Screening of Key Pathways and Key Genes for the Differential Regulation of Subcutaneous and Intramuscular Fat Deposition by FTO in Chickens
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Culture of Primary Chicken Subcutaneous and Intramuscular Adipocytes
2.2. Construction of FTO Lentiviral Expression Vector
2.3. Lentiviral Transfection and Cell Treatment
2.4. FTO siRNA Transfection and Cell Treatment
2.5. Total RNA Isolation, Primer Synthesis, Reverse Transcription and qPCR
2.6. Transcriptome Sequencing Analysis
2.7. Statistical Analysis
3. Results
3.1. The Role of FTO in Proliferation and Lipid Droplet Deposition in Chicken Subcutaneous Adipocytes
3.1.1. Effects of FTO Lentiviral Expression Vector Transfection on Subcutaneous Adipocytes Proliferation and Lipid Droplet Accumulation
3.1.2. Effects of FTO siRNA Transfection on Proliferation and Lipid Droplet Accumulation in Chicken Subcutaneous Adipocytes
3.1.3. Screening of Pathways and Genes Underlying FTO-Regulated Lipid Deposition in Chicken Subcutaneous Adipocytes
3.2. Regulatory Effect and Pathway of FTO on Proliferation and Lipid Deposition in Chicken Intramuscular Adipocytes
3.2.1. Effects of FTO Lentiviral Expression Vector Transfection on Proliferation and Differentiation of Chicken Intramuscular Adipocytes
3.2.2. Effects of FTO siRNA Transfection on Proliferation and Lipid Droplet Accumulation in Chicken Intramuscular Adipocytes
3.2.3. Screening of Pathways and Genes Underlying FTO-Regulated Lipid Deposition in Intramuscular Adipocytes
3.3. Combined Analysis of Significantly Enriched Pathways in Subcutaneous and Intramuscular Adipocytes
4. Discussion
4.1. Regulatory Role of FTO in Lipid Deposition in Chicken Adipocytes
4.2. Pathways and Genes Associated with FTO-Regulated Lipid Deposition in Chicken Subcutaneous Adipocytes
4.3. Pathways and Genes Involved in FTO-Regulated Lipid Deposition in Intramuscular Adipocytes
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lu, T.; Gibril, B.A.A.; Xu, J.; Xiong, X. Unraveling the Genetic Foundations of Broiler Meat Quality: Advancements in Research and Their Impact. Genes 2024, 15, 746. [Google Scholar] [CrossRef]
- Tang, Z.; Sun, C.; Yan, Y.; Niu, Z.; Li, Y.; Xu, X.; Zhang, J.; Wu, Y.; Li, Y.; Wang, L.; et al. Aberrant Elevation of FTO Levels Promotes Liver Steatosis by Decreasing the m6A Methylation and Increasing the Stability of SREBF1 and ChREBP mRNAs. J. Mol. Cell Biol. 2023, 14, mjac061. [Google Scholar] [CrossRef]
- Laber, S.; Cox, R.D. Commentary: FTO Obesity Variant Circuitry and Adipocyte Browning in Humans. Front. Genet. 2015, 6, 318. [Google Scholar] [CrossRef] [PubMed]
- Vámos, A.; Arianti, R.; Vinnai, B.Á.; Alrifai, R.; Shaw, A.; Póliska, S.; Guba, A.; Csősz, É.; Csomós, I.; Mocsár, G.; et al. Corrigendum: Human Abdominal Subcutaneous-Derived Active Beige Adipocytes Carrying FTO Rs1421085 Obesity-Risk Alleles Exert Lower Thermogenic Capacity. Front. Cell Dev. Biol. 2023, 11, 1249909. [Google Scholar] [CrossRef]
- Yang, Z.; Yu, G.-L.; Zhu, X.; Peng, T.-H.; Lv, Y.-C. Critical Roles of FTO-Mediated mRNA m6A Demethylation in Regulating Adipogenesis and Lipid Metabolism: Implications in Lipid Metabolic Disorders. Genes Dis. 2022, 9, 51–61. [Google Scholar] [CrossRef] [PubMed]
- Popović, A.-M.; Huđek Turković, A.; Žuna, K.; Bačun-Družina, V.; Rubelj, I.; Matovinović, M. FTO Gene Polymorphisms at the Crossroads of Metabolic Pathways of Obesity and Epigenetic Influences. Food Technol. Biotechnol. 2023, 61, 14–26. [Google Scholar] [CrossRef]
- Ikels, K.; Kuschel, S.; Fischer, J.; Kaisers, W.; Eberhard, D.; Rüther, U. FTO Is a Relevant Factor for the Development of the Metabolic Syndrome in Mice. PLoS ONE 2014, 9, e105349. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Ren, W.; Li, A.; Ding, Y.; Guo, W.; Su, D.; Hu, C.; Xu, K.; Chen, H.; Xu, X.; et al. Fat Mass and Obesity-Associated Gene Enhances Oxidative Stress and Lipogenesis in Nonalcoholic Fatty Liver Disease. Dig. Dis. Sci. 2013, 58, 1004–1009. [Google Scholar] [CrossRef]
- Franczak, A.; Kolačkov, K.; Jawiarczyk-Przybyłowska, A.; Bolanowski, M. Association between FTO Gene Polymorphisms and HDL Cholesterol Concentration May Cause Higher Risk of Cardiovascular Disease in Patients with Acromegaly. Pituitary 2018, 21, 10–15. [Google Scholar] [CrossRef]
- Kang, H.; Zhang, Z.; Yu, L.; Li, Y.; Liang, M.; Zhou, L. FTO Reduces Mitochondria and Promotes Hepatic Fat Accumulation through RNA Demethylation. J. Cell. Biochem. 2018, 119, 5676–5685. [Google Scholar] [CrossRef]
- Jevsinek Skok, D.; Kunej, T.; Kovac, M.; Malovrh, S.; Potocnik, K.; Petric, N.; Zgur, S.; Dovc, P.; Horvat, S. FTO Gene Variants Are Associated with Growth and Carcass Traits in Cattle. Anim. Genet. 2016, 47, 219–222. [Google Scholar] [CrossRef]
- Huang, H.; Liu, L.; Li, C.; Liang, Z.; Huang, Z.; Wang, Q.; Li, S.; Zhao, Z. Fat Mass- and Obesity-Associated (FTO) Gene Promoted Myoblast Differentiation through the Focal Adhesion Pathway in Chicken. 3 Biotech. 2020, 10, 403. [Google Scholar] [CrossRef]
- Li, K.; Huang, W.; Wang, Z.; Nie, Q. m6A Demethylase FTO Regulate CTNNB1 to Promote Adipogenesis of Chicken Preadipocyte. J. Anim. Sci. Biotechnol. 2022, 13, 147. [Google Scholar] [CrossRef]
- Park, E.; Jeon, H.; Oh, K.-I.; Jeong, J.; Kim, D.-W.; Jin, H.-S.; Jeong, S.-Y. Coactosin-like F-Actin Binding Protein (Cotl1) Plays a Key Role in Adipocyte Differentiation and Obesity. Commun. Biol. 2025, 8, 628. [Google Scholar] [CrossRef]
- Qiu, J.; Zhang, Z.; Hu, Y.; Guo, Y.; Liu, C.; Chen, Y.; Wang, D.; Su, J.; Wang, S.; Ni, M.; et al. Transferrin Receptor Levels and Its Rare Variant Are Associated with Human Obesity. J. Diabetes. 2024, 16, e13467. [Google Scholar] [CrossRef] [PubMed]
- Ma, P.; Zhang, Y.; Yin, Y.; Wang, S.; Chen, S.; Liang, X.; Li, Z.; Deng, H. Gut Microbiota Metabolite Tyramine Ameliorates High-Fat Diet-Induced Insulin Resistance via Increased Ca2+ Signaling. EMBO J. 2024, 43, 3466–3493. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Shi, J. Insight into Rho Kinase Isoforms in Obesity and Energy Homeostasis. Front. Endocrinol. 2022, 13, 886534. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.; Wang, Y.; Xu, Q.; Li, A.; Yue, Y.; Ma, Y.; Lin, Y. LKB1 Regulates Goat Intramuscular Adipogenesis Through Focal Adhesion Pathway. Front. Physiol. 2021, 12, 755598. [Google Scholar] [CrossRef]
- Li, Y.; Fu, C.; Liu, L.; Liu, Y.; Li, F. Mechanistic Target of Rapamycin and an Extracellular Signaling-Regulated Kinases 1 and 2 Signaling Participate in the Process of Acetate Regulating Lipid Metabolism and Hormone-Sensitive Lipase Expression. Anim. Biosci. 2022, 35, 1444–1453. [Google Scholar] [CrossRef]
- Sabaté-Pérez, A.; Romero, M.; Sànchez-Fernàndez-de-Landa, P.; Carobbio, S.; Mouratidis, M.; Sala, D.; Engel, P.; Martínez-Cristóbal, P.; Villena, J.A.; Virtue, S.; et al. Autophagy-Mediated NCOR1 Degradation Is Required for Brown Fat Maturation and Thermogenesis. Autophagy 2023, 19, 904–925. [Google Scholar] [CrossRef]
- Kim, D.Y.; Choi, M.J.; Ko, T.K.; Lee, N.H.; Kim, O.-H.; Cheon, H.G. Angiotensin AT1 Receptor Antagonism by Losartan Stimulates Adipocyte Browning via Induction of Apelin. J. Biol. Chem. 2020, 295, 14878–14892. [Google Scholar] [CrossRef]
- Zhao, C.; Wen, Z.; Gao, Y.; Xiao, F.; Yan, J.; Wang, X.; Meng, T. Pantothenic Acid Alleviates Fat Deposition and Inflammation by Suppressing the JNK/P38 MAPK Signaling Pathway. J. Med. Food. 2024, 27, 834–843. [Google Scholar] [CrossRef] [PubMed]
- Figarola, J.L.; Rahbar, S. Small-Molecule COH-SR4 Inhibits Adipocyte Differentiation via AMPK Activation. Int. J. Mol. Med. 2013, 31, 1166–1176. [Google Scholar] [CrossRef] [PubMed]
- Magusto, J.; Beaupère, C.; Afonso, M.B.; Auclair, M.; Delaunay, J.-L.; Soret, P.-A.; Courtois, G.; Aït-Slimane, T.; Housset, C.; Jéru, I.; et al. The Necroptosis-Inducing Pseudokinase Mixed Lineage Kinase Domain-like Regulates the Adipogenic Differentiation of Pre-Adipocytes. iScience 2022, 25, 105166. [Google Scholar] [CrossRef]
- Zhang, X.; Luo, S.; Wang, M.; Cao, Q.; Zhang, Z.; Huang, Q.; Li, J.; Deng, Z.; Liu, T.; Liu, C.-L.; et al. Differential IL18 Signaling via IL18 Receptor and Na-Cl Co-Transporter Discriminating Thermogenesis and Glucose Metabolism Regulation. Nat. Commun. 2022, 13, 7582. [Google Scholar] [CrossRef]
- Liu, G.; Chen, L.; Zhao, J.; Jiang, Y.; Guo, Y.; Mao, X.; Ren, X.; Liu, K.; Mei, Q.; Li, Q.; et al. Deciphering the Metabolic Impact and Clinical Relevance of N-Glycosylation in Colorectal Cancer through Comprehensive Glycoproteomic Profiling. Adv. Sci. 2025, 12, e2415645. [Google Scholar] [CrossRef] [PubMed]
- Cremonini, E.; Da Silva, L.M.E.; Lanzi, C.R.; Marino, M.; Iglesias, D.E.; Oteiza, P.I. Anthocyanins and Their Metabolites Promote White Adipose Tissue Beiging by Regulating Mitochondria Thermogenesis and Dynamics. Biochem. Pharmacol. 2024, 222, 116069. [Google Scholar] [CrossRef]
- Ma, S.; Wang, Y.; Fan, S.; Jiang, W.; Sun, M.; Jing, M.; Bi, W.; Zhou, M.; Wu, D. TSH-Stimulated Hepatocyte Exosomes Modulate Liver-Adipose Triglyceride Accumulation via the TGF-Β1/ATGL Axis in Mice. Lipids Health Dis. 2025, 24, 81. [Google Scholar] [CrossRef]
- Liu, Y.; Zhao, Y.; Wu, R.; Chen, Y.; Chen, W.; Liu, Y.; Luo, Y.; Huang, C.; Zeng, B.; Liao, X.; et al. mRNA m5C Controls Adipogenesis by Promoting CDKN1A mRNA Export and Translation. RNA Biol. 2021, 18, 711–721. [Google Scholar] [CrossRef]
- Ren, J.-G.; Xing, B.; Lv, K.; O’Keefe, R.A.; Wu, M.; Wang, R.; Bauer, K.M.; Ghazaryan, A.; Burslem, G.M.; Zhang, J.; et al. RAB27B Controls Palmitoylation-Dependent NRAS Trafficking and Signaling in Myeloid Leukemia. J. Clin. Investig. 2023, 133, e165510. [Google Scholar] [CrossRef]
- Morandi, E.M.; Verstappen, R.; Zwierzina, M.E.; Geley, S.; Pierer, G.; Ploner, C. ITGAV and ITGA5 Diversely Regulate Proliferation and Adipogenic Differentiation of Human Adipose Derived Stem Cells. Sci. Rep. 2016, 6, 28889. [Google Scholar] [CrossRef]
- Tomas, A.; Yermen, B.; Min, L.; Pessin, J.E.; Halban, P.A. Regulation of Pancreatic Beta-Cell Insulin Secretion by Actin Cytoskeleton Remodelling: Role of Gelsolin and Cooperation with the MAPK Signalling Pathway. J. Cell Sci. 2006, 119, 2156–2167. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.; Zhou, L.; Zhong, Y.; Ding, Z.; Lin, S.; Hou, X.; Zhou, X.; Shao, J.; Yang, F.; Zou, X.; et al. Kindlin-2 Haploinsufficiency Protects against Fatty Liver by Targeting Foxo1 in Mice. Nat. Commun. 2022, 13, 1025. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Li, D.; Cao, G.; Shi, Q.; Zhu, J.; Zhang, M.; Cheng, H.; Wen, Q.; Xu, H.; Zhu, L.; et al. IL-27 Signalling Promotes Adipocyte Thermogenesis and Energy Expenditure. Nature 2021, 600, 314–318. [Google Scholar] [CrossRef]
- Chakrabarti, P.; English, T.; Karki, S.; Qiang, L.; Tao, R.; Kim, J.; Luo, Z.; Farmer, S.R.; Kandror, K.V. SIRT1 Controls Lipolysis in Adipocytes via FOXO1-Mediated Expression of ATGL. J. Lipid Res. 2011, 52, 1693–1701. [Google Scholar] [CrossRef]
- Al Madhoun, A.; Kochumon, S.; Al-Rashed, F.; Sindhu, S.; Thomas, R.; Miranda, L.; Al-Mulla, F.; Ahmad, R. Dectin-1 as a Potential Inflammatory Biomarker for Metabolic Inflammation in Adipose Tissue of Individuals with Obesity. Cells 2022, 11, 2879. [Google Scholar] [CrossRef] [PubMed]
- Yadav, H.; Quijano, C.; Kamaraju, A.K.; Gavrilova, O.; Malek, R.; Chen, W.; Zerfas, P.; Zhigang, D.; Wright, E.C.; Stuelten, C.; et al. Protection from Obesity and Diabetes by Blockade of TGF-β/Smad3 Signaling. Cell Metab. 2011, 14, 67–79. [Google Scholar] [CrossRef]
- Tirosh, A.; Tuncman, G.; Calay, E.S.; Rathaus, M.; Ron, I.; Tirosh, A.; Yalcin, A.; Lee, Y.G.; Livne, R.; Ron, S.; et al. Intercellular Transmission of Hepatic ER Stress in Obesity Disrupts Systemic Metabolism. Cell Metab. 2021, 33, 1716. [Google Scholar] [CrossRef]
- McCurdy, C.E.; Klemm, D.J. Adipose Tissue Insulin Sensitivity and Macrophage Recruitment: Does PI3K Pick the Pathway? Adipocyte 2013, 2, 135–142. [Google Scholar] [CrossRef]
- Wang, J.; Cai, S.; Xiong, Q.; Weng, D.; Wang, Q.; Ma, Z. PIK3R2 Predicts Poor Outcomes for Patients with Melanoma and Contributes to the Malignant Progression via PI3K/AKT/NF-κB Axis. Clin. Transl. Oncol. 2023, 25, 1402–1412. [Google Scholar] [CrossRef]
- Huang, K.; Liang, J.J.; Lin, Y.Q.; Zhu, J.J.; Ma, J.Q.; Wang, Y. Molecular Characterization of Fibroblast Growth Factor-16 and Its Role in Promoting the Differentiation of Intramuscular Preadipocytes in Goat. Animal 2020, 14, 2351–2362. [Google Scholar] [CrossRef]
- Shamsi, F.; Xue, R.; Huang, T.L.; Lundh, M.; Liu, Y.; Leiria, L.O.; Lynes, M.D.; Kempf, E.; Wang, C.-H.; Sugimoto, S.; et al. FGF6 and FGF9 Regulate UCP1 Expression Independent of Brown Adipogenesis. Nat. Commun. 2020, 11, 1421. [Google Scholar] [CrossRef]
- Luo, J.-H.; Wang, F.-X.; Zhao, J.-W.; Yang, C.-L.; Rong, S.-J.; Lu, W.-Y.; Chen, Q.-J.; Zhou, Q.; Xiao, J.; Wang, Y.-N.; et al. PDIA3 Defines a Novel Subset of Adipose Macrophages to Exacerbate the Development of Obesity and Metabolic Disorders. Cell Metab. 2024, 36, 2262–2280.e5. [Google Scholar] [CrossRef]
- Ji, Y.; Cao, M.; Liu, J.; Chen, Y.; Li, X.; Zhao, J.; Qu, C. Rock Signaling Control PPARγ Expression and Actin Polymerization during Adipogenesis. Saudi J. Biol. Sci. 2017, 24, 1866–1870. [Google Scholar] [CrossRef]









| GENES | SEQUENCE 5′ TO3 ′ |
|---|---|
| β-ACTIN | F: 5′GTCCACCTTCCAGCAGATGT3′ |
| R: 5′ATAAAGCCATGCCAATCTCG3′ | |
| FTO | F: 5′CTGGTCCTCCAGAAGTTCG3′ |
| R: 5′CTGCTCTTCTGGCAAGCTCT3′ | |
| NRAS | F: 5′CCAGCTCATCCAGAACCACTT3′ |
| R: 5′TCCTGCAGTGTCCAGAATGTC3′ | |
| ITGAV | F: 5′GACGCCTCCTCGATGTTTCT3′ |
| R: 5′ATACAATGGGGCACAAGCCA3′ | |
| FGF9 | F: 5′TTTATTGGCCACGTGAGGCT3′ |
| R: 5′GCCACAAAGTAAAGCCCAGC3′ | |
| FGF16 | F: 5′CACTTTTTACCGAGGCCCGT3′ |
| R: 5′TGGGAAAAAGCTTGGGAGCC3′ | |
| RHOA | F: 5′CCTGTGGAGCAGGAAGCG3′ |
| R: 5′AAGCCAACTCCACCTGCTTT3′ | |
| PIK3R2 | F: 5′TTCGGGGAGGTTCGTTCTTC3′ |
| R: 5′TCCAGCCCGTTCCTTCTTTC3′ | |
| FTO-205 | S: 5′CCAGAUAUUCCAAGCUAAUTT3′ |
| A: 5′AUUAGCUUGGAAUAUCUGGTT3′ | |
| FTO-858 | S: 5′GCUGAAGAAGCUACUGAUUTT3′ |
| A: 5′AAUCAGUAGCUUCUUCAGCTT3′ | |
| FTO-1286 | S: 5′GCUUAAGCCUAUGGCUAAATT3′ |
| A: 5′UUUAGCCAUAGGCUUAAGCTT3′ |
| Pathway | p Value | Genes |
|---|---|---|
| Regulation of actin cytoskeleton | 0.0006 | LPAR4, ITGAV, NRAS, ITGA4, ITGB8, PDGFRA, BRAF, ROCK1 CRKL, PPP1R12A, ROCK2 |
| Endocytosis | 0.0008 | RAB22A, RAB10, PARD6B, DAB2, CHMP1A, CHMP6, STAM, EEA1 PDGFRA, ARAP2, IGF2R, ARHGEF3 |
| Vascular smooth muscle contraction | 0.0013 | EDN3, EDNRA, ROCK1, BRAF, MRVI1, PPP1R12A, ROCK2, GNAQ |
| Focal adhesion | 0.0021 | ARHGAP5, ITGAV, ITGA4, ITGB8, PDGFRA, BRAF, ROCK1, CRKL, PPP1R12A, ROCK2 |
| mTOR signaling pathway | 0.0036 | RPS6KA3, RICTOR, CAB39, FZD1, ATP6V1D, BRAF, NRAS, FNIP2 |
| Autophagy—animal | 0.0050 | UVRAG, RB1CC1, NRAS, EIF2AK4, RAB33B, GABARAPL1, IRS4 |
| Apelin signaling pathway | 0.0055 | NOV, GNB4, NRAS, GNB, GABARAPL1, PIK3CG, GNAQ |
| MMAPK signaling pathway | 0.0066 | RPS6KA3, RASA2, NGF, ATF2, PDGFRA, BRAF, NRAS, CRKL, IL1R1, STK4, MAP4K3 |
| Ribosome biogenesis in eukaryotes | 0.0073 | SBDS, BMS1, HEATR1, XRN1, XPO1 |
| Necroptosis | 0.0089 | SMPD1, CHMP1A, CHMP6, HSP90AA1, PARP4, JAK2, FADD |
| cytokine–cytokine receptor interaction | 0.0096 | TNFSF15, IL18, NGF, CXCR7, BMPR2, EDA, INHBA, IL1R1, CCL4 |
| N-Glycan biosynthesis | 0.0120 | ALG2, MAN2A1, B4GALT2, B4GALT1 |
| Mitophagy-animal | 0.0204 | GABARAPL1, NRAS, TAX1BP1, USP15 |
| TGF-beta signaling pathway | 0.0221 | INHBA, CUL1, ROCK1, BMPR2, DCN |
| RNA transport | 0.0293 | THOC2, TACC3, UBE2I, TPR, EIF1B, XPO1 |
| Salmonella infection | 0.0360 | CCL4, IL18, ROCK1, ROCK2 |
| Hedgehog signaling pathway | 0.0375 | EVC, CUL1, SPOPL |
| Pathway | p Value | Genes |
|---|---|---|
| MAPK signaling pathway | 0.014 | HGF, FGF9, PDGFB, NGF, AKT3, FGF16 |
| cytokine–cytokine receptor interaction | 0.018 | IL18, NGF, BMP15, IFNGR2, IL4R |
| FoxO signaling pathway | 0.014 | CDKN2B, CDKN2A, PIK3R2, AKT3, FOXO4 |
| TGF-beta signaling pathway | 0.031 | CDKN2B, CDKN2A, SMAD6, RHOA |
| Focal adhesion pathway | 0.003 | HGF, ITGA1, RHOA, PDGFB, PIK3R2, AKT3 |
| Regulation of actin cytoskeleton | 0.003 | ITGA1, FGF9, RHOA, PDGFB, PIK3R2, FGF16 |
| Gap junction | 0.001 | TUBA4A, HTR2B, TUBB4B, PDGFB, GJA1 |
| Apoptosis | 0.016 | TUBA4A, NGF, PIK3R2, AKT3 |
| Toll-like receptor signaling pathway | 0.026 | TLR5, PIK3R2, AKT3 |
| C-type lectin receptor signaling pathway | 0.029 | RHOA, PIK3R2, AKT3 |
| Salmonella infection | 0.002 | TLR5, IFNGR2, IL18, RHOG |
| Influenza A | 0.019 | IFNGR2, IL18, PIK3R2, AKT3 |
| AGE-RAGE signaling pathway in diabetic complications | 0.031 | PIM1, PIK3R2, AKT3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Huang, H.-Y.; Kong, Y.; Li, C.-M.; Sui, Y.-L.; Wang, Q.-B.; Zhao, Z.-H.; Kong, L.-L.; Wu, Z.-L.; Han, W. Screening of Key Pathways and Key Genes for the Differential Regulation of Subcutaneous and Intramuscular Fat Deposition by FTO in Chickens. Cells 2026, 15, 903. https://doi.org/10.3390/cells15100903
Huang H-Y, Kong Y, Li C-M, Sui Y-L, Wang Q-B, Zhao Z-H, Kong L-L, Wu Z-L, Han W. Screening of Key Pathways and Key Genes for the Differential Regulation of Subcutaneous and Intramuscular Fat Deposition by FTO in Chickens. Cells. 2026; 15(10):903. https://doi.org/10.3390/cells15100903
Chicago/Turabian StyleHuang, Hua-Yun, Yi Kong, Chun-Miao Li, Yu-Le Sui, Qian-Bao Wang, Zhen-Hua Zhao, Ling-Lin Kong, Zhao-Lin Wu, and Wei Han. 2026. "Screening of Key Pathways and Key Genes for the Differential Regulation of Subcutaneous and Intramuscular Fat Deposition by FTO in Chickens" Cells 15, no. 10: 903. https://doi.org/10.3390/cells15100903
APA StyleHuang, H.-Y., Kong, Y., Li, C.-M., Sui, Y.-L., Wang, Q.-B., Zhao, Z.-H., Kong, L.-L., Wu, Z.-L., & Han, W. (2026). Screening of Key Pathways and Key Genes for the Differential Regulation of Subcutaneous and Intramuscular Fat Deposition by FTO in Chickens. Cells, 15(10), 903. https://doi.org/10.3390/cells15100903
