Atrophic C2C12 Myotubes Activate Inflammatory Response of Macrophages In Vitro
Abstract
:1. Introduction
2. Materials and Methods
2.1. Culture and Atrophy Induction of C2C12 Cells
2.2. Immunofluorescence Staining and Myotube Diameter Measurement
2.3. Collection of Conditioned Medium Derived from Myotubes
2.4. Measurement of Lactate Dehydrogenase Release
2.5. Harvest and Treatment of Bone Marrow-Derived Macrophages
2.6. Quantitative RT-PCR Analysis
2.7. Statistical Analysis
3. Results
3.1. Characterization of D-Galactose-Treated Myotubes and Starvation-Treated Myotubes
3.2. Cytotoxic Effects of D-Galactose Treatment and Starvation Treatment on Myotubes
3.3. Conditioned Medium Derived from Atrophic Myotubes Promotes Lipopolysaccharide-Induced Inflammatory Responses in Bone Marrow-Derived Macrophages
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
BMDMs | Bone marrow-derived macrophages |
LPS | Lipopolysaccharide |
DMEM | Dulbecco’s modified Eagle’s medium |
FBS | Fetal bovine serum |
HS | Horse serum |
EBSS | Earle’s balanced salt solution |
MHC | Myosin heavy chain |
CM | Conditional medium |
M-CSF | Macrophage colony-stimulating factor |
MuRF-1 | Muscle RING finger-1 |
MAFbx | Muscular atrophy F-box |
References
- Sakuma, K.; Yamaguchi, A. Sarcopenia and cachexia: The adaptations of negative regulators of skeletal muscle mass. J. Cachexia Sarcopenia Muscle. 2012, 3, 77–94. [Google Scholar] [CrossRef]
- Henrot, P.; Blervaque, L.; Dupin, I.; Zysman, M.; Esteves, P.; Gouzi, F.; Hayot, M.; Pomiès, P.; Berger, P. Cellular interplay in skeletal muscle regeneration and wasting: Insights from animal models. J. Cachexia Sarcopenia Muscle 2023, 14, 745–757. [Google Scholar] [CrossRef] [PubMed]
- Kalinkovich, A.; Livshits, G. Sarcopenic obesity or obese sarcopenia: A cross talk between age-associated adipose tissue and skeletal muscle inflammation as a main mechanism of the pathogenesis. Ageing Res. Rev. 2017, 35, 200–221. [Google Scholar] [CrossRef] [PubMed]
- Setiawan, T.; Sari, I.N.; Wijaya, Y.T.; Julianto, N.M.; Muhammad, J.A.; Lee, H.; Chae, J.H.; Kwon, H.Y. Cancer cachexia: Molecular mechanisms and treatment strategies. J. Hematol. Oncol. 2023, 16, 54. [Google Scholar] [CrossRef] [PubMed]
- Bennett, J.L.; Pratt, A.G.; Dodds, R.; Sayer, A.A.; Isaacs, J.D. Rheumatoid sarcopenia: Loss of skeletal muscle strength and mass in rheumatoid arthritis. Nat. Rev. Rheumatol. 2023, 19, 239–251. [Google Scholar] [CrossRef]
- Picca, A.; Coelho-Junior, H.J.; Calvani, R.; Marzetti, E.; Vetrano, D.L. Biomarkers shared by frailty and sarcopenia in older adults: A systematic review and meta-analysis. Ageing Res. Rev. 2022, 73, 101530. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K. Chronic Inflammation as an Immunological Abnormality and Effectiveness of Exercise. Biomolecules 2019, 9, 223. [Google Scholar] [CrossRef] [PubMed]
- Antuña, E.; Cachán-Vega, C.; Bermejo-Millo, J.C.; Potes, Y.; Caballero, B.; Vega-Naredo, I.; Coto-Montes, A.; Garcia-Gonzalez, C. Inflammaging: Implications in Sarcopenia. Int. J. Mol. Sci. 2022, 23, 15039. [Google Scholar] [CrossRef]
- Files, D.C.; D’Alessio, F.R.; Johnston, L.F.; Kesari, P.; Aggarwal, N.R.; Garibaldi, B.T.; Mock, J.R.; Simmers, J.L.; DeGorordo, A.; Murdoch, J.; et al. A critical role for muscle ring finger-1 in acute lung injury-associated skeletal muscle wasting. Am. J. Respir. Crit. Care Med. 2012, 185, 825–834. [Google Scholar] [CrossRef]
- Pellegrino, R.; Paganelli, R.; Di Iorio, A.; Bandinelli, S.; Moretti, A.; Iolascon, G.; Sparvieri, E.; Tarantino, D.; Tanaka, T.; Ferrucci, L. Beyond Inflammaging: The Impact of Immune System Aging on Age-Related Muscle Decline, Results From the InCHIANTI Study. J. Gerontol. Ser. A 2024, 79, glad238. [Google Scholar] [CrossRef] [PubMed]
- Osa, S.; Enoki, Y.; Miyajima, T.; Akiyama, M.; Fujiwara, Y.; Taguchi, K.; Kim, Y.G.; Matsumoto, K. Sciatic denervation-induced skeletal muscle atrophy is associated with persistent inflammation and increased mortality during sepsis. Shock 2023, 59, 417–425. [Google Scholar] [CrossRef] [PubMed]
- Pedersen, M.; Cromwell, J.; Nau, P. Sarcopenia is a Predictor of Surgical Morbidity in Inflammatory Bowel Disease. Inflamm. Bowel Dis. 2017, 23, 1867–1872. [Google Scholar] [CrossRef] [PubMed]
- Minawala, R.; Faye, A.S. Sarcopenia as a Preoperative Risk Stratification Tool among Older Adults with Inflammatory Bowel Disease. Adv. Geriatr. Med. Res. 2024, 6, e240003. [Google Scholar] [PubMed]
- Zhang, X.; Mosser, D.M. Macrophage activation by endogenous danger signals. J. Pathol. 2008, 214, 161–178. [Google Scholar] [CrossRef] [PubMed]
- Laskin, D.L.; Sunil, V.R.; Gardner, C.R.; Laskin, J.D. Macrophages and tissue injury: Agents of defense or destruction? Annu. Rev. Pharmacol. Toxicol. 2011, 51, 267–288. [Google Scholar] [CrossRef]
- Chen, Q.N.; Fan, Z.; Lyu, A.K.; Wu, J.; Guo, A.; Yang, Y.F.; Chen, J.L.; Xiao, Q. Effect of sarcolipin-mediated cell transdifferentiation in sarcopenia-associated skeletal muscle fibrosis. Exp. Cell Res. 2020, 389, 111890. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.H.; Sun, Y.N.; Qu, T.Q.; Sang, X.Q.; Zhou, L.M.; Li, Y.X.; Ren, F.Z. Nobiletin Prevents D-Galactose-Induced C2C12 Cell Aging by Improving Mitochondrial Function. Int. J. Mol. Sci. 2022, 23, 11963. [Google Scholar] [CrossRef] [PubMed]
- Caldow, M.K.; Ham, D.J.; Trieu, J.; Chung, J.D.; Lynch, G.S.; Koopman, R. Glycine Protects Muscle Cells From Wasting in vitro via mTORC1 Signaling. Front. Nutr. 2019, 6, 172. [Google Scholar] [CrossRef]
- Chen, W.; Shen, Z.; Dong, W.; Huang, G.; Yu, D.; Chen, W.; Yan, X.; Yu, Z. Polygonatum sibiricum polysaccharide ameliorates skeletal muscle aging via mitochondria-associated membrane-mediated calcium homeostasis regulation. Phytomedicine 2024, 129, 155567. [Google Scholar] [CrossRef]
- Ye, Y.L.; Kuai, Z.; Qian, D.D.; He, Y.T.; Shen, J.P.; Wu, K.F.; Ren, W.Y.; Hu, Y. GLP-2 ameliorates D-galactose induced muscle aging by IGF-1/Pi3k/Akt/FoxO3a signaling pathway in C2C12 cells and mice. Arch. Gerontol. Geriatr. 2024, 124, 105462. [Google Scholar] [CrossRef] [PubMed]
- Nie, C.; Wang, B.; Fan, M.; Wang, Y.; Sun, Y.; Qian, H.; Li, Y.; Wang, L. Highland Barley Tea Polyphenols Extract Alleviates Skeletal Muscle Fibrosis in Mice by Reducing Oxidative Stress, Inflammation, and Cell Senescence. J. Agric. Food Chem. 2023, 71, 739–748. [Google Scholar] [CrossRef] [PubMed]
- Shao, X.; Gong, W.; Wang, Q.; Wang, P.; Shi, T.; Mahmut, A.; Qin, J.; Yao, Y.; Yan, W.; Chen, D.; et al. Atrophic skeletal muscle fibre-derived small extracellular vesicle miR-690 inhibits satellite cell differentiation during ageing. J. Cachexia Sarcopenia Muscle 2022, 13, 3163–3180. [Google Scholar] [CrossRef] [PubMed]
- Ferraro, E.; Giammarioli, A.M.; Caldarola, S.; Lista, P.; Feraco, A.; Tinari, A.; Salvatore, A.M.; Malorni, W.; Berghella, L.; Rosano, G. The metabolic modulator trimetazidine triggers autophagy and counteracts stress-induced atrophy in skeletal muscle myotubes. FEBS J. 2013, 280, 5094–5108. [Google Scholar] [CrossRef]
- Brun, A.; Mougeot, G.; Denis, P.; Collin, M.L.; Pouchin, P.; Montaurier, C.; Walrand, S.; Capel, F.; Gueugneau, M. A new bio imagery user-friendly tool for automatic morphometry measurement on muscle cell cultures and histological sections. Sci. Rep. 2024, 14, 3108. [Google Scholar] [CrossRef]
- Csibi, A.; Leibovitch, M.P.; Cornille, K.; Tintignac, L.A.; Leibovitch, S.A. MAFbx/Atrogin-1 controls the activity of the initiation factor eIF3-f in skeletal muscle atrophy by targeting multiple C-terminal lysines. J. Biol. Chem. 2009, 284, 4413–4421. [Google Scholar] [CrossRef] [PubMed]
- Fakhfakh, R.; Michaud, A.; Tremblay, J.P. Blocking the myostatin signal with a dominant negative receptor improves the success of human myoblast transplantation in dystrophic mice. Mol. Ther. 2011, 19, 204–210. [Google Scholar] [CrossRef]
- Zanders, L.; Kny, M.; Hahn, A.; Schmidt, S.; Wundersitz, S.; Todiras, M.; Lahmann, I.; Bandyopadhyay, A.; Wollersheim, T.; Kaderali, L.; et al. Sepsis induces interleukin 6, gp130/JAK2/STAT3, and muscle wasting. J. Cachexia Sarcopenia Muscle 2022, 13, 713–727. [Google Scholar] [CrossRef]
- Hargreaves, M.; Spriet, L.L. Skeletal muscle energy metabolism during exercise. Nat. Metab. 2020, 2, 817–828. [Google Scholar] [CrossRef] [PubMed]
- Giudice, J.; Taylor, J.M. Muscle as a paracrine and endocrine organ. Curr. Opin. Pharmacol. 2017, 34, 49–55. [Google Scholar] [CrossRef]
- Pedersen, B.K.; Febbraio, M.A. Muscles, exercise and obesity: Skeletal muscle as a secretory organ. Nat. Rev. Endocrinol. 2012, 8, 457–465. [Google Scholar] [CrossRef] [PubMed]
- Xie, W.Q.; He, M.; Yu, D.J.; Wu, Y.X.; Wang, X.H.; Lv, S.; Xiao, W.F.; Li, Y.S. Mouse models of sarcopenia: Classification and evaluation. J. Cachexia Sarcopenia Muscle 2021, 12, 538–554. [Google Scholar] [CrossRef]
- Wu, Y.; Wu, Y.; Yang, Y.; Yu, J.; Wu, J.; Liao, Z.; Guo, A.; Sun, Y.; Zhao, Y.; Chen, J.; Xiao, Q.; et al. Lysyl oxidase-like 2 inhibitor rescues D-galactose-induced skeletal muscle fibrosis. Aging Cell. 2022, 21, e13659. [Google Scholar] [CrossRef]
- Bai, J.; Wang, X.; Chen, Y.; Yuan, Q.; Yang, Z.; Mi, Y.; Zhang, C. Nobiletin Ameliorates Aging of Chicken Ovarian Prehierarchical Follicles by Suppressing Oxidative Stress and Promoting Autophagy. Cells 2024, 13, 415. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.; Ullah, R.; Rehman, S.U.; Shah, S.A.; Saeed, K.; Muhammad, T.; Park, H.Y.; Jo, M.H.; Choe, K.; Rutten, B.P.F.; et al. 17β-Estradiol Modulates SIRT1 and Halts Oxidative Stress-Mediated Cognitive Impairment in a Male Aging Mouse Model. Cells 2019, 8, 928. [Google Scholar] [CrossRef]
- Jiang, X.; Ji, S.; Yuan, F.; Li, T.; Cui, S.; Wang, W.; Ye, X.; Wang, R.; Chen, Y.; Zhu, S. Pyruvate dehydrogenase B regulates myogenic differentiation via the FoxP1-Arih2 axis. J. Cachexia Sarcopenia Muscle 2023, 14, 606–621. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.H.; Zhang, Y.; Qu, T.Q.; Sang, X.Q.; Li, Y.X.; Ren, F.Z.; Wen, P.C.; Sun, Y.N. Nobiletin Improves D-Galactose-Induced Aging Mice Skeletal Muscle Atrophy by Regulating Protein Homeostasis. Nutrients 2023, 15, 1801. [Google Scholar] [CrossRef]
- Gomes, M.D.; Lecker, S.H.; Jagoe, R.T.; Navon, A.; Goldberg, A.L. Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc. Natl. Acad. Sci. USA 2001, 98, 14440–14445. [Google Scholar] [CrossRef] [PubMed]
- Peker, N.; Sharma, M.; Kambadur, R. Parkin deficiency exacerbates fasting-induced skeletal muscle wasting in mice. npj Park. Dis. 2022, 8, 159. [Google Scholar] [CrossRef] [PubMed]
- Oyabu, M.; Takigawa, K.; Mizutani, S.; Hatazawa, Y.; Fujita, M.; Ohira, Y.; Sugimoto, T.; Suzuki, O.; Tsuchiya, K.; Suganami, T.; et al. FOXO1 cooperates with C/EBPδ and ATF4 to regulate skeletal muscle atrophy transcriptional program during fasting. FASEB J. 2022, 36, e22152. [Google Scholar] [CrossRef]
- Sandri, M.; Sandri, C.; Gilbert, A.; Skurk, C.; Calabria, E.; Picard, A.; Walsh, K.; Schiaffino, S.; Lecker, S.H.; Goldberg, A.L. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 2004, 117, 399–412. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, E.J.; Koncarevic, A.; Giresi, P.G.; Jackman, R.W.; Kandarian, S.C. Transcriptional profile of a myotube starvation model of atrophy. J. Appl. Physiol. 2005, 98, 1396–1406. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, A.; Maeshige, N.; Yan, J.; Ma, X.; Uemura, M.; Matsuda, M.; Nishimura, Y.; Hasunuma, T.; Kondo, H.; Fujino, H.; et al. Skeletal myotube-derived extracellular vesicles enhance itaconate production and attenuate inflammatory responses of macrophages. Front. Immunol. 2023, 14, 1099799. [Google Scholar] [CrossRef]
- Yamaguchi, A.; Maeshige, N.; Noguchi, H.; Yan, J.; Ma, X.; Uemura, M.; Su, D.; Kondo, H.; Sarosiek, K.; Fujino, H. Pulsed ultrasound promotes secretion of anti-inflammatory extracellular vesicles from skeletal myotubes via elevation of intracellular calcium level. Elife 2023, 12, RP89512. [Google Scholar] [CrossRef]
- Tang, X.; Metzger, D.; Leeman, S.; Amar, S. LPS-induced TNF-alpha factor (LITAF)-deficient mice express reduced LPS-induced cytokine: Evidence for LITAF-dependent LPS signaling pathways. Proc. Natl. Acad. Sci. USA 2006, 103, 13777–13782. [Google Scholar] [CrossRef] [PubMed]
- Shapouri-Moghaddam, A.; Mohammadian, S.; Vazini, H.; Taghadosi, M.; Esmaeili, S.A.; Mardani, F.; Seifi, B.; Mohammadi, A.; Afshari, J.T.; Sahebkar, A. Macrophage plasticity, polarization, and function in health and disease. J. Cell Physiol. 2018, 233, 6425–6440. [Google Scholar] [CrossRef] [PubMed]
- Bashir, S.; Sharma, Y.; Elahi, A.; Khan, F. Macrophage polarization: The link between inflammation and related diseases. Inflamm. Res. 2016, 65, 1–11. [Google Scholar] [CrossRef]
- Benoit, M.; Desnues, B.; Mege, J.L. Macrophage polarization in bacterial infections. J. Immunol. 2008, 181, 3733–3739. [Google Scholar] [CrossRef] [PubMed]
- Kawanishi, N.; Yano, H.; Yokogawa, Y.; Suzuki, K. Exercise training inhibits inflammation in adipose tissue via both suppression of macrophage infiltration and acceleration of phenotypic switching from M1 to M2 macrophages in high-fat-diet-induced obese mice. Exerc. Immunol. Rev. 2010, 16, 105–118. [Google Scholar]
- Xiang, X.; Xin, X.; Hou, Y.; Deng, Y.; Liu, X.; Yu, W. Diosgenin alters LPS-induced macrophage polarization by activating PPARγ/NF-κB signaling pathway. Int. Immunopharmacol. 2024, 126, 111270. [Google Scholar] [CrossRef] [PubMed]
- Hung, Y.L.; Wang, S.C.; Suzuki, K.; Fang, S.H.; Chen, C.S.; Cheng, W.C.; Su, C.C.; Yeh, H.C.; Tu, H.P.; Liu, P.L. Bavachin attenuates LPS-induced inflammatory response and inhibits the activation of NLRP3 inflammasome in macrophages. Phytomedicine 2019, 59, 152785. [Google Scholar] [CrossRef]
- Gazzinelli, R.T.; Wysocka, M.; Hieny, S.; Scharton-Kersten, T.; Cheever, A.; Kühn, R.; Müller, W.; Trinchieri, G.; Sher, A. In the absence of endogenous IL-10, mice acutely infected with Toxoplasma gondii succumb to a lethal immune response dependent on CD4+ T cells and accompanied by overproduction of IL-12, IFN-gamma and TNF-alpha. J. Immunol. 1996, 157, 798–805. [Google Scholar] [CrossRef]
- Kobayashi, T.; Matsuoka, K.; Sheikh, S.Z.; Russo, S.M.; Mishima, Y.; Collins, C.; deZoeten, E.F.; Karp, C.L.; Ting, J.P.; Sartor, R.B.; et al. IL-10 regulates Il12b expression via histone deacetylation: Implications for intestinal macrophage homeostasis. J. Immunol. 2012, 189, 1792–1799. [Google Scholar] [CrossRef]
- Watford, W.T.; Hissong, B.D.; Bream, J.H.; Kanno, Y.; Muul, L.; O’Shea, J.J. Signaling by IL-12 and IL-23 and the immunoregulatory roles of STAT4. Immunol. Rev. 2004, 202, 139–156. [Google Scholar] [CrossRef] [PubMed]
- Lai, Y.; Ramírez-Pardo, I.; Isern, J.; An, J.; Perdiguero, E.; Serrano, A.L.; Li, J.; García-Domínguez, E.; Segalés, J.; Guo, P.; et al. Multimodal cell atlas of the ageing human skeletal muscle. Nature 2024, 629, 154–164. [Google Scholar] [CrossRef]
- Kedlian, V.R.; Wang, Y.; Liu, T.; Chen, X.; Bolt, L.; Tudor, C.; Shen, Z.; Fasouli, E.S.; Prigmore, E.; Kleshchevnikov, V.; et al. Human skeletal muscle aging atlas. Nat. Aging 2024, 4, 727–744. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Suzuki, K. The Effects of Flavonoids on Skeletal Muscle Mass, Muscle Function, and Physical Performance in Individuals with Sarcopenia: A Systematic Review of Randomized Controlled Trials. Nutrients 2023, 15, 3897. [Google Scholar] [CrossRef]
Gene | Forward (5′–3′) | Reverse (3′–5′) |
---|---|---|
Fbxo32 | GCTGGATTGGAAGAAGATG | AGAGAATGTGGCAGTGTT |
Trim63 | CGACATCTTCCAGGCTGCGAAT | ATCACTTCATGGCGGCACGAG |
Il6 | CTTGGGACTGATGCTGGTGACA | GCCTCCGACTTGTGAAGTGGTA |
Il1b | TGCCACCTTTTGACAGTGATG | ATGTGCTGCTGCGAGATTTG |
Il12b | GAATGGCGTCTCTGTCTG | GCTGGTGCTGTAGTTCTC |
Tnf | GTCCCCAAAGGGATGAGAAGT | TTTGCTACGACGTGGGCTAC |
Nfkb1 | GCCTCTAGTGAGAAGAACAA | GTGACCAACTGAACGATAAC |
Nos2 | GCAAACCCAAGGTCTACGTTCA | GAGCACGCTGAGTACCTCATTG |
Il10 | ACATACTGCTAACCGACTCCT | GGCATCACTTCTACCAGGTAA |
Rps18 | TTCTGGCCAACGGTCTAGACAAC | CCAGTGGTCTTGGTGTGCTGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, C.; Tong, Y.; Huang, J.; Wang, S.; Kobori, H.; Zhang, Z.; Suzuki, K. Atrophic C2C12 Myotubes Activate Inflammatory Response of Macrophages In Vitro. Cells 2025, 14, 317. https://doi.org/10.3390/cells14050317
Wu C, Tong Y, Huang J, Wang S, Kobori H, Zhang Z, Suzuki K. Atrophic C2C12 Myotubes Activate Inflammatory Response of Macrophages In Vitro. Cells. 2025; 14(5):317. https://doi.org/10.3390/cells14050317
Chicago/Turabian StyleWu, Cong, Yishan Tong, Jiapeng Huang, Shuo Wang, Haruki Kobori, Ziwei Zhang, and Katsuhiko Suzuki. 2025. "Atrophic C2C12 Myotubes Activate Inflammatory Response of Macrophages In Vitro" Cells 14, no. 5: 317. https://doi.org/10.3390/cells14050317
APA StyleWu, C., Tong, Y., Huang, J., Wang, S., Kobori, H., Zhang, Z., & Suzuki, K. (2025). Atrophic C2C12 Myotubes Activate Inflammatory Response of Macrophages In Vitro. Cells, 14(5), 317. https://doi.org/10.3390/cells14050317