Fabry Disease and Inflammation: Potential Role of p65 iso5, an Isoform of the NF-κB Complex
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design and Population
2.2. Genetic Analysis
2.3. α-Galactosidase A Activity Assay
2.4. Lyso-Gb3 Determination
2.5. Isolation of PBMCs in Human Samples
2.6. RNA Extraction from PBMCs and RT-PCR
2.7. Nested PCR
2.8. Real-Time Quantitative PCR
2.9. Protein Sample Preparation
2.10. Western Blot Analysis
2.11. Statistical Analysis
3. Results
3.1. Fabry Disease Patient Population Overview
3.2. Identification and Evaluation of the mRNA Expression Levels of p65 iso5 in PBMCs of Fabry Patients
3.3. mRNA Expression Levels of p65 iso5 in PBMCs from Fabry Patients
3.4. Analysis of p65 iso5 Protein Expression in PBMCs of Fabry Patients
3.5. Focus on Late Onset Phenotype: F113L Mutation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bonam, S.R.; Wang, F.; Muller, S. Lysosomes as a therapeutic target. Nat. Rev. Drug Discov. 2019, 18, 923–948. [Google Scholar] [CrossRef] [PubMed]
- Coelho-Ribeiro, B.; Silva, H.G.; Sampaio-Marques, B.; Fraga, A.G.; Azevedo, O.; Pedrosa, J.; Ludovico, P. Inflammation and Exosomes in Fabry Disease Pathogenesis. Cells 2024, 13, 654. [Google Scholar] [CrossRef] [PubMed]
- Sun, A. Lysosomal storage disease overview. Ann. Transl. Med. 2018, 6, 476. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Gómez-Sintes, R.; Boya, P. Lysosomal membrane permeabilization and cell death. Traffic 2018, 19, 918–931. [Google Scholar] [CrossRef] [PubMed]
- Kuk, M.U.; Lee, Y.H.; Kim, J.W.; Hwang, S.Y.; Park, J.T.; Park, S.C. Potential Treatment of Lysosomal Storage Disease through Modulation of the Mitochondrial-Lysosomal Axis. Cells 2021, 10, 420. [Google Scholar] [CrossRef]
- Schiffmann, R. Fabry disease. In Handbook of Clinical Neurology; Elsevier: Amsterdam, The Netherlands, 2015; Volume 132, pp. 231–248. [Google Scholar] [CrossRef]
- Michaud, M.; Mauhin, W.; Belmatoug, N.; Garnotel, R.; Bedreddine, N.; Catros, F.; Ancellin, S.; Lidove, O.; Gaches, F. When and How to Diagnose Fabry Disease in Clinical Pratice. Am. J. Med. Sci. 2020, 360, 641–649. [Google Scholar] [CrossRef] [PubMed]
- Marques, A.R.A.; Saftig, P. Lysosomal storage disorders—Challenges, concepts and avenues for therapy: Beyond rare diseases. J. Cell Sci. 2019, 132, jcs221739. [Google Scholar] [CrossRef]
- Juchniewicz, P.; Piotrowska, E.; Kloska, A.; Podlacha, M.; Mantej, J.; Węgrzyn, G.; Tukaj, S.; Jakóbkiewicz-Banecka, J. Dosage Compensation in Females with X-Linked Metabolic Disorders. Int. J. Mol. Sci. 2021, 22, 4514. [Google Scholar] [CrossRef]
- Beck, M. Fabry Disease. In Pediatric Nephrology; Emma, F., Goldstein, S.L., Bagga, A., Bates, C.M., Shroff, R., Eds.; Springer International Publishing: Cham, Switzerland, 2022; pp. 821–830. [Google Scholar]
- Tuttolomondo, A.; Simonetta, I.; Riolo, R.; Todaro, F.; Di Chiara, T.; Miceli, S.; Pinto, A. Pathogenesis and Molecular Mechanisms of Anderson-Fabry Disease and Possible New Molecular Addressed Therapeutic Strategies. Int. J. Mol. Sci. 2021, 22, 88. [Google Scholar] [CrossRef] [PubMed]
- Simonetta, I.; Tuttolomondo, A.; Daidone, M.; Pinto, A. Biomarkers in Anderson-Fabry Disease. Int. J. Mol. Sci. 2020, 21, 8080. [Google Scholar] [CrossRef]
- Amodio, F.; Caiazza, M.; Monda, E.; Rubino, M.; Capodicasa, L.; Chiosi, F.; Simonelli, V.; Dongiglio, F.; Fimiani, F.; Pepe, N.; et al. An Overview of Molecular Mechanisms in Fabry Disease. Biomolecules 2022, 12, 1460. [Google Scholar] [CrossRef] [PubMed]
- Izhar, R.; Borriello, M.; La Russa, A.; Di Paola, R.; De, A.; Capasso, G.; Ingrosso, D.; Perna, A.F.; Simeoni, M. Fabry Disease in Women: Genetic Basis, Available Biomarkers, and Clinical Manifestations. Genes 2023, 15, 37. [Google Scholar] [CrossRef]
- Arends, M.; Wanner, C.; Hughes, D.; Mehta, A.; Oder, D.; Watkinson, O.T.; Elliott, P.M.; Linthorst, G.E.; Wijburg, F.A.; Biegstraaten, M.; et al. Characterization of Classical and Nonclassical Fabry Disease: A Multicenter Study. J. Am. Soc. Nephrol. JASN 2017, 28, 1631–1641. [Google Scholar] [CrossRef]
- Capelli, I.; Aiello, V.; Gasperoni, L.; Comai, G.; Corradetti, V.; Ravaioli, M.; Biagini, E.; Graziano, C.; La Manna, G. Kidney Transplant in Fabry Disease: A Revision of the Literature. Medicina 2020, 56, 284. [Google Scholar] [CrossRef] [PubMed]
- Azevedo, O.; Gago, M.F.; Miltenberger-Miltenyi, G.; Sousa, N.; Cunha, D. Fabry Disease Therapy: State-of-the-Art and Current Challenges. Int. J. Mol. Sci. 2021, 22, 206. [Google Scholar] [CrossRef] [PubMed]
- Cammarata, G.; Fatuzzo, P.; Rodolico, M.S.; Colomba, P.; Sicurella, L.; Iemolo, F.; Zizzo, C.; Alessandro, R.; Bartolotta, C.; Duro, G.; et al. High variability of Fabry disease manifestations in an extended Italian family. BioMed Res. Int. 2015, 2015, 504784. [Google Scholar] [CrossRef] [PubMed]
- Tuttolomondo, A.; Simonetta, I.; Duro, G.; Pecoraro, R.; Miceli, S.; Colomba, P.; Zizzo, C.; Nucera, A.; Daidone, M.; Di Chiara, T.; et al. Inter-familial and intra-familial phenotypic variability in three Sicilian families with Anderson-Fabry disease. Oncotarget 2017, 8, 61415–61424. [Google Scholar] [CrossRef]
- Sezer, O.; Ceylaner, S. Genetic Management Algorithm in High-Risk Fabry Disease Cases; Especially in Female Indexes with Mutations. Endocr. Metab. Immune Disord. Drug Targets 2021, 21, 324–337. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Wang, S.; Chen, Y.; Yang, D.; Tang, Y.; Tan, J.; Qin, W. Fabry Disease with Genetic Variants of Unknown Significance and Concomitant Immunoglobulin A Nephropathy. Kidney Blood Press. Res. 2024, 49, 799–811. [Google Scholar] [CrossRef] [PubMed]
- Germain, D.P.; Levade, T.; Hachulla, E.; Knebelmann, B.; Lacombe, D.; Seguin, V.L.; Nguyen, K.; Noël, E.; Rabès, J.P. Challenging the traditional approach for interpreting genetic variants: Lessons from Fabry disease. Clin. Genet. 2022, 101, 390–402. [Google Scholar] [CrossRef] [PubMed]
- Ballabio, A.; Gieselmann, V. Lysosomal disorders: From storage to cellular damage. Biochim. Biophys. Acta 2009, 1793, 684–696. [Google Scholar] [CrossRef]
- Aerts, J.M.; Groener, J.E.; Kuiper, S.; Donker-Koopman, W.E.; Strijland, A.; Ottenhoff, R.; van Roomen, C.; Mirzaian, M.; Wijburg, F.A.; Linthorst, G.E.; et al. Elevated globotriaosylsphingosine is a hallmark of Fabry disease. Proc. Natl. Acad. Sci. USA 2008, 105, 2812–2817. [Google Scholar] [CrossRef] [PubMed]
- Rozenfeld, P.; Feriozzi, S. Contribution of inflammatory pathways to Fabry disease pathogenesis. Mol. Genet. Metab. 2017, 122, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Vitner, E.B.; Platt, F.M.; Futerman, A.H. Common and uncommon pathogenic cascades in lysosomal storage diseases. J. Biol. Chem. 2010, 285, 20423–20427. [Google Scholar] [CrossRef] [PubMed]
- Kurdi, H.; Lavalle, L.; Moon, J.C.C.; Hughes, D. Inflammation in Fabry disease: Stages, molecular pathways, and therapeutic implications. Front. Cardiovasc. Med. 2024, 11, 1420067. [Google Scholar] [CrossRef]
- Appelqvist, H.; Wäster, P.; Kågedal, K.; Öllinger, K. The lysosome: From waste bag to potential therapeutic target. J. Mol. Cell Biol. 2013, 5, 214–226. [Google Scholar] [CrossRef]
- Schmid, D.; Dengjel, J.; Schoor, O.; Stevanovic, S.; Münz, C. Autophagy in innate and adaptive immunity against intracellular pathogens. J. Mol. Med. 2006, 84, 194–202. [Google Scholar] [CrossRef] [PubMed]
- Schmid, D.; Münz, C. Immune surveillance of intracellular pathogens via autophagy. Cell Death Differ. 2005, 12 (Suppl. S2), 1519–1527. [Google Scholar] [CrossRef] [PubMed]
- Hsing, L.C.; Rudensky, A.Y. The lysosomal cysteine proteases in MHC class II antigen presentation. Immunol. Rev. 2005, 207, 229–241. [Google Scholar] [CrossRef] [PubMed]
- Castaneda, J.A.; Lim, M.J.; Cooper, J.D.; Pearce, D.A. Immune system irregularities in lysosomal storage disorders. Acta Neuropathol. 2008, 115, 159–174. [Google Scholar] [CrossRef]
- Blott, E.J.; Griffiths, G.M. Secretory lysosomes. Nat. Rev. Mol. Cell Biol. 2002, 3, 122–131. [Google Scholar] [CrossRef] [PubMed]
- Mauhin, W.; Lidove, O.; Masat, E.; Mingozzi, F.; Mariampillai, K.; Ziza, J.-M.; Benveniste, O. Innate and Adaptive Immune Response in Fabry Disease. In JIMD Reports; Zschocke, J., Baumgartner, M., Morava, E., Patterson, M., Rahman, S., Peters, V., Eds.; Springer: Berlin/Heidelberg, Germany, 2015; Volume 22, pp. 1–10. [Google Scholar]
- Anders, H.J.; Banas, B.; Schlöndorff, D. Signaling danger: Toll-like receptors and their potential roles in kidney disease. J. Am. Soc. Nephrol. JASN 2004, 15, 854–867. [Google Scholar] [CrossRef] [PubMed]
- De Francesco, P.N.; Mucci, J.M.; Ceci, R.; Fossati, C.A.; Rozenfeld, P.A. Fabry disease peripheral blood immune cells release inflammatory cytokines: Role of globotriaosylceramide. Mol. Genet. Metab. 2013, 109, 93–99. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Niño, M.D.; Carpio, D.; Sanz, A.B.; Ruiz-Ortega, M.; Mezzano, S.; Ortiz, A. Lyso-Gb3 activates Notch1 in human podocytes. Hum. Mol. Genet. 2015, 24, 5720–5732. [Google Scholar] [CrossRef]
- Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 2018, 9, 7204–7218. [Google Scholar] [CrossRef] [PubMed]
- Medzhitov, R. Inflammation 2010: New adventures of an old flame. Cell 2010, 140, 771–776. [Google Scholar] [CrossRef]
- Ferrero-Miliani, L.; Nielsen, O.H.; Andersen, P.S.; Girardin, S.E. Chronic inflammation: Importance of NOD2 and NALP3 in interleukin-1beta generation. Clin. Exp. Immunol. 2007, 147, 227–235. [Google Scholar] [CrossRef]
- Barton, G.M. A calculated response: Control of inflammation by the innate immune system. J. Clin. Investig. 2008, 118, 413–420. [Google Scholar] [CrossRef] [PubMed]
- Soares, C.L.R.; Wilairatana, P.; Silva, L.R.; Moreira, P.S.; Vilar Barbosa, N.M.M.; da Silva, P.R.; Coutinho, H.D.M.; de Menezes, I.R.A.; Felipe, C.F.B. Biochemical aspects of the inflammatory process: A narrative review. Biomed. Pharmacother. 2023, 168, 115764. [Google Scholar] [CrossRef] [PubMed]
- Land, W.G. The Role of Damage-Associated Molecular Patterns (DAMPs) in Human Diseases: Part II: DAMPs as diagnostics, prognostics and therapeutics in clinical medicine. Sultan Qaboos Univ. Med. J. 2015, 15, e157–e170. [Google Scholar]
- Zhou, Y.; Hong, Y.; Huang, H. Triptolide Attenuates Inflammatory Response in Membranous Glomerulo-Nephritis Rat via Downregulation of NF-κB Signaling Pathway. Kidney Blood Press. Res. 2016, 41, 901–910. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef]
- Hayden, M.S.; Ghosh, S. Signaling to NF-kappaB. Genes Dev. 2004, 18, 2195–2224. [Google Scholar] [CrossRef] [PubMed]
- Oeckinghaus, A.; Ghosh, S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb. Perspect. Biol. 2009, 1, a000034. [Google Scholar] [CrossRef]
- Hoffmann, A.; Natoli, G.; Ghosh, G. Transcriptional regulation via the NF-kappaB signaling module. Oncogene 2006, 25, 6706–6716. [Google Scholar] [CrossRef]
- Baldwin, A.S., Jr. The NF-kappa B and I kappa B proteins: New discoveries and insights. Annu. Rev. Immunol. 1996, 14, 649–683. [Google Scholar] [CrossRef]
- Moynagh, P.N. The NF-kappaB pathway. J. Cell Sci. 2005, 118, 4589–4592. [Google Scholar] [CrossRef] [PubMed]
- Bonizzi, G.; Karin, M. The two NF-kappaB activation pathways and their role in innate and adaptive immunity. Trends Immunol. 2004, 25, 280–288. [Google Scholar] [CrossRef] [PubMed]
- Kadhim, H.; Tabarki, B.; Verellen, G.; De Prez, C.; Rona, A.M.; Sébire, G. Inflammatory cytokines in the pathogenesis of periventricular leukomalacia. Neurology 2001, 56, 1278–1284. [Google Scholar] [CrossRef]
- Sun, S.C. Non-canonical NF-κB signaling pathway. Cell Res. 2011, 21, 71–85. [Google Scholar] [CrossRef]
- Sun, S.C.; Chang, J.H.; Jin, J. Regulation of nuclear factor-κB in autoimmunity. Trends Immunol. 2013, 34, 282–289. [Google Scholar] [CrossRef] [PubMed]
- Vallabhapurapu, S.; Karin, M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu. Rev. Immunol. 2009, 27, 693–733. [Google Scholar] [CrossRef] [PubMed]
- Iacobazzi, D.; Convertini, P.; Todisco, S.; Santarsiero, A.; Iacobazzi, V.; Infantino, V. New Insights into NF-κB Signaling in Innate Immunity: Focus on Immunometabolic Crosstalks. Biology 2023, 12, 776. [Google Scholar] [CrossRef]
- Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-κB pathway for the therapy of diseases: Mechanism and clinical study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [CrossRef] [PubMed]
- Hayden, M.S.; Ghosh, S. NF-κB, the first quarter-century: Remarkable progress and outstanding questions. Genes Dev. 2012, 26, 203–234. [Google Scholar] [CrossRef]
- Hayden, M.S.; Ghosh, S. Shared principles in NF-kappaB signaling. Cell 2008, 132, 344–362. [Google Scholar] [CrossRef] [PubMed]
- Deploey, N.; Van Moortel, L.; Rogatsky, I.; Peelman, F.; De Bosscher, K. The Biologist’s Guide to the Glucocorticoid Receptor’s Structure. Cells 2023, 12, 1636. [Google Scholar] [CrossRef]
- McKay, L.I.; Cidlowski, J.A. Molecular control of immune/inflammatory responses: Interactions between nuclear factor-kappa B and steroid receptor-signaling pathways. Endocr. Rev. 1999, 20, 435–459. [Google Scholar] [CrossRef]
- Almawi, W.Y.; Melemedjian, O.K. Negative regulation of nuclear factor-kappaB activation and function by glucocorticoids. J. Mol. Endocrinol. 2002, 28, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Spinelli, G.; Biddeci, G.; Artale, A.; Valentino, F.; Tarantino, G.; Gallo, G.; Gianguzza, F.; Conaldi, P.G.; Corrao, S.; Gervasi, F.; et al. A new p65 isoform that bind the glucocorticoid hormone and is expressed in inflammation liver diseases and COVID-19. Sci. Rep. 2021, 11, 22913. [Google Scholar] [CrossRef]
- Chamoles, N.A.; Blanco, M.; Gaggioli, D. Fabry disease: Enzymatic diagnosis in dried blood spots on filter paper. Clin. Chim. Acta; Int. J. Clin. Chem. 2001, 308, 195–196. [Google Scholar] [CrossRef] [PubMed]
- Polo, G.; Burlina, A.P.; Kolamunnage, T.B.; Zampieri, M.; Dionisi-Vici, C.; Strisciuglio, P.; Zaninotto, M.; Plebani, M.; Burlina, A.B. Diagnosis of sphingolipidoses: A new simultaneous measurement of lysosphingolipids by LC-MS/MS. Clin. Chem. Lab. Med. 2017, 55, 403–414. [Google Scholar] [CrossRef] [PubMed]
- Hirashio, S.; Kagawa, R.; Tajima, G.; Masaki, T. A classic variant of Fabry disease in a family with the M296I late-onset variant. CEN Case Rep. 2021, 10, 106–110. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, S.; Nagasawa, T.; Sugimura, K.; Kanno, A.; Tatebe, S.; Aoki, T.; Sato, H.; Kozu, K.; Konno, R.; Nochioka, K.; et al. Clinical Diversity in Patients with Anderson-fabry Disease with the R301Q Mutation. Intern. Med. 2019, 58, 603–607. [Google Scholar] [CrossRef] [PubMed]
- Ortiz, A.; Abiose, A.; Bichet, D.G.; Cabrera, G.; Charrow, J.; Germain, D.P.; Hopkin, R.J.; Jovanovic, A.; Linhart, A.; Maruti, S.S.; et al. Time to treatment benefit for adult patients with Fabry disease receiving agalsidase β: Data from the Fabry Registry. J. Med. Genet. 2016, 53, 495–502. [Google Scholar] [CrossRef] [PubMed]
- Nishino, T.; Obata, Y.; Furusu, A.; Hirose, M.; Shinzato, K.; Hattori, K.; Nakamura, K.; Matsumoto, T.; Endo, F.; Kohno, S. Identification of a novel mutation and prevalence study for fabry disease in Japanese dialysis patients. Ren. Fail. 2012, 34, 566–570. [Google Scholar] [CrossRef]
- Lawrence, T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [PubMed]
- Sandro, F.; Paula, R. The inflammatory pathogenetic pathways of Fabry nephropathy. Rare Dis. Orphan Drugs J. 2024, 3, 18. [Google Scholar]
- Altarescu, G.; Goldfarb, L.; Park, K.-Y.; Kaneski, C.; Jeffries, N.; Litvak, S.; Nagle, J.; Schiffmann, R. Identification of fifteen novel mutations and genotype–phenotype relationship in Fabry disease. Clin. Genet. 2001, 60, 46–51. [Google Scholar] [CrossRef]
- Faro, D.C.; Losi, V.; Rodolico, M.S.; Torrisi, E.M.; Colomba, P.; Duro, G.; Monte, I.P. Sex Differences in Anderson-Fabry Cardiomyopathy: Clinical, Genetic, and Imaging Analysis in Women. Genes 2023, 14, 1804. [Google Scholar] [CrossRef] [PubMed]
- Verovnik, F.; Benko, D.; Vujkovac, B.; Linthorst, G.E. Remarkable variability in renal disease in a large Slovenian family with Fabry disease. Eur. J. Hum. Genet. EJHG 2004, 12, 678–681. [Google Scholar] [CrossRef]
- Echevarria, L.; Benistan, K.; Toussaint, A.; Dubourg, O.; Hagege, A.A.; Eladari, D.; Jabbour, F.; Beldjord, C.; De Mazancourt, P.; Germain, D.P. X-chromosome inactivation in female patients with Fabry disease. Clin. Genet. 2016, 89, 44–54. [Google Scholar] [CrossRef] [PubMed]
- Asehnoune, K.; Strassheim, D.; Mitra, S.; Kim, J.Y.; Abraham, E. Involvement of reactive oxygen species in Toll-like receptor 4-dependent activation of NF-kappa B. J. Immunol. 2004, 172, 2522–2529. [Google Scholar] [CrossRef] [PubMed]
- Ishii, S.; Chang, H.H.; Kawasaki, K.; Yasuda, K.; Wu, H.L.; Garman, S.C.; Fan, J.Q. Mutant alpha-galactosidase A enzymes identified in Fabry disease patients with residual enzyme activity: Biochemical characterization and restoration of normal intracellular processing by 1-deoxygalactonojirimycin. Biochem. J. 2007, 406, 285–295. [Google Scholar] [CrossRef] [PubMed]
- Azevedo, O.; Gal, A.; Faria, R.; Gaspar, P.; Miltenberger-Miltenyi, G.; Gago, M.F.; Dias, F.; Martins, A.; Rodrigues, J.; Reimão, P.; et al. Founder effect of Fabry disease due to p.F113L mutation: Clinical profile of a late-onset phenotype. Mol. Genet. Metab. 2020, 129, 150–160. [Google Scholar] [CrossRef] [PubMed]
- Burlina, A.P.; Manara, R.; Caillaud, C.; Laissy, J.P.; Severino, M.; Klein, I.; Burlina, A.; Lidove, O. The pulvinar sign: Frequency and clinical correlations in Fabry disease. J. Neurol. 2008, 255, 738–744. [Google Scholar] [CrossRef]
- Lee, B.H.; Heo, S.H.; Kim, G.-H.; Park, J.-Y.; Kim, W.-S.; Kang, D.-H.; Choe, K.H.; Kim, W.-H.; Yang, S.H.; Yoo, H.-W. Mutations of the GLA gene in Korean patients with Fabry disease and frequency of the E66Q allele as a functional variant in Korean newborns. J. Hum. Genet. 2010, 55, 512–517. [Google Scholar] [CrossRef]
- Laffer, B.; Lenders, M.; Ehlers-Jeske, E.; Heidenreich, K.; Brand, E.; Köhl, J. Complement activation and cellular inflammation in Fabry disease patients despite enzyme replacement therapy. Front. Immunol. 2024, 15, 1307558. [Google Scholar] [CrossRef] [PubMed]
Target | Forward Primer | Reverse Primer | Dimension (bp) |
---|---|---|---|
p65 iso5 | AGCCCTGGCTTTGCTCCAGACC | CCGGGAAGATGAGGGGGAAC | 118 |
FD Tot | Patients | Male | Female |
Patients | 106 | 40 | 66 |
Average α-Gal A activity | 7.57 | 3.76 | 9.89 |
Average LysoGb3 | 11.22 | 23.95 | 3.84 |
Classic | Patients | Male | Female |
Patients | 46 | 19 | 27 |
Average α-Gal A activity | 4.7 | 0.55 | 7.62 |
Average LysoGb3 | 22.74 | 44.63 | 7.34 |
Late-onset | Patients | Male | Female |
Patients | 34 | 13 | 21 |
Average α-Gal A activity | 6.53 | 2.88 | 8.80 |
Average LysoGb3 | 3.04 | 5.63 | 1.43 |
GVUS | Patients | Male | Female |
Patients | 26 | 8 | 18 |
Average α-Gal A activity | 14.03 | 12.80 | 14.57 |
Average LysoGb3 | 1.52 | 1.83 | 1.38 |
Symptoms | Male (n = 19) | Female (n = 27) | |
---|---|---|---|
Cardiac manifestations | 8 (42.1 %) | 8 (29.6 %) | |
Classic (n = 46) | Renal manifestations | 9 (47.4 %) | 19 (70.4 %) |
Neurological manifestations | 14 (73.7 %) | 13 (48.1 %) | |
Symptoms | Male (n = 13) | Female (n = 21) | |
Cardiac manifestations | 9 (69.2 %) | 13 (61.9 %) | |
Late-onset (n = 34) | Renal manifestations | 6 (46.1 %) | 5 (23.8 %) |
Neurological manifestations | 6 (46.1 %) | 11 (52.4 %) | |
Symptoms | Male (n = 8) | Female (n = 18) | |
Cardiac manifestations | 1 (12.5 %) | 4 (22.2 %) | |
GVUS (n = 26) | Renal manifestations | 4 (50 %) | 13 (72.2 %) |
Neurological manifestations | 6 (75 %) | 10 (55.5 %) |
Healthy (n = 20) | Classic (n = 46) | Late-Onset (n = 34) | GVUS (n = 26) | |
---|---|---|---|---|
Age, yo | Age, yo | Age, yo | Age, yo | |
41.8 ± 12.20 | 43.9 ± 19.70 | 45.6 ± 20.70 | 41.2 ± 16.90 | |
Males | 47.17 ± 12.89 | 33.84 ± 19.17 | 52 ± 22.92 | 43.38 ± 13.93 |
Females | 33.63 ± 4.14 | 51 ± 17.06 | 41.57 ± 18.69 | 40.22 ± 18.34 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Biddeci, G.; Spinelli, G.; Colomba, P.; Duro, G.; Anania, M.; Francofonte, D.; Di Blasi, F. Fabry Disease and Inflammation: Potential Role of p65 iso5, an Isoform of the NF-κB Complex. Cells 2025, 14, 230. https://doi.org/10.3390/cells14030230
Biddeci G, Spinelli G, Colomba P, Duro G, Anania M, Francofonte D, Di Blasi F. Fabry Disease and Inflammation: Potential Role of p65 iso5, an Isoform of the NF-κB Complex. Cells. 2025; 14(3):230. https://doi.org/10.3390/cells14030230
Chicago/Turabian StyleBiddeci, Giuseppa, Gaetano Spinelli, Paolo Colomba, Giovanni Duro, Monia Anania, Daniele Francofonte, and Francesco Di Blasi. 2025. "Fabry Disease and Inflammation: Potential Role of p65 iso5, an Isoform of the NF-κB Complex" Cells 14, no. 3: 230. https://doi.org/10.3390/cells14030230
APA StyleBiddeci, G., Spinelli, G., Colomba, P., Duro, G., Anania, M., Francofonte, D., & Di Blasi, F. (2025). Fabry Disease and Inflammation: Potential Role of p65 iso5, an Isoform of the NF-κB Complex. Cells, 14(3), 230. https://doi.org/10.3390/cells14030230