and/or E2F2 regardless of DEX treatment in NIH 3T3 cells. NIH-3T3 cells were transfected with the ICP0 CRM-C construct (0.5 μg) and/or GR-α construct (1 μg), and/or E2F2 construct (0.5 μg). DEX treatment was added to certain cultures. The average of three biological replicates were performed. The # denotes that the promoter activity of the CRM-C construct was significantly higher than the empty vector (VC). The * denotes a significant difference in luciferase activity compared to basal transcriptional activity of the ICP0 CRM-C construct.
Cells 15 00445 g005
Cells 15 00445 g006
Figure 6. Schematic of CRM-C fragment and location of putative E2F and ½ GRE. (A): Nucleotide sequence of DNA sequences that encompass the CRM-A fragment. The #1 and #2 are consensus E2F binding sites [41]. A ½ GRE is adjacent to a E2F2 binding site. The #3 denotes a G-C-rich E2F consensus binding site [43,44]. (B): Comparison of a consensus E2F binding site [41] to the two binding sites in CRM-C sequences (blue nucleotides are shaded in yellow). The S in the E2F consensus can be G or C. The g and below the E2F2 GC-rich motif are more flexible nucleotides in the consensus binding site, the C can be C or G, and the consecutive AA can also be GG [43]. The blue nucleotides denote sequences in CRM-C sequences. (C): A consensus ½ GR binding site [45] was identified in the CRM-C fragment. The A at the 5′-terminus of the ½ GRE denotes the A and G can be present in this motif. (D): Summary of mutant CRM C constructs. (E): Summary of CRM-C mutants. (F,G): Comparison of transactivation of the respective CRM-C mutants and wt CRM-C construct in Neuro-2A cells. * p < 0.05.
Figure 6. Schematic of CRM-C fragment and location of putative E2F and ½ GRE. (A): Nucleotide sequence of DNA sequences that encompass the CRM-A fragment. The #1 and #2 are consensus E2F binding sites [41]. A ½ GRE is adjacent to a E2F2 binding site. The #3 denotes a G-C-rich E2F consensus binding site [43,44]. (B): Comparison of a consensus E2F binding site [41] to the two binding sites in CRM-C sequences (blue nucleotides are shaded in yellow). The S in the E2F consensus can be G or C. The g and below the E2F2 GC-rich motif are more flexible nucleotides in the consensus binding site, the C can be C or G, and the consecutive AA can also be GG [43]. The blue nucleotides denote sequences in CRM-C sequences. (C): A consensus ½ GR binding site [45] was identified in the CRM-C fragment. The A at the 5′-terminus of the ½ GRE denotes the A and G can be present in this motif. (D): Summary of mutant CRM C constructs. (E): Summary of CRM-C mutants. (F,G): Comparison of transactivation of the respective CRM-C mutants and wt CRM-C construct in Neuro-2A cells. * p < 0.05.
Cells 15 00445 g006
Cells 15 00445 g007
Figure 7. Association of GR and E2F2 with viral DNA during productive infection. (A): Schematic of ICP0 promoter that includes sequences amplified by PCR primers (R0). (B–G): Neuro-2A cells were infected with HSV-1 (MOI of 1) and the virus was incubated with the cells for 1 h at 37 °C. After removing the virus and washing with PBS, the cells incubated in 2% stripped FBS for the indicated times: this timepoint is operationally referred to as 0h after infection. ChIP studies were performed using the GR or E2F2 antibody, or nonspecific IgG as an isotope control. PCR was performed using the ICP0 CRM-C primers (B–D) or R0 (E–G) primers. DNA was separated through a 1.2% agarose gel. DNA was then stained with ethidium bromide. Bands were quantified using Image Lab software and graphed as a percentage input. All ChIP studies presented are the means of two separate transfection studies that were performed on different days. Samples designated by an asterisk show statistically significant differences from isotype control IgG by Student’s t-test (*, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ns, not significant). The h denotes the cells were infected for 0, 4, or 8 h post-infection.
Figure 7. Association of GR and E2F2 with viral DNA during productive infection. (A): Schematic of ICP0 promoter that includes sequences amplified by PCR primers (R0). (B–G): Neuro-2A cells were infected with HSV-1 (MOI of 1) and the virus was incubated with the cells for 1 h at 37 °C. After removing the virus and washing with PBS, the cells incubated in 2% stripped FBS for the indicated times: this timepoint is operationally referred to as 0h after infection. ChIP studies were performed using the GR or E2F2 antibody, or nonspecific IgG as an isotope control. PCR was performed using the ICP0 CRM-C primers (B–D) or R0 (E–G) primers. DNA was separated through a 1.2% agarose gel. DNA was then stained with ethidium bromide. Bands were quantified using Image Lab software and graphed as a percentage input. All ChIP studies presented are the means of two separate transfection studies that were performed on different days. Samples designated by an asterisk show statistically significant differences from isotype control IgG by Student’s t-test (*, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ns, not significant). The h denotes the cells were infected for 0, 4, or 8 h post-infection.
Cells 15 00445 g007
Cells 15 00445 g008
Figure 8. Association of GR and E2F2 with the ICP0 CRM-C constructs in transfected cells. (A–C): Neuro-2A cells were grown in MEM containing 2% charcoal-stripped FBS following transfection with plasmid containing the CRM-C (wt) construct (1.5 μg DNA) alone, with the E2F2 expression plasmid (1.5 μg DNA), or the GR-α expression plasmid (3.0 μg DNA). ChIP was performed as described in the Section 2 using the isotype control antibody, GR antibody, or E2F2 antibody. Location of the R0 PCR product is denoted in Figure 7A. Data presented are the means from two separate transfection studies that were performed on different days. Asterisks denote a significant difference between the GR or E2F2 specific antibody and respective isotype control (Iso) antibody. Comparison between samples was determined by Students t-test (*, p ≤ 0.05; **, p ≤ 0.01; ns, not significant). (D–F): Neuro-2A cells were grown in MEM containing 2% charcoal-stripped FBS following transfection with plasmid containing the CRM-C (∆½GRE) construct (1.5 μg DNA) alone, with E2F2 expression plasmid (1.5 μg DNA), or with GR-α expression plasmid (3.0 μg DNA). ChIP was performed as described in the Section 2 using the isotype control antibody, GR antibody, or E2F2 antibody. (G–I): Neuro-2A cells were grown in MEM containing 2% charcoal-stripped FBS following transfection with plasmid containing the CRM-C (∆1-3) construct (1.5 μg DNA) alone, with E2F2 expression plasmid (1.5 μg DNA), or with GR-α expression plasmid (3.0 μg DNA). ChIP was performed as described in the Section 2 using the isotype control antibody, GR antibody, or E2F2 antibody. All ChIP studies presented are the means from two separate transfection studies that were performed on different days. Asterisks denote a significant difference between the CRM-C∆1-3 or CRM-C∆1/2 GRE constructs compared to the wt CRM-C construct for the isotype control antibody, GR antibody, or E2F2-specific antibody (*, p ≤ 0.05; **, p ≤ 0.01).
Figure 8. Association of GR and E2F2 with the ICP0 CRM-C constructs in transfected cells. (A–C): Neuro-2A cells were grown in MEM containing 2% charcoal-stripped FBS following transfection with plasmid containing the CRM-C (wt) construct (1.5 μg DNA) alone, with the E2F2 expression plasmid (1.5 μg DNA), or the GR-α expression plasmid (3.0 μg DNA). ChIP was performed as described in the Section 2 using the isotype control antibody, GR antibody, or E2F2 antibody. Location of the R0 PCR product is denoted in Figure 7A. Data presented are the means from two separate transfection studies that were performed on different days. Asterisks denote a significant difference between the GR or E2F2 specific antibody and respective isotype control (Iso) antibody. Comparison between samples was determined by Students t-test (*, p ≤ 0.05; **, p ≤ 0.01; ns, not significant). (D–F): Neuro-2A cells were grown in MEM containing 2% charcoal-stripped FBS following transfection with plasmid containing the CRM-C (∆½GRE) construct (1.5 μg DNA) alone, with E2F2 expression plasmid (1.5 μg DNA), or with GR-α expression plasmid (3.0 μg DNA). ChIP was performed as described in the Section 2 using the isotype control antibody, GR antibody, or E2F2 antibody. (G–I): Neuro-2A cells were grown in MEM containing 2% charcoal-stripped FBS following transfection with plasmid containing the CRM-C (∆1-3) construct (1.5 μg DNA) alone, with E2F2 expression plasmid (1.5 μg DNA), or with GR-α expression plasmid (3.0 μg DNA). ChIP was performed as described in the Section 2 using the isotype control antibody, GR antibody, or E2F2 antibody. All ChIP studies presented are the means from two separate transfection studies that were performed on different days. Asterisks denote a significant difference between the CRM-C∆1-3 or CRM-C∆1/2 GRE constructs compared to the wt CRM-C construct for the isotype control antibody, GR antibody, or E2F2-specific antibody (*, p ≤ 0.05; **, p ≤ 0.01).
Cells 15 00445 g008
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jayathilake, K.; Santos, V.C.; Jones, C. Glucocorticoid Receptor and Cell Cycle Regulator (E2F2) Cooperatively Transactivate a Cis-Regulatory Module in the HSV-1 Infected Cell Protein 0 (ICP0) Promoter. Cells 2026, 15, 445. https://doi.org/10.3390/cells15050445

AMA Style

Jayathilake K, Santos VC, Jones C. Glucocorticoid Receptor and Cell Cycle Regulator (E2F2) Cooperatively Transactivate a Cis-Regulatory Module in the HSV-1 Infected Cell Protein 0 (ICP0) Promoter. Cells. 2026; 15(5):445. https://doi.org/10.3390/cells15050445

Chicago/Turabian Style

Jayathilake, Kaushalya, Vanessa Claire Santos, and Clinton Jones. 2026. "Glucocorticoid Receptor and Cell Cycle Regulator (E2F2) Cooperatively Transactivate a Cis-Regulatory Module in the HSV-1 Infected Cell Protein 0 (ICP0) Promoter" Cells 15, no. 5: 445. https://doi.org/10.3390/cells15050445

APA Style

Jayathilake, K., Santos, V. C., & Jones, C. (2026). Glucocorticoid Receptor and Cell Cycle Regulator (E2F2) Cooperatively Transactivate a Cis-Regulatory Module in the HSV-1 Infected Cell Protein 0 (ICP0) Promoter. Cells, 15(5), 445. https://doi.org/10.3390/cells15050445

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop