LUCAT1-Mediated Competing Endogenous RNA (ceRNA) Network in Triple-Negative Breast Cancer
Abstract
1. Introduction
2. Material and Methods
2.1. Clinical Samples, RNA-Sequencing Data, and Identification of Differentially Expressed lncRNAs in TNBC
2.2. Prediction of lncRNA for ceRNA Network and Construction of ceRNA Network
2.3. GSEA of LUCAT1-Correlated Genes and CCLE Data Analysis
2.4. Cell Culture and Reagents
2.5. Transfection, Cell Viability, Colony-Formation, and Trypan Blue Exclusion Assays
2.6. Transwell-Migration Assay
2.7. Semiquantitative and Quantitative RT-PCR (qPCR)
2.8. Identification of Side Population Cells
2.9. Immunoblotting
2.10. ALDEFLUOR Assay
2.11. Cell Cycle Analysis
2.12. Flow Cytometry
2.13. Statistical Analysis
3. Results
3.1. Identification of Differentially Expressed lncRNAs in Triple-Negative Breast Cancer
3.2. Comprehensive Characterization of LUCAT1 in TNBC and Its Involvement in ceRNA Network
3.3. LUCAT1 Induces Growth, Proliferation, and Migration of Triple-Negative Breast Cancer Cells
3.4. LUCAT1 Functions as a Central Node Regulating Drug Efflux, Stemness, and Programmed Cell Death in Triple-Negative Breast Cancer Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Giaquinto, A.N.; Jemal, A. Cancer statistics, 2024. CA Cancer J. Clin. 2024, 74, 12–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prat, A.; Pineda, E.; Adamo, B.; Galvan, P.; Fernandez, A.; Gaba, L.; Diez, M.; Viladot, M.; Arance, A.; Munoz, M. Clinical implications of the intrinsic molecular subtypes of breast cancer. Breast 2015, 24 (Suppl. S2), S26–S35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lehmann, B.D.; Bauer, J.A.; Chen, X.; Sanders, M.E.; Chakravarthy, A.B.; Shyr, Y.; Pietenpol, J.A. Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. J. Clin. Investig. 2011, 121, 2750–2767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.K.; Park, K.H.; Kim, Y.; Park, S.E.; Lee, H.S.; Lim, S.W.; Cho, J.H.; Kim, J.Y.; Lee, J.E.; Ahn, J.S.; et al. Discordance of the PAM50 Intrinsic Subtypes Compared with Immunohistochemistry-Based Surrogate in Breast Cancer Patients: Potential Implication of Genomic Alterations of Discordance. Cancer Res. Treat. 2019, 51, 737–747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anastasiadou, E.; Jacob, L.S.; Slack, F.J. Non-coding RNA networks in cancer. Nat. Rev. Cancer 2018, 18, 5–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Slack, F.J.; Chinnaiyan, A.M. The Role of Non-coding RNAs in Oncology. Cell 2019, 179, 1033–1055. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Wu, W.; Chen, Q.; Chen, M. Non-Coding RNAs and their Integrated Networks. J. Integr. Bioinform. 2019, 16, 20190027. [Google Scholar] [CrossRef] [Scilit]
- Zhong, G.; Lou, W.; Yao, M.; Du, C.; Wei, H.; Fu, P. Identification of novel mRNA-miRNA-lncRNA competing endogenous RNA network associated with prognosis of breast cancer. Epigenomics 2019, 11, 1501–1518. [Google Scholar] [CrossRef] [Scilit]
- Sideris, N.; Dama, P.; Bayraktar, S.; Stiff, T.; Castellano, L. LncRNAs in breast cancer: A link to future approaches. Cancer Gene Ther. 2022, 29, 1866–1877. [Google Scholar] [CrossRef] [Scilit]
- Zhang, F.; Li, L.; Fan, Z. circRNAs and their relationship with breast cancer: A review. World J. Surg. Oncol. 2022, 20, 373. [Google Scholar] [CrossRef] [Scilit]
- Ammad, M.; Javed, Z.; Sadia, H.; Ahmed, R.; Akbar, A.; Nadeem, T.; Calina, D.; Sharifi-Rad, J. Advancements in long non-coding RNA-based therapies for cancer: Targeting, delivery, and clinical implications. Med. Oncol. 2024, 41, 292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suri, C.; Swarnkar, S.; Bhaskar, L.; Verma, H.K. Non-Coding RNA as a Biomarker in Lung Cancer. Noncoding RNA 2024, 10, 50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hara, T.; Meng, S.; Arao, Y.; Saito, Y.; Inoue, K.; Rennie, S.; Ofusa, K.; Doki, Y.; Eguchi, H.; Kitagawa, T.; et al. Recent advances in noncoding RNA modifications of gastrointestinal cancer. Cancer Sci. 2024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Wang, X.; Zhou, X.; Hou, L.; Wu, J.; Zhang, W.; Li, H.; Gao, C.; Sun, C. ncRNA-mediated ceRNA regulatory network: Transcriptomic insights into breast cancer progression and treatment strategies. Biomed. Pharmacother. 2023, 162, 114698. [Google Scholar] [CrossRef] [Scilit]
- Salmena, L.; Poliseno, L.; Tay, Y.; Kats, L.; Pandolfi, P.P. A ceRNA hypothesis: The Rosetta Stone of a hidden RNA language? Cell 2011, 146, 353–358. [Google Scholar] [CrossRef] [Scilit]
- To, K.K.W.; Zhang, H.; Cho, W.C. Competing endogenous RNAs (ceRNAs) and drug resistance to cancer therapy. Cancer Drug Resist. 2024, 7, 37. [Google Scholar] [CrossRef] [Scilit]
- Nema, R.; Vats, P.; Singh, J.; Srivastava, S.K.; Kumar, A. Competing Endogenous TMPO-AS1-let-7c-5p- LDHA RNA Network Predicts the Prognosis of Lung Adenocarcinoma Patients. Asian Pac. J. Cancer Prev. 2024, 25, 3673–3689. [Google Scholar] [CrossRef] [Scilit]
- Hashemi, M.; Khosroshahi, E.M.; Daneii, P.; Hassanpoor, A.; Eslami, M.; Koohpar, Z.K.; Asadi, S.; Zabihi, A.; Jamali, B.; Ghorbani, A.; et al. Emerging roles of CircRNA-miRNA networks in cancer development and therapeutic response. Noncoding RNA Res. 2024, 10, 98–115. [Google Scholar] [CrossRef] [Scilit]
- Aria, H.; Azizi, M.; Nazem, S.; Mansoori, B.; Darbeheshti, F.; Niazmand, A.; Daraei, A.; Mansoori, Y. Competing endogenous RNAs regulatory crosstalk networks: The messages from the RNA world to signaling pathways directing cancer stem cell development. Heliyon 2024, 10, e35208. [Google Scholar] [CrossRef] [Scilit]
- Ge, S.X.; Son, E.W.; Yao, R. iDEP: An integrated web application for differential expression and pathway analysis of RNA-Seq data. BMC Bioinform. 2018, 19, 534. [Google Scholar] [CrossRef] [Scilit]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit]
- Smedley, D.; Haider, S.; Durinck, S.; Pandini, L.; Provero, P.; Allen, J.; Arnaiz, O.; Awedh, M.H.; Baldock, R.; Barbiera, G.; et al. The Biomart community portal: An innovative alternative to large, centralized data repositories. Nucleic Acids Res. 2015, 43, W589–W598. [Google Scholar] [CrossRef] [Scilit]
- Gao, Y.; Shang, S.; Guo, S.; Li, X.; Zhou, H.; Liu, H.; Sun, Y.; Wang, J.; Wang, P.; Zhi, H.; et al. Lnc2Cancer 3.0: An updated resource for experimentally supported lncRNA/circRNA cancer associations and web tools based on RNA-seq and scRNA-seq data. Nucleic Acids Res. 2020, 49, D1251–D1258. [Google Scholar] [CrossRef] [Scilit]
- Jézéquel, P.; Gouraud, W.; Ben Azzouz, F.; Guérin-Charbonnel, C.; Juin, P.P.; Lasla, H.; Campone, M. bc-GenExMiner 4.5: New mining module computes breast cancer differential gene expression analyses. Database 2021, 2021, baab007. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.; Guo, Q.; Qi, Y.; Hao, Y.; Gao, Y.; Zhi, H.; Zhang, Y.; Sun, Y.; Zhang, Y.; Xin, M.; et al. LncACTdb 3.0: An updated database of experimentally supported ceRNA interactions and personalized networks contributing to precision medicine. Nucleic Acids Res. 2021, 50, D183–D189. [Google Scholar] [CrossRef] [Scilit]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [Scilit]
- Nusinow, D.P.; Szpyt, J.; Ghandi, M.; Rose, C.M.; McDonald, E.R., 3rd; Kalocsay, M.; Jané-Valbuena, J.; Gelfand, E.; Schweppe, D.K.; Jedrychowski, M.; et al. Quantitative Proteomics of the Cancer Cell Line Encyclopedia. Cell 2020, 180, 387–402. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.; Zahari, M.S.; Ma, B.; Liu, R.; Renuse, S.; Sahasrabuddhe, N.A.; Chen, L.; Chaerkady, R.; Kim, M.S.; Zhong, J.; et al. Global phosphotyrosine survey in triple-negative breast cancer reveals activation of multiple tyrosine kinase signaling pathways. Oncotarget 2015, 6, 29143–29160. [Google Scholar] [CrossRef] [Scilit]
- Siddharth, S.; Muniraj, N.; Saxena, N.K.; Sharma, D. Concomitant Inhibition of Cytoprotective Autophagy Augments the Efficacy of Withaferin A in Hepatocellular Carcinoma. Cancers 2019, 11, 453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagalingam, A.; Siddharth, S.; Parida, S.; Muniraj, N.; Avtanski, D.; Kuppusamy, P.; Elsey, J.; Arbiser, J.L.; Győrffy, B.; Sharma, D. Hyperleptinemia in obese state renders luminal breast cancers refractory to tamoxifen by coordinating a crosstalk between Med1, miR205 and ErbB. npj Breast Cancer 2021, 7, 105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siddharth, S.; Parida, S.; Muniraj, N.; Hercules, S.; Lim, D.; Nagalingam, A.; Wang, C.; Gyorffy, B.; Daniel, J.M.; Sharma, D. Concomitant activation of GLI1 and Notch1 contributes to racial disparity of human triple negative breast cancer progression. eLife 2021, 10, e70729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muniraj, N.; Siddharth, S.; Shriver, M.; Nagalingam, A.; Parida, S.; Woo, J.; Elsey, J.; Gabrielson, K.; Gabrielson, E.; Arbiser, J.L.; et al. Induction of STK11-dependent cytoprotective autophagy in breast cancer cells upon honokiol treatment. Cell Death Discov. 2020, 6, 81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siddharth, S.; Kuppusamy, P.; Wu, Q.; Nagalingam, A.; Saxena, N.K.; Sharma, D. Metformin Enhances the Anti-Cancer Efficacy of Sorafenib via Suppressing MAPK/ERK/Stat3 Axis in Hepatocellular Carcinoma. Int. J. Mol. Sci. 2022, 23, 8083. [Google Scholar] [CrossRef] [Scilit]
- Parsons, M.J.; Tammela, T.; Dow, L.E. WNT as a Driver and Dependency in Cancer. Cancer Discov. 2021, 11, 2413–2429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Rocha, S.T.; Boeva, V.; Escamilla-Del-Arenal, M.; Ancelin, K.; Granier, C.; Matias, N.R.; Sanulli, S.; Chow, J.; Schulz, E.; Picard, C.; et al. Jarid2 Is Implicated in the Initial Xist-Induced Targeting of PRC2 to the Inactive X Chromosome. Mol. Cell 2014, 53, 301–316. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Liu, B.; Wapinski, O.L.; Tsai, M.C.; Qu, K.; Zhang, J.; Carlson, J.C.; Lin, M.; Fang, F.; Gupta, R.A.; et al. Targeted Disruption of Hotair Leads to Homeotic Transformation and Gene Derepression. Cell Rep. 2013, 5, 3–12. [Google Scholar] [CrossRef] [Scilit]
- Marín-Béjar, O.; Marchese, F.P.; Athie, A.; Sánchez, Y.; González, J.; Segura, V.; Huang, L.; Moreno, I.; Navarro, A.; Monzó, M.; et al. PintlincRNA connects the p53 pathway with epigenetic silencing by the Polycomb repressive complex 2. Genome Biol. 2013, 14, R104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venkatraman, A.; He, X.C.; Thorvaldsen, J.L.; Sugimura, R.; Perry, J.M.; Tao, F.; Zhao, M.; Christenson, M.K.; Sanchez, R.; Yu, J.Y.; et al. Maternal imprinting at the H19–Igf2 locus maintains adult haematopoietic stem cell quiescence. Nature 2013, 500, 345–349. [Google Scholar] [CrossRef] [Scilit]
- Hasegawa, Y.; Brockdorff, N.; Kawano, S.; Tsutui, K.; Tsutui, K.; Nakagawa, S. The Matrix Protein hnRNP U Is Required for Chromosomal Localization of Xist RNA. Dev. Cell 2010, 19, 469–476. [Google Scholar] [CrossRef] [Scilit]
- Hacisuleyman, E.; Goff, L.A.; Trapnell, C.; Williams, A.; Henao-Mejia, J.; Sun, L.; McClanahan, P.; Hendrickson, D.G.; Sauvageau, M.; Kelley, D.R.; et al. Topological organization of multichromosomal regions by the long intergenic noncoding RNA Firre. Nat. Struct. Mol. Biol. 2014, 21, 198–206. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Gou, H.; Tripathi, B.K.; Huang, J.; Jiang, S.; Dubois, W.; Waybright, T.; Lei, M.; Shi, J.; Zhou, M. An Apela RNA-Containing Negative Feedback Loop Regulates p53-Mediated Apoptosis in Embryonic Stem Cells. Cell Stem Cell 2015, 16, 669–683. [Google Scholar] [CrossRef] [Scilit]
- Jiang, W.; Liu, Y.; Liu, R.; Zhang, K.; Zhang, Y. The lncRNA DEANR1 Facilitates Human Endoderm Differentiation by Activating FOXA2 Expression. Cell Rep. 2015, 11, 137–148. [Google Scholar] [CrossRef] [Scilit]
- Kurian, L.; Aguirre, A.; Sancho-Martinez, I.; Benner, C.; Hishida, T.; Nguyen, T.B.; Reddy, P.; Nivet, E.; Krause, M.N.; Nelles, D.A.; et al. Identification of Novel Long Noncoding RNAs Underlying Vertebrate Cardiovascular Development. Circulation 2015, 131, 1278–1290. [Google Scholar] [CrossRef] [Scilit]
- Chu, C.; Zhang, Q.C.; Da Rocha, S.T.; Flynn, R.A.; Bharadwaj, M.; Calabrese, J.M.; Magnuson, T.; Heard, E.; Chang, H.Y. Systematic Discovery of Xist RNA Binding Proteins. Cell 2015, 161, 404–416. [Google Scholar] [CrossRef] [Scilit]
- Kallen, A.N.; Zhou, X.-B.; Xu, J.; Qiao, C.; Ma, J.; Yan, L.; Lu, L.; Liu, C.; Yi, J.-S.; Zhang, H.; et al. The Imprinted H19 LncRNA Antagonizes Let-7 MicroRNAs. Mol. Cell 2013, 52, 101–112. [Google Scholar] [CrossRef] [Scilit]
- Keniry, A.; Oxley, D.; Monnier, P.; Kyba, M.; Dandolo, L.; Smits, G.; Reik, W. The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. Nat. Cell Biol. 2012, 14, 659–665. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Cheng, T.; Du, Y.; Hu, X.; Xia, W. LncRNA LUCAT1/miR-181a-5p axis promotes proliferation and invasion of breast cancer via targeting KLF6 and KLF15. BMC Mol. Cell Biol. 2020, 21, 69. [Google Scholar] [CrossRef] [Scilit]
- Mou, E.; Wang, H. LncRNA LUCAT1 facilitates tumorigenesis and metastasis of triple-negative breast cancer through modulating miR-5702. Biosci. Rep. 2019, 39, BSR20190489. [Google Scholar] [CrossRef] [Scilit]
- Xia, L.; Wang, H. lncRNA LUCAT1/ELAVL1/LIN28B/SOX2 Positive Feedback Loop Promotes Cell Stemness in Triple-Negative Breast Cancer. Breast J. 2022, 2022, 7689718. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Jin, S.D.; Zhu, Q.; Han, L.; Feng, J.; Lu, X.Y.; Wang, W.; Wang, F.; Guo, R.H. Long non-coding RNA LUCAT1 is associated with poor prognosis in human non-small lung cancer and regulates cell proliferation via epigenetically repressing p21 and p57 expression. Oncotarget 2017, 8, 28297–28311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoon, J.H.; You, B.H.; Park, C.H.; Kim, Y.J.; Nam, J.W.; Lee, S.K. The long noncoding RNA LUCAT1 promotes tumorigenesis by controlling ubiquitination and stability of DNA methyltransferase 1 in esophageal squamous cell carcinoma. Cancer Lett. 2018, 417, 47–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, Z.; Shi, L. Long non-coding RNA LUCAT1 modulates methotrexate resistance in osteosarcoma via miR-200c/ABCB1 axis. Biochem. Biophys. Res. Commun. 2018, 495, 947–953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, Z.; Zhao, F.; Zhu, D.; Han, J.; Chen, H.; Cai, Y.; Chen, Z.; Xie, W. Long Non-Coding RNA LUCAT1 Promotes Proliferation and Invasion in Clear Cell Renal Cell Carcinoma Through AKT/GSK-3beta Signaling Pathway. Cell Physiol. Biochem. 2018, 48, 891–904. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.L.; Wang, X.M.; Qiao, G.D.; Zhang, S.; Wang, J.; Cong, Y.Z.; Zhu, S.G. Up-regulated lnc-lung cancer associated transcript 1 enhances cell migration and invasion in breast cancer progression. Biochem. Biophys. Res. Commun. 2020, 521, 271–278. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Zhang, X.; You, Z.; Meng, Y.; Fan, X.; Qiao, G.; Pang, D. RNA atlas and competing endogenous RNA regulation in tissue-derived exosomes from luminal B and triple-negative breast cancer patients. Front. Oncol. 2023, 13, 1113115. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.; Wang, F.; Chen, C.; Ji, J.; Huang, P.; Wei, D.; Zhang, Y.; Ren, L. Identification of prognostic genes signature and construction of ceRNA network in pirarubicin treatment of triple-negative breast cancer. Breast Cancer 2023, 30, 379–392. [Google Scholar] [CrossRef] [Scilit]
- Qin, W.; Qi, F.; Li, J.; Li, P.; Zang, Y.S. Prognostic Biomarkers on a Competitive Endogenous RNA Network Reveals Overall Survival in Triple-Negative Breast Cancer. Front. Oncol. 2021, 11, 681946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, H.; Oshi, M.; Yan, L.; Endo, I.; Takabe, K. Gastric cancer with enhanced apical junction pathway has increased metastatic potential and worse clinical outcomes. Am. J. Cancer Res. 2022, 12, 2146. [Google Scholar]
- Vierbuchen, T.; Agarwal, S.; Johnson, J.L.; Galia, L.; Lei, X.; Stein, K.; Olagnier, D.; Gaede, K.I.; Herzmann, C.; Holm, C.K.; et al. The lncRNA LUCAT1 is elevated in inflammatory disease and restrains inflammation by regulating the splicing and stability of NR4A2. Proc. Natl. Acad. Sci. USA 2023, 120, e2213715120. [Google Scholar] [CrossRef] [Scilit]
- Afshar-Kharghan, V. The role of the complement system in cancer. J. Clin. Investig. 2017, 127, 780–789. [Google Scholar] [CrossRef] [Scilit]
- Luzón-Toro, B.; Fernández, R.M.; Martos-Martínez, J.M.; Rubio-Manzanares-Dorado, M.; Antiñolo, G.; Borrego, S. LncRNA LUCAT1 as a novel prognostic biomarker for patients with papillary thyroid cancer. Sci. Rep. 2019, 9, 14374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, S.; Tao, F.; Zhang, X.; Zhang, Y.; Sun, X.; Wu, D. Role of Wnt/beta-Catenin Signaling in the Chemoresistance Modulation of Colorectal Cancer. Biomed. Res. Int. 2020, 2020, 9390878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Yu, X. Crosstalk between Wnt/beta-catenin signaling pathway and DNA damage response in cancer: A new direction for overcoming therapy resistance. Front. Pharmacol. 2023, 14, 1230822. [Google Scholar] [CrossRef] [Scilit]





| Primer | Forward 5′-3′ | Reverse 5′-3′ |
|---|---|---|
| LUCAT1 | GCTCGGATTGCCTTAGACAG | GGGTGAGCTTCTTGTGAGGA |
| GAPDH | AATCCCATCACCATCTTCCA | TGGACTCCACGACGTACTCA |
| Actin1 | ACCATGGATGATGATATCGC | ACATGGCTGGGGTGTTGAAG |
| OCT-4 | GTTGATCCTCGGACCTGGCTA | GGTTGCCTCTCACTCGGTTCT |
| cMYC | TCAAGAGGCGAACACACAAC | GGCCTTTTCATTGTTTTCCA |
| Wnt1 | GGGTCCTCCTAAGTCCCTTC | CCAACCTCATTTCCACATCAT |
| Wnt2 | CGGGAATCTGCCTTTGTTTA | TTCCTTTCCTTTGCATCCAC |
| ZEB1 | CCTGAAATCCTTAATCCTCCGC | TGGTTCCTGTTCCTAGTGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Verma, D.; Siddharth, S.; Yende, A.S.; Wu, Q.; Sharma, D. LUCAT1-Mediated Competing Endogenous RNA (ceRNA) Network in Triple-Negative Breast Cancer. Cells 2024, 13, 1918. https://doi.org/10.3390/cells13221918
Verma D, Siddharth S, Yende AS, Wu Q, Sharma D. LUCAT1-Mediated Competing Endogenous RNA (ceRNA) Network in Triple-Negative Breast Cancer. Cells. 2024; 13(22):1918. https://doi.org/10.3390/cells13221918
Chicago/Turabian StyleVerma, Deepak, Sumit Siddharth, Ashutosh S. Yende, Qitong Wu, and Dipali Sharma. 2024. "LUCAT1-Mediated Competing Endogenous RNA (ceRNA) Network in Triple-Negative Breast Cancer" Cells 13, no. 22: 1918. https://doi.org/10.3390/cells13221918
APA StyleVerma, D., Siddharth, S., Yende, A. S., Wu, Q., & Sharma, D. (2024). LUCAT1-Mediated Competing Endogenous RNA (ceRNA) Network in Triple-Negative Breast Cancer. Cells, 13(22), 1918. https://doi.org/10.3390/cells13221918

