LncRNA NEAT1/miR-146a-5p Axis Restores Normal Angiogenesis in Diabetic Foot Ulcers by Targeting mafG
Abstract
1. Introduction
2. Materials and Methods
2.1. Enrolment of the Study Subjects
2.2. Cell Culture Treatments and Conditions
2.3. RNA Isolation
2.4. cDNA Synthesis and q-RT-PCR
2.5. Protein Extraction and Multiplexing of Angiogenic Markers from the Tissue Biopsies of Study Subjects
2.6. Silencing lncRNA NEAT1 and miR-146a-5p in Endothelial Cells
2.7. Scratch Assay
2.8. In Vitro Tube-Formation Assay
2.9. Establishment of lncRNA-miRNA-mRNA Network
2.10. Statistical Analysis
3. Results
3.1. Clinical and Biochemical Factors of the Study Participants
3.2. Levels of Angiogenic Markers among the Study Subjects
3.3. Expression of Angiogenic Markers and lncRNA NEAT1 among the Study Subjects
3.4. Inhibition of lncRNA NEAT1 Reduced Angiogenesis and Migration in Endothelial Cells In Vitro
3.5. miR-146a-5p as a Putative Target for lncRNA NEAT1
3.6. Correlation Analysis of lncRNA-miRNA-mRNA Axis
3.7. mafG as a Putative Target for miR-146a-5p
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kirchmair, R.; Okonkwo, U.A.; Chen, L.; Ma, D.; Haywood, V.A.; Barakat, M.; Urao, N.; DiPietro, L.A. Compromised angiogenesis and vascular Integrity in impaired diabetic wound healing. PLoS ONE 2020, 15, e0231962. [Google Scholar] [CrossRef] [Scilit]
- Okonkwo, U.; DiPietro, L. Diabetes and Wound Angiogenesis. Int. J. Mol. Sci. 2017, 18, 1419. [Google Scholar] [CrossRef] [Scilit]
- Schönborn, M.; Łączak, P.; Pasieka, P.; Borys, S.; Płotek, A.; Maga, P. Pro- and Anti-Angiogenic Factors: Their Relevance in Diabetic Foot Syndrome—A Review. Angiology 2021, 73, 299–311. [Google Scholar] [CrossRef] [Scilit]
- Cyr, A.R.; Huckaby, L.V.; Shiva, S.S.; Zuckerbraun, B.S. Nitric Oxide and Endothelial Dysfunction. Crit. Care Clin. 2020, 36, 307–321. [Google Scholar] [CrossRef] [Scilit]
- Jayasuriya, R.; Ganesan, K.; Xu, B.; Ramkumar, K.M. Emerging role of long non-coding RNAs in endothelial dysfunction and their molecular mechanisms. Biomed. Pharmacother. 2022, 145, 112421. [Google Scholar] [CrossRef] [Scilit]
- Nagaraja, S.; Chen, L.; DiPietro, L.A.; Reifman, J.; Mitrophanov, A.Y. Predictive Approach Identifies Molecular Targets and Interventions to Restore Angiogenesis in Wounds With Delayed Healing. Front. Physiol. 2019, 10, 636. [Google Scholar] [CrossRef] [Scilit]
- Veith, A.P.; Henderson, K.; Spencer, A.; Sligar, A.D.; Baker, A.B. Therapeutic strategies for enhancing angiogenesis in wound healing. Adv. Drug Deliv. Rev. 2019, 146, 97–125. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Li, F.; Shao, W.; Gao, J.; Ling, D. Promoting Angiogenesis in Oxidative Diabetic Wound Microenvironment Using a Nanozyme-Reinforced Self-Protecting Hydrogel. ACS Cent. Sci. 2019, 5, 477–485. [Google Scholar] [CrossRef] [Scilit]
- Carmeliet, P.; Jain, R.K. Molecular mechanisms and clinical applications of angiogenesis. Nature 2011, 473, 298–307. [Google Scholar] [CrossRef] [Scilit]
- Bermudez, D.M.; Xu, J.; Herdrich, B.J.; Radu, A.; Mitchell, M.E.; Liechty, K.W. Inhibition of stromal cell-derived factor-1α further impairs diabetic wound healing. J. Vasc. Surg. 2011, 53, 774–784. [Google Scholar] [CrossRef] [Scilit]
- Johnson, K.E.; Wilgus, T.A. Vascular Endothelial Growth Factor and Angiogenesis in the Regulation of Cutaneous Wound Repair. Adv. Wound Care 2014, 3, 647–661. [Google Scholar] [CrossRef] [Scilit]
- Yan, M.S.; Marsden, P.A. Epigenetics in the Vascular Endothelium. Arterioscler. Thromb. Vasc. Biol. 2015, 35, 2297–2306. [Google Scholar] [CrossRef] [Scilit]
- Subramaniam, N.; Nair, R.; Marsden, P.A. Epigenetic Regulation of the Vascular Endothelium by Angiogenic LncRNAs. Front. Genet. 2021, 12, 968. [Google Scholar] [CrossRef] [Scilit]
- Jayasuriya, R.; Ramkumar, K.M. Role of long non-coding RNAs on the regulation of Nrf2 in chronic diseases. Life Sci. 2021, 270, 119025. [Google Scholar] [CrossRef] [Scilit]
- Ghafouri-Fard, S.; Taheri, M. Nuclear Enriched Abundant Transcript 1 (NEAT1): A long non-coding RNA with diverse functions in tumorigenesis. Biomed. Pharmacother. 2019, 111, 51–59. [Google Scholar] [CrossRef] [Scilit]
- Prinz, F.; Kapeller, A.; Pichler, M.; Klec, C. The Implications of the Long Non-Coding RNA NEAT1 in Non-Cancerous Diseases. Int. J. Mol. Sci. 2019, 20, 627. [Google Scholar] [CrossRef] [Scilit]
- Taiana, E.; Ronchetti, D.; Todoerti, K.; Nobili, L.; Tassone, P.; Amodio, N.; Neri, A. LncRNA NEAT1 in Paraspeckles: A Structural Scaffold for Cellular DNA Damage Response Systems? Non-Coding RNA 2020, 6, 26. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Yang, L.; Zhao, J.; Li, C.; Nie, J.; Liu, F.; Zhuo, C.; Zheng, Y.; Li, B.; Wang, Z.; et al. Nuclear-enriched abundant transcript 1 as a diagnostic and prognostic biomarker in colorectal cancer. Mol. Cancer 2015, 14, 191. [Google Scholar] [CrossRef] [Scilit]
- de Aguiar Vallim, T.Q.; Tarling, E.J.; Ahn, H.; Hagey, L.R.; Romanoski, C.E.; Lee, R.G.; Graham, M.J.; Motohashi, H.; Yamamoto, M.; Edwards, P.A. MAFG Is a Transcriptional Repressor of Bile Acid Synthesis and Metabolism. Cell Metab. 2015, 21, 298–311. [Google Scholar] [CrossRef] [Scilit]
- Pradas-Juni, M.; Hansmeier, N.R.; Link, J.C.; Schmidt, E.; Larsen, B.D.; Klemm, P.; Meola, N.; Topel, H.; Loureiro, R.; Dhaouadi, I.; et al. A MAFG-lncRNA axis links systemic nutrient abundance to hepatic glucose metabolism. Nat. Commun. 2020, 11, 644. [Google Scholar] [CrossRef] [Scilit]
- Ling, H.; Fabbri, M.; Calin, G.A. MicroRNAs and other non-coding RNAs as targets for anticancer drug development. Nat. Rev. Drug Discov. 2013, 12, 847–865. [Google Scholar] [CrossRef] [Scilit]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Tan, X.-R.; Li, S.-J.; Zhang, X.-X. LncRNA NEAT1 promotes hepatic lipid accumulation via regulating miR-146a-5p/ROCK1 in nonalcoholic fatty liver disease. Life Sci. 2019, 235, 116829. [Google Scholar] [CrossRef] [Scilit]
- Jayasuriya, R.; Ramkumar, K.M. Mangiferin alleviates hyperglycemia-induced endothelial impairment via Nrf2 signaling pathway. Eur. J. Pharmacol. 2022, 936, 175359. [Google Scholar] [CrossRef] [Scilit]
- Amin, N.; Doupis, J. Diabetic foot disease: From the evaluation of the “foot at risk” to the novel diabetic ulcer treatment modalities. World J. Diabetes 2016, 7, 153. [Google Scholar] [CrossRef] [Scilit]
- Teena, R.; Dhamodharan, U.; Ali, D.; Rajesh, K.; Ramkumar, K.M. Gene Expression Profiling of Multiple Histone Deacetylases (HDAC) and Its Correlation with NRF2-Mediated Redox Regulation in the Pathogenesis of Diabetic Foot Ulcers. Biomolecules 2020, 10, 1466. [Google Scholar] [CrossRef] [Scilit]
- Teena, R.; Dhamodharan, U.; Jayasuriya, R.; Ali, D.; Kesavan, R.; Ramkumar, K.M. Analysis of the Exonic Single Nucleotide Polymorphism rs182428269 of the NRF2 Gene in Patients with Diabetic Foot Ulcer. Arch. Med. Res. 2021, 52, 224–232. [Google Scholar] [CrossRef] [Scilit]
- Kumar, P.; Kumar, S.; Udupa, E.P.; Kumar, U.; Rao, P.; Honnegowda, T. Role of angiogenesis and angiogenic factors in acute and chronic wound healing. Plast. Aesthetic Res. 2015, 2, 243–249. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Zhang, Y.-P.; Kirsner, R.S. Angiogenesis in wound repair: Angiogenic growth factors and the extracellular matrix. Microsc. Res. Tech. 2003, 60, 107–114. [Google Scholar] [CrossRef] [Scilit]
- Onodera, K. Perinatal synthetic lethality and hematopoietic defects in compound mafG::mafK mutant mice. EMBO J. 2000, 19, 1335–1345. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Chen, J.; Garcia, S.P.; Liang, X.; Zhang, F.; Yan, P.; Yu, H.; Wei, W.; Li, Z.; Wang, J.; et al. A dynamic and integrated epigenetic program at distal regions orchestrates transcriptional responses to VEGFA. Genome Res. 2019, 29, 193–207. [Google Scholar] [CrossRef] [Scilit]
- Shao, K.; Xi, L.; Cang, Z.; Chen, C.; Huang, S. Knockdown of NEAT1 exerts suppressive effects on diabetic retinopathy progression via inactivating TGF-β1 and VEGF signaling pathways. J. Cell. Physiol. 2020, 235, 9361–9369. [Google Scholar] [CrossRef] [Scilit]
- Huo, X.; Han, S.; Wu, G.; Latchoumanin, O.; Zhou, G.; Hebbard, L.; George, J.; Qiao, L. Dysregulated long noncoding RNAs (lncRNAs) in hepatocellular carcinoma: Implications for tumorigenesis, disease progression, and liver cancer stem cells. Molecular Cancer 2017, 16, 165. [Google Scholar] [CrossRef] [Scilit]
- Jayasuriya, R.; Dhamodharan, U.; Karan, A.N.; Anandharaj, A.; Rajesh, K.; Ramkumar, K.M. Role of Nrf2 in MALAT1/ HIF-1α loop on the regulation of angiogenesis in diabetic foot ulcer. Free. Radic. Biol. Med. 2020, 156, 168–175. [Google Scholar] [CrossRef] [Scilit]
- Pandey, A.; Ajgaonkar, S.; Jadhav, N.; Saha, P.; Gurav, P.; Panda, S.; Mehta, D.; Nair, S. Current Insights into miRNA and lncRNA Dysregulation in Diabetes: Signal Transduction, Clinical Trials and Biomarker Discovery. Pharmaceuticals 2022, 15, 1269. [Google Scholar] [CrossRef] [Scilit]
- Ala, U. Competing Endogenous RNAs, Non-Coding RNAs and Diseases: An Intertwined Story. Cells 2020, 9, 1574. [Google Scholar] [CrossRef] [Scilit]
- Sakshi, S.; Jayasuriya, R.; Ganesan, K.; Xu, B.; Ramkumar, K.M. Role of circRNA-miRNA-mRNA interaction network in diabetes and its associated complications. Mol. Ther.-Nucleic Acids 2021, 26, 1291–1302. [Google Scholar] [CrossRef] [Scilit]
- Yuan, L.Y.; Zhou, M.; Lv, H.; Qin, X.; Zhou, J.; Mao, X.; Li, X.; Xu, Y.; Liu, Y.; Xing, H. Involvement of NEAT1/miR-133a axis in promoting cervical cancer progression via targeting SOX4. J. Cell. Physiol. 2019, 234, 18985–18993. [Google Scholar] [CrossRef] [Scilit]
- Guo, W.; Li, X.-N.; Li, J.; Lu, J.; Wu, J.; Zhu, W.-F.; Qin, P.; Xu, N.-Z.; Zhang, Q. Increased plasma miR-146a levels are associated with subclinical atherosclerosis in newly diagnosed type 2 diabetes mellitus. J. Diabetes Its Complicat. 2020, 34, 107725. [Google Scholar] [CrossRef] [Scilit]
- Luo, H.-Y.; Li, G.; Liu, Y.-G.; Wei, Y.-H.; Chen, J.-B.; Gu, X.-F.; Tang, J.-Q.; Zhao, Y.; Su, C.-H.; Xiao, L.-Y.; et al. The Accelerated Progression of Atherosclerosis Correlates with Decreased miR-33a and miR-21 and Increased miR-122 and miR-3064-5p in Circulation and the Liver of ApoE−/− Mice with Streptozocin (STZ)-Induced Type 2 Diabetes. Curr. Issues Mol. Biol. 2022, 44, 4822–4837. [Google Scholar] [CrossRef] [Scilit]
- Quan, X.; Ji, Y.; Zhang, C.; Guo, X.; Zhang, Y.; Jia, S.; Ma, W.; Fan, Y.; Wang, C. Circulating MiR-146a May be a Potential Biomarker of Coronary Heart Disease in Patients with Subclinical Hypothyroidism. Cell. Physiol. Biochem. 2018, 45, 226–236. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Wu, W.; Zhang, L.; Dorset-Martin, W.; Morris, M.W.; Mitchell, M.E.; Liechty, K.W. The Role of MicroRNA-146a in the Pathogenesis of the Diabetic Wound-Healing Impairment. Diabetes 2012, 61, 2906–2912. [Google Scholar] [CrossRef] [Scilit]
- Liang, Y.C.; Wu, Y.P.; Li, X.D.; Chen, S.H.; Ye, X.J.; Xue, X.Y.; Xu, N. TNF-α-induced exosomal miR-146a mediates mesenchymal stem cell-dependent suppression of urethral stricture. J. Cell. Physiol. 2019, 234, 23243–23255. [Google Scholar] [CrossRef] [Scilit]
- Nahid, M.A.; Satoh, M.; Chan, E.K.L. Interleukin 1β-Responsive MicroRNA-146a Is Critical for the Cytokine-Induced Tolerance and Cross-Tolerance to Toll-Like Receptor Ligands. J. Innate Immun. 2015, 7, 428–440. [Google Scholar] [CrossRef] [Scilit]
- Taganov, K.D.; Boldin, M.P.; Chang, K.-J.; Baltimore, D. NF-κB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc. Natl. Acad. Sci. USA 2006, 103, 12481–12486. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Boldin, M.P.; Yu, Y.; Liu, C.S.; Ea, C.-K.; Ramakrishnan, P.; Taganov, K.D.; Zhao, J.L.; Baltimore, D. miR-146a controls the resolution of T cell responses in mice. J. Exp. Med. 2012, 209, 1655–1670. [Google Scholar] [CrossRef] [Scilit]
- Boldin, M.P.; Taganov, K.D.; Rao, D.S.; Yang, L.; Zhao, J.L.; Kalwani, M.; Garcia-Flores, Y.; Luong, M.; Devrekanli, A.; Xu, J.; et al. miR-146a is a significant brake on autoimmunity, myeloproliferation, and cancer in mice. J. Exp. Med. 2011, 208, 1189–1201. [Google Scholar] [CrossRef] [Scilit]
- Dong, S.; Xiong, W.E.I.; Yuan, J.; Li, J.; Liu, J.; Xu, X. MiRNA-146a regulates the maturation and differentiation of vascular smooth muscle cells by targeting NF-κB expression. Mol. Med. Rep. 2013, 8, 407–412. [Google Scholar] [CrossRef] [Scilit]
- Oerlemans, M.I.F.J.; Mosterd, A.; Dekker, M.S.; de Vrey, E.A.; van Mil, A.; Pasterkamp, G.; Doevendans, P.A.; Hoes, A.W.; Sluijter, J.P.G. Early assessment of acute coronary syndromes in the emergency department: The potential diagnostic value of circulating microRNAs. EMBO Mol. Med. 2012, 4, 1176–1185. [Google Scholar] [CrossRef] [Scilit]








| Target Name | Primer Sequence | |
|---|---|---|
| Forward | Reverse | |
| mafG | CTGTTTTCCCGTGTTCGTTT | ACCCCAGTTTCACCTACCCC |
| SDF-1α | CGCACTTTCACTCTCCGTCA | AGCACGACCACGACCTTG |
| VEGF | CTACCTCCACCATGCCAAGT | GCAGTAGCTGCGCTGATAGA |
| lncRNA NEAT1 | CTTCCTCCCTTTAACTTATCCATTCAC | CTCTTCCTCCACCATTACCAACAATAC |
| GAPDH | AAGAAGGTGGTGAAGCAGGC | GTCAAAGGTGGAGGAGTGGG |
| miR-146a-5p | TGAGAACTGAATTCCATGGGTT | |
| U6 | CGCAAGGATGACACGCAAATTC | |
| Antisense Oligonucleotides | Sequence |
|---|---|
| Si-NEAT1 | CTGTTTTCCCGTGTTCGTTT |
| SC for NEAT1 | CGCACTTTCACTCTCCGTCA |
| Si-miR146a-5p | CTACCTCCACCATGCCAAGT |
| SC | ACGTCTATACGCCCA |
| Clinical Parameters | Acute DFU (n = 27) | Chronic DFU (n = 33) |
|---|---|---|
| Age (Years) | 48.8 ± 4.9 | 51.4 ± 2.6 |
| BMI (kg/m2) | 28.6 ± 1.6 | 29.2 ± 3.5 |
| SBP (mm Hg) | 135.2 ± 3.1 | 140.6 ± 6.2 |
| DBP (mm Hg) | 85.4 ± 3.1 | 89.5 ± 3.3 |
| FPG (mg/dL) | 186.8 ± 8.0 | 210.9 ± 10.3 |
| PPG (mg/dL) | 215.5 ± 6.0 | 275.5 ± 12.5 |
| HbA1c (%) | 7.2 ± 1.0 | 10.8 ± 1.6 * |
| TSC (mg/dL) | 179.3 ± 4.9 | 191.8 ± 5.4 |
| HDL-c (mg/dL) | 47.5 ± 5.1 | 40.1 ± 4.6 |
| LDL-c (mg/dL) | 100.1 ± 7.4 | 135.5 ± 21.9 * |
| Urea (mg/dL) | 30.2 ± 2.6 | 34.5 ± 3.1 |
| Creatinine (mg/dL) | 1.1 ± 0.1 | 1.12 ± 0.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Architha, T.; Juanitaa, G.R.; Vijayalalitha, R.; Jayasuriya, R.; Athira, G.; Balamurugan, R.; Ganesan, K.; Ramkumar, K.M. LncRNA NEAT1/miR-146a-5p Axis Restores Normal Angiogenesis in Diabetic Foot Ulcers by Targeting mafG. Cells 2024, 13, 456. https://doi.org/10.3390/cells13050456
Architha T, Juanitaa GR, Vijayalalitha R, Jayasuriya R, Athira G, Balamurugan R, Ganesan K, Ramkumar KM. LncRNA NEAT1/miR-146a-5p Axis Restores Normal Angiogenesis in Diabetic Foot Ulcers by Targeting mafG. Cells. 2024; 13(5):456. https://doi.org/10.3390/cells13050456
Chicago/Turabian StyleArchitha, TCA, George Raj Juanitaa, Ramanarayanan Vijayalalitha, Ravichandran Jayasuriya, Gopinathan Athira, Ramachandran Balamurugan, Kumar Ganesan, and Kunka Mohanram Ramkumar. 2024. "LncRNA NEAT1/miR-146a-5p Axis Restores Normal Angiogenesis in Diabetic Foot Ulcers by Targeting mafG" Cells 13, no. 5: 456. https://doi.org/10.3390/cells13050456
APA StyleArchitha, T., Juanitaa, G. R., Vijayalalitha, R., Jayasuriya, R., Athira, G., Balamurugan, R., Ganesan, K., & Ramkumar, K. M. (2024). LncRNA NEAT1/miR-146a-5p Axis Restores Normal Angiogenesis in Diabetic Foot Ulcers by Targeting mafG. Cells, 13(5), 456. https://doi.org/10.3390/cells13050456

