Versatile Endogenous Editing of GluRIIA in Drosophila melanogaster
Round 1
Reviewer 1 Report
Comments and Suggestions for AuthorsThe manuscript „Versatile endogenous editing of GluRIIA in Drosophila melanogaster” by Beckers et al. investigates the role of GluRIIA in presynaptic homeostatic potentiation (PHP) at the neuromuscular junction of Drosophila. The authors used a CRISPR-Cas9 assisted gene editing approach to precisely knockout GluRIIA without affecting adjacent genomic regions. By C-terminal fluorophore-tagging, they enable super-resolution imaging of GluRIIA. Furthermore, they demonstrate chronic and acute (philanthotoxin-treatment) PHP using electrophysiological techniques and subsequent quantal content calculations.
The manuscript provides significant advances in the investigation of synaptic adaptations at Drosophila NMJs. By using precise gene editing approaches, they overcome limitations of pre-existing models. The experimental approaches are suitable to test the accuracy of their model and the conclusions are justified. Statistics were executed in accordance with scientific standards and the results are transparently displayed.
I have a few minor points to address:
- (1) The authors used different holding potentials for the recordings of mEPSCs and eEPSCs. Although the authors claim that mEPSC amplitudes were corrected for the more hyperpolarized holding potential (lines 123+124), they should elaborate on the rational for using different holding potentials.
- (2) Figure 2: Did the authors quantify the expression of GluRIIA rescue, GluRIIA EGFP and GluRIIA ALFA? Although no functional differences were reported in electrophysiological recordings, an analysis of the expression and the clustering would be helpful.
- (3) Figure 2: I recommend adding an overview panel to gain a better understanding of the protein distribution.
- (4) Lines 137+138: The authors used a very high antibody concentration to stain for GluRIIA, please confirm!
- (5) Please correct typo in line 122 AFLA – ALFA
I am confident to be able to recommend the acceptance of this manuscript after minor revisions.
Author Response
Please see the attachment.
Author Response File:
Author Response.pdf
Reviewer 2 Report
Comments and Suggestions for AuthorsIn the manuscript entitled “Versatile endogenous editing of GluRIIA in Drosophila melanogaster” by Beckers et al., the authors provide a novel tool for the study of Glutamate receptor IIA using CRISPR gene editing to insert a landing platform into a fly strain while cleanly removing the coding sequence. The go on to create epitope tagged alleles and demonstrate that they are functional. The manuscript is well written with high quality data showing the findings. Since the glutamate receptor subunit GluRIIA is important to many fields of biology including synaptic plasticity, neurotoxicity and presynaptic homeostatic potentiation, the tools will likely be very beneficial to the field. A few minor comments follow:
1. Line 34-35. the statement: “two versions with an EGFP 34 (GluRIIAEGFP) or ALFA-tag (GluRIIAALFA).” Is ambiguous and could either mean two GFPs and Two ALFA or one of each (which is the case here). Please revise for clarity
2. For the null mutant created, it would be useful to provide the information of the base-pair numbers deleted using coordinates from the latest release of the D. melanogaster sequence (FB2023_06): i.e. GluRIIAΔ5555010-5559248
3. It might also be helpful to use the naming convention used by flybase TI{attP}GluRIIAΔ5555010-5559248 on first use then GluRIIAKO for all subsequent uses.
4. In figure 1B, the orientation of the upstream sgRNA sequence has the 3’ orientations listed on top of the 5’ rather than the convention of showing the 5’à3’ orientation on top. This is confusing to readers. Please correct:
5’ CCGTGA/ACTGGAGAGAGCTTCCC 3’ …[GluRIIA]… 5’ CTGCGAGACTTACTACGTCATGG 3’
3’ GGCACT/TGACCTCTCTCGAAGGG 5’ …[GluRIIA]… 3’ GACGCTCTGAATGATGCAGTACC 5’
5. Please provide sequences of plasmids in supplementary info or provide information on where plasmids and sequences are deposited.
Author Response
Please see the attachment.
Author Response File:
Author Response.pdf
Reviewer 3 Report
Comments and Suggestions for AuthorsThis work is focused on generating and characterizing a new tools to examine the function of GluRIIA at the neuromuscular junction of Drosophila melanogaster. They did this by using genetic editing to express their constructs under endogenous regulatory control. This allowed them to knock out, rescue and tag GluRIIA with two different constructs. This work is an important contribution to the field as the new design circumvents limiting factors, like imprecise knockouts. In the manuscript the group characterizes the tools and demonstrate that the rescue construct and both tags do not disturb receptor function and the ALFA tag is suitable for super-resolution imaging. A case is made in the introduction about needing better tools to study GluRIIA as it relates to the mechanism of PHP. There are some experiments that demonstrate insight, but the significance of these results get lost in the Discussion section. Highlighting next steps to address questions may help to tie this together a bit better.
Author Response
Please see the attachment.
Author Response File:
Author Response.pdf

