Next Article in Journal
Hepatocellular-Carcinoma-Derived Organoids: Innovation in Cancer Research
Next Article in Special Issue
LUCAT1-Mediated Competing Endogenous RNA (ceRNA) Network in Triple-Negative Breast Cancer
Previous Article in Journal
Sex Differences in Astrocyte Activity
Previous Article in Special Issue
A Comprehensive Insight and In Silico Analysis of CircRNAs in Hepatocellular Carcinoma: A Step toward ncRNA-Based Precision Medicine
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Circular RNA hsa_circ_0008726 Targets the hsa-miR-206-3p/KLF4 Axis to Modulate 4,4′-Methylene Diphenyl Diisocyanate-Glutathione Conjugate-Induced Chemokine Transcription in Macrophages

Allergy and Clinical Immunology Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505, USA
*
Author to whom correspondence should be addressed.
Cells 2024, 13(20), 1725; https://doi.org/10.3390/cells13201725
Submission received: 6 September 2024 / Revised: 2 October 2024 / Accepted: 10 October 2024 / Published: 18 October 2024
(This article belongs to the Special Issue Advances in the Biogenesis, Biology, and Functions of Noncoding RNAs)

Abstract

:
Exposure to 4,4′-methylene diphenyl diisocyanate (MDI) in the workplace may lead to the development of occupational asthma (OA). However, the specific mechanism(s) by which MDI induces OA are poorly understood. Previous reports have demonstrated that MDI and MDI-glutathione (GSH) conjugate exposure downregulates endogenous human/murine (hsa/mmu)-microRNA(miR)-206-3p, resulting in the activation of mmu/hsa-miR-206-3p-regulated signaling pathways in macrophages. Circular RNAs (circRNAs) regulate many important biological processes by targeting endogenous miRs; however, whether MDI/MDI-GSH exposure may influence circRNA expressions is unknown. Several circRNAs have been identified that regulate hsa-miR-206-3p. We hypothesize that MDI-GSH conjugate exposure induces endogenous circRNA(s) to regulate hsa-miR-206-3p in macrophages. The expression of candidate hsa-miR-206-3p-binding circRNAs was determined from MDI-GSH conjugate-treated differentiated THP-1 macrophages using RT-qPCR. MDI-GSH exposures induced hsa_circ_0008726 and its host gene transcript DNAJB6, whereas other circRNA(s) examined were either not detected or unchanged. RNA-induced silencing complex-immunoprecipitation (RISC-IP) experiments confirm that hsa-miR-206-3p can bind to hsa_circ_0008726. The expressions of endogenous hsa-miR-206-3p, hsa-miR-206-3p-regulated KLF4, and KLF4-activated M2 macrophage-associated markers and chemokines were up-/down-regulated by transfection of hsa_circ_0008726 siRNAs or hsa_circ_0008726 overexpression plasmid in macrophages, respectively. These results suggest MDI-GSH exposure downregulates hsa-miR-206-3p via induction of endogenous hsa_circ_0008726/DNAJB6, resulting in the upregulation of hsa-miR-206-3p-mediated regulations in macrophages.

Graphical Abstract

1. Introduction

Diisocyanates are highly reactive crosslinking agents utilized in the manufacture of polyurethane products [1]. Of these, 4,4′-methylene diphenyl diisocyanate (MDI) is the most widely utilized, and global demand for MDI is predicted to continue to grow [2]. Workplace exposure to MDI is a leading cause of occupational asthma (OA) development [3,4,5,6,7,8]. However, the specific molecular mechanism(s) through which MDI exposure causes OA remains an active area of research.
In the lung microenvironment, the airway fluid contains a very high concentration of the antioxidant glutathione (GSH) (>100 µM) [9], and evidence suggests that the free thiol groups of GSH are a primary target of isocyanate in vivo [10,11,12]. Isocyanate reacts with the free thiol of GSH to a thiocarbamate; further reaction with water may reverse the thiocarbamate linkage and hydrolyze the original isocyanate moiety to an amine group [11]. Thiocarbamate species may further react with endogenous proteins via transcarbamoylation that may contribute to the isocyanate-mediated irritation/allergy reaction of the cells within the lung microenvironment.
Following allergen exposure, airway immune cells infiltrate into the lung microenvironment, and interactions with airway cells are important for asthma pathogenesis [13,14,15]. Among the first immune cells to respond to inhaled allergens are the alveolar macrophages, which have been implicated in the development of asthma [16]. Alternatively activated (M2) macrophage populations have been shown to be elevated in the airways of asthmatic patients [17]. In vivo/vitro studies have indicated that MDI/MDI-GSH conjugate exposure led to the induction of M2 macrophage-associated gene signatures [18,19], and some of the M2 macrophage-associated genes are induced partially through Krüppel-like factor 4 (KLF4)-mediated transcriptional activation [20]. Macrophage differentiation and M2 macrophage polarization can be regulated by KLF4 [21]; however, the detailed molecular mechanism(s) by which MDI/MDI-GSH conjugate exposure induces KLF4 and KLF4-mediated M2 macrophage-associated gene activation remains an active research area. Prior studies demonstrate that endogenous microRNAs (miRs) may play a role in regulation of the MDI/MDI-GSH conjugate-mediated induction of KLF4 in macrophages [22]. However, the molecular mechanism through which MDI/MDI-GSH conjugate exposure alters miR levels in macrophages is currently unknown.
Circular RNAs (circRNAs) are noncoding RNAs with a circular structure that have been suggested to participate in the pathogenesis of many different diseases, such as prostate cancer, arthritis, diabetes, and asthma [23,24,25,26,27], through competing endogenous RNA (ceRNA) mechanisms [28], including acting as a miR sponge to regulate gene expression. Moreover, endogenous circRNA species have been reported to regulate macrophage polarization and are involved in the pathogenesis of many different diseases. Endogenous circRNAs are differentially expressed and can regulate macrophage polarization by targeting miR-mediated macrophage polarization-associated gene regulation [29]. For example, circRNA hsa_circ_0005567 promotes M2 macrophage polarization by sponging hsa-miR-492 and inducing suppressor of cytokine signaling 2 (SOCS2) expression in osteoarthritis [30]. Inhibition of circRNA hsa_circ_0074854 suppressed exosome-mediated macrophage M2 polarization in liver cancer, indicating that hsa_circ_0074854 promotes macrophages towards the M2 phenotype [31]. Additionally, circRNAs have been shown to participate in classically activated (M1) macrophage polarization, as the circRNA circPPM1F promotes M1 macrophage polarization in type 1 diabetes mellitus [32]. Furthermore, circular RNA circCdyl promotes M1 macrophage polarization by sponging miR-let-7c in aortic aneurysm [33]. However, the roles of circRNAs in MDI and MDI-GSH conjugate-mediated induction of M2 macrophage-associated gene expression have not been reported.
Previously, we determined that MDI-GSH conjugate exposure leads to downregulation of two endogenous miRs, mmu/hsa-miR-206-3p and mmu/hsa-miR-381-3p [34,35], and upregulation of endogenous KLF4 and KLF4-mediated M2 macrophage-associate genes in human macrophages [20]. However, the specific mechanism by which MDI downregulates endogenous hsa-miR-206-3p and hsa-miR-381-3p is currently unknown. One of the many functions of endogenous circRNAs is degradation/downregulation of endogenous miRs through binding [36]. Several circRNAs have been shown to regulate endogenous hsa-miR-206-3p levels through ceRNA mechanisms and hsa-miR-206-3p-mediated downstream gene regulation, including hsa_circ_0000199 [37], hsa_circ_0001264 [38], hsa_circ_0001982 [39], hsa_circ_0004662 [40], hsa_circ_0007428 [41], hsa_circ_0008726 [42,43], hsa_circ_0056618 [44,45], hsa_circ_0057558 [24], hsa_circ_0058141 [46], and hsa_circ_0072088 [47]. Therefore, we hypothesize that MDI (in the form of MDI-GSH conjugate) exposure downregulates endogenous hsa-miR-206-3p via induction of certain endogenous circRNA(s) in macrophages.
This report focuses on characterizing MDI in the form of MDI-GSH conjugate-mediated candidate hsa-miR-206-3p binding circRNA(s) responses and verifying the interaction between hsa-miR-206-3p and candidate circRNA(s). Furthermore, we characterize the downstream molecular mechanistic effects of MDI-mediated circRNA changes that contribute to the regulation of KLF4 and KLF4-mediated regulation of downstream M2 macrophage-associated gene responses. In vitro exposure to MDI-GSH conjugates results in downregulation of endogenous hsa-miR-206-3p, upregulation of hsa_circ_0008726 and hsa_circ_0008726 host RNA transcript, DnaJ Heat Shock Protein Family (Hsp40) Member B6 (DNAJB6), with subsequent upregulation of KLF4-mediated induction of M2 macrophage-associated genes. Here, we provide a putative circRNA-regulated mechanism to describe downregulation of endogenous hsa-miR-206-3p after MDI-GSH conjugate exposure in macrophages.

2. Materials and Methods

2.1. Caution

The 4,4′-methylene diphenyl diisocyanate (MDI) is a strongly reactive, hazardous, irritating, and well-known immune sensitizing chemical. Appropriate personal protective equipment (PPE) such as nitrile gloves, protective clothing, and goggles must be utilized while handling MDI.

2.2. Chemicals and Reagents

HPLC grade acetone (CAS No. 67-64-1), 4,4′-methylene diphenyl diisocyanate (MDI, 98%) (CAS No. 101-68-8), 3Å molecular sieve (4–8 mesh), Tween-20 (CAS No. 9005-64-5), dimethyl sulfoxide (DMSO) (CAS No. 67-68-5), phorbol 12-myristate 13-acetate (PMA) (CAS No. 16561-29-8), butyric acid (Cas No. 107-92-6), bovine serum albumin (BSA), tris-buffered saline (TBS), and reduced-glutathione (GSH) (CAS No. 70-18-8) were acquired from MilliporeSigma (St. Louis, MO, USA). Roswell Park Memorial Institute (RPMI)-1640 culture medium, phosphate-buffered saline (PBS), and penicillin–streptomycin–glutamine (PSG; 100×) were acquired from ThermoFisher Scientific (Waltham, MA, USA). Hyclone fetal bovine serum (FBS) was obtained from Cytiva Life Sciences (Marlborough, MA, USA). Dry acetone was prepared by incubating HPLC-grade acetone with 3Å molecular sieves for a minimum of 24 h to adsorb water.

2.3. Cell Culture and Differentiation

Cell culture and differentiation were performed as previously described [48]. THP-1 (ATCC® TIB-202), Clone 15 HL-60 (HL-60_C15; ATCC® CRL-1964), and Jurkat Clone E6-1 (Jurkat_E6-1; ATCC® TIB-152) cells were acquired from American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained at 0.5–1 × 106/mL in complete RPMI media (RPMI-1640 media supplement, 10% FBS, 1 × PSG) at 37 °C in a humidified atmosphere with 5% CO2 [48]. THP-1 cells (2 × 106 cells) were differentiated using 10 ng/mL PMA in 10 cm culture dishes for 72 h. The PMA-differentiated THP-1 macrophages were enhanced by washing twice with PBS following removal of PMA and incubation of the cells in PMA-free fresh complete media for another 72 h. Differentiation by PMA at a concentration of 10 ng/mL has been shown to enhance response to polarizing stimuli [49,50]. All in vitro cell experiments described in this study used differentiated/enhanced THP-1 macrophages. For eosinophil differentiation in chemotaxis experiments, HL-60_C15 cells (5 × 105 cells/mL) were cultured in complete RPMI-1640 media containing 0.5 mM butyric acid for 7 days as previously described [51,52,53].

2.4. MDI-GSH Conjugation Reactions

MDI-GSH conjugate was prepared as previously described [34,48]. Briefly, 10 mM GSH in 200 mM sodium phosphate buffer (pH = 7.4) was prepared. Dry acetone was freshly prepared, and 50 µL of 10% MDI (w/v) in dry acetone were added to 25 mL of GSH solution dropwise with stirring, resulting in an approximate MDI concentration of 800 µM. MDI-GSH conjugates reactions were performed at 25 °C with end-over-end mixing for 1 h and then centrifuged for 5 min at 10,000× g and filtered with a 0.2 µm syringe filter. Freshly prepared MDI-GSH conjugate was immediately added into differentiated/enhanced THP-1 macrophages at 0, 1, and 10 µM as indicated or at 10 µM MDI concentrations.

2.5. Plasmid Construction

Plasmid construction was performed similar to our previous reports [22,34]. The circular RNA overexpression vector pcDNA3.1(+)_CircRNA_Mini Vector was obtained from Addgene (plasmid id#60648; Watertown, MA, USA), which was deposited by Dr. Jeremy Wilusz at Baylor College of Medicine [54]. To generate a wildtype (WT) hsa_circ_0008726 overexpression plasmid, a 0.28 kb cDNA fragment representing the full length of human circular RNA hsa_circ_0008726 was generated by PCR using a PacI restriction site containing forward primer (cccttaattaaATATCGGAAACTGGCACTG) and a SacII restriction site containing reverse primer (cccccgcggCCCATTTTCATTTGACTTC) on THP-1 cell cDNA. The PCR amplified hsa_circ_0008726 cDNA fragment was treated with PacI and SacII. This fragment was inserted into pcDNA3.1(+)_CircRNA_Mini Vector that was prepared by sequential enzyme treatments with PacI, SacII, and calf intestinal alkaline phosphatase (CIP) to generate pcDNA3.1(+)_Circ_Mini-hsa_circ_0008726 overexpression plasmid.

2.6. Plasmid, microRNA Mimics/Inhibitors, and siRNA Transfection

Nucleic acid transfections were performed as previously described [20,34,48]. Briefly, for the circRNA overexpression study, 1 × 106 differentiated/enhanced THP-1 macrophages were reverse transfected with 2.5 µg of either pcDNA3.1(+)_CircRNA_Mini-hsa_circ_0008726 or pcDNA3.1(+)_CircRNA_Mini Vector using Mirus TransIT®-2020 transfection reagent for 48 h, after which total RNA was isolated using the mirVana miR Isolation Kit (ThermoFisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. For functional analyses on binding and regulation with hsa_circ_0008726, the following mirVana miRNA inhibitors (MH; Cat#4464084) and miR-mimics (MC; Cat#4464066) were obtained from ThermoFisher Scientific and diluted to 20 µM in nuclease-free water: hsa-miR-206-3p (MH10409, MC10409), hsa-miR-381-3p (MH10242, MC10242), mirVana miRNA Inhibitor, negative control #1 (4464076), and mirVana miRNA Mimic, negative control #1 (4464058). For circRNA hsa_circ_0008726 knockdown studies, two Dharmacon custom siRNAs to hsa_circ_0008726 and ON-TARGETplus Non-targeting Control Pool (Cat# D-001810-10-05) were purchased from Horizon Discovery (Lafayette, CO, USA). The custom-designed siRNA sequences are as follows: si-hsa_circ_0008726#1 (Sense): 5′-ACUUCUUUGAUAUCGGAAACUUU-3′; si-hsa_circ_0008726#1 (Antisense) 5′-AGUUUCCGAUAUCAAAGAAGUUU-3′; si-hsa_circ_0008726#2 (Sense): 5′-UUUGACUUCUUUGAUAUCGGAUU-3′; si-hsa_circ_0008726#2 (Antisense): 5′-UCCGAUAUCAAAGAAGUCAAAUU-3′. As previously described, differentiated/enhanced THP-1 macrophages were reverse transfected and forward transfected after 24 h [55]. Total RNA was prepared for RT-qPCR expression analyses 24 h following forward transfection.

2.7. Expression Analyses

To determine whether endogenous circRNA hsa_circ_0008726 is expressed within differentiated/enhanced THP-1 macrophages, total RNA was extracted from THP-1 macrophages using the mirVana miR Isolation Kit (ThermoFisher Scientific). To deplete linear RNA species in isolated THP-1 total RNA, 3 µg of purified THP-1 total RNA was treated with 20 U Ribonuclease R (RNase R; LGC Biosearch Technologies, Teddington, UK). Briefly, a 20 µL reaction mix containing 3 µg of total RNA, 20 U of RNase inhibitor (Cat# N8080119; ThermoFisher Scientific), 1 × RNase R buffer, and 20 U of RNase R was incubated for 30 min at 37 °C. Control reactions were performed similarly, but without RNase R. After RNAase R treatment, the processed RNA was further purified by using the mirVana miR Isolation Kit according to the manufacturer’s instructions. RNase R protein was removed during the RNA isolation step using the mirVana miR Isolation Kit, which eliminates all protein from the sample. Total RNA with or without RNAse R treatment was reverse transcribed to cDNA using a High-Capacity cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. PCR reactions were conducted using either DNAJB6 convergent primers (DNAJB6-F: TAAAGTCCTTAACAATAAATG; DNAJB6-R: GAGGCCGGCAGGCTGGGCTGGC) or circRNA hsa_circ_0008726 divergent primers (see Supplemental Table S1).
The mRNA, circRNA, and miR levels from THP-1 total RNA were analyzed using RT-qPCR like those previously described [20,22,34,35,48,55]. Briefly, all RT-qPCR reactions were normalized to human beta-2 microglobulin (B2M) for mRNA analysis or to U6 snRNA for circRNA and miR analysis. Gene expression and miR-specific assays were purchased from ThermoFisher Scientific and include human KLF4 (Cat#4331182; Assay ID: Hs00358836_m1), DNAJB6 (Hs00369717_m1), CD206 (Hs00267207_m1), TGM2 (Hs01096681_m1), CCL17 (Hs00171074_m1), CCL22 (Hs01574247_m1), CCL24 (Hs00171082_m1), B2M (Hs00187842_m1), hsa-miR-206-3p (Cat# 4427975; Assay ID No. 000510; hsa/Homo sapiens), and U6 snRNA (No. 001973). For circRNA assays, SYBR Green-based qPCR reactions were performed using PowerTrack SYBR Green Master Mix from ThermoFisher Scientific (Cat#A46110) with divergent primer sets listed in Supplemental Table S1 and normalized using U6 snRNA with the following primer sequences: U6_snRNA-F: CTCGCTTCGGCAGCACA; U6_snRNA-R: AACGCTTCACGAATTTGCGT. PCR reactions were performed using an ABI 7500 Real-Time PCR System (ThermoFisher Scientific). Expressions of mRNAs and miRs were determined using the ΔΔCT method [34].

2.8. Validation of miR-circRNA Interaction by Argonaute (AGO) Immunoprecipitation

The miR-containing RNA-inducing silencing complex (miR/RISC) and miR-targeting circRNA(s) were immunoprecipitated using the miRNA target IP kit (Active Motif, Carlsbad, CA, USA) as previously described [20,34,48]. Briefly, differentiated/enhanced THP-1 macrophages were trypsinized and seeded at 8 × 106 cells in a 10 cm dish. Macrophages were transfected with 25 nM of either miR-mimic-206-3p, miR-mimic-381-3p, or miR-mimic negative control #1 for 24 h. Two 10 cm dishes using an equal number of 1.6 × 107 cells were utilized for each IP reaction. Cells were lysed, and the lysates were divided into two equal aliquots. Aliquots underwent IP using either a pan-AGO antibody (to precipitate the RISC containing AGOs/miRs/mRNAs/circRNAs) or an isotype IgG antibody control. The precipitate was collected, and RNA was purified from the RISC complex using the mirVana miR Isolation Kit (ThermoFisher Scientific). RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific), and hsa_circ_0008726 divergent primer was mixed with PowerTrack SYBR Green Master Mix for RT-qPCR reactions. Data were analyzed by comparing the cells transfected with miR-mimics or non-target miR-mimic-control, and the fold enrichment of hsa_circ_0008726 was calculated from the anti-panAGO and the IgG isotype antibody IP preparations as per the manufacturer’s instructions.

2.9. Chemokine ELISA

Secreted CCL17, CCL22, and CCL24 protein concentrations in conditioned media were determined as previously described [20]. Briefly, conditioned media was collected 48 h following THP-1 macrophage transfection with 2.5 µg of either pcDNA3.1(+)_CircRNA_Mini-hsa_circ_0008726 overexpression plasmid or empty pcDNA3.1(+)_CircRNA_Mini vector. The following enzyme-linked immunosorbent assay (ELISA) kits were obtained from R&D systems (Minneapolis, MN, USA): human CCL17/TARC ELISA kit (Cat#DY364); human CCL22/MDC (#DY336); and human CCL24/Eotaxin-2 (#DY343). The sensitivity for each chemokine is as follows: CCL17 (7.8 pg/mL), CCL22 (7.8 pg/mL), and CCL24 (31.2 pg/mL). Human CCL17, CCL22, and CCL24 chemokines released into the conditioned media from plasmid-transfected THP-1 macrophages were determined by ELISA per manufacturer’s directions.

2.10. Chemotaxis Assays and Quantification of Migrated Cells

Chemotaxis/cell migration in response to conditioned media collected from THP-1 macrophages treated with pcDNA3.1(+)_CircRNA_Mini-hsa_circ_0008726 overexpression plasmid or pcDNA3.1(+)_CircRNA_Mini vector only were performed as previously described [20,48]. Chemotaxis/cell migration assays were performed on a 24-well plate with Transwell inserts (3 µm pore, Corning Transwell plates, ThermoFisher Scientific). Moreover, 1 × 106 naive T-cells (Jurkat_E6-1 T cells) or eosinophils (butyric acid-differentiated HL-60_C15 cells) in 100 µL serum-free RPMI 1640 media were added to the upper chamber. Moreover, 500 µL of cell-free conditioned media from either pcDNA3.1(+)_CircRNA_Mini-hsa_circ_0008726 overexpression plasmid or pcDNA3.1(+)_CircRNA_Mini vector plasmid transfected THP-1 macrophages were placed in the lower chamber as a chemoattractant. Immune cells were incubated for 6 h at 37 °C in a humidified atmosphere with 5% CO2. The cells that migrated into the lower chamber media were collected and stored on ice. Cells that failed to migrate from the upper chamber were aspirated and discarded. The Transwell assembly was washed twice with PBS. Furthermore, 500 µL of cell detaching media (0.25% Trypsin-EDTA, Cat#25200056, ThermoFisher Scientific) were added back to the lower chambers with the upper chambers reinstalled. The whole plate was further incubated at 37 °C for 30 min to detach any remaining migrated cells. After 30 min, the detached cells were combined with the conditioned media/migrated cells previously collected, centrifuged at 300× g for 5 min, washed with PBS twice, and stored at −80 °C. Total migrated cell numbers in the lower chamber were quantified by using the CyQUANT® Cell proliferation assay (ThermoFisher Scientific) according to the manufacturer’s directions.

2.11. Statistical Analysis

Statistical analysis was performed as previously described [20,34,48]. Briefly, data were analyzed using either the unpaired t-test (two-tailed) when comparing two groups or one-way analysis of variance followed by Tukey’s multiple comparison ad hoc post-test when comparing multiple groups. Statistical analyses were performed in GraphPad Prism 7.0 (GraphPad Software, La Jolla, CA, USA). p < 0.05 was used to assign significance.

3. Results

3.1. MDI-GSH Conjugate Exposure Upregulates Endogenous Circular RNA hsa_circ_0008726 in Differentiated/Enhanced THP-1 Human Macrophages

Previous reports from our laboratory have shown that in vivo/in vitro MDI/MDI-GSH conjugate exposure downregulates endogenous mmu/hsa-miR-206-3p in bronchoalveolar lavage cells (BALCs) isolated from an MDI-exposed mouse model and in an acute MDI-GSH conjugate exposed THP-1 macrophage cell culture model [34,48]. These results indicate that MDI and MDI-GSH conjugates cause endogenous mmu/hsa-miR-206-3p downregulation via an unknown mechanism in alveolar macrophages. Through a literature search (10/2023), we identified several endogenous circRNA candidates that have been reported to regulate endogenous hsa-miR-206-3p levels and function in diverse cell types. The candidate hsa-miR-206-3p targeting circRNAs include hsa_circ_0000199 [37], hsa_circ_0001264 [38], hsa_circ_0001982 [39], hsa_circ_0004662 [40], hsa_circ_0007428 [41], hsa_circ_0008726 [42,43], hsa_circ_0056618 [44,45], hsa_circ_0057558 [24], hsa_circ_0058141 [46], and hsa_circ_0072088 [47]. To investigate whether MDI-GSH conjugate exposure can cause expression changes in candidate hsa-miR-206-3p sponging/targeting circRNAs, we utilized differentiated/enhanced human THP-1 macrophages in an in vitro cell model to investigate the circRNA responses to MDI-GSH conjugate exposure and downstream cellular signaling pathways. Differentiated/enhanced THP-1 macrophages were treated with MDI-GSH conjugate (0, 1, and 10 µM) for 24 h. The endogenous hsa-miR-206-3p and candidate circRNA levels were measured by RT-qPCR using either the TaqMan hsa-miR-206-3p assay or designed circRNA primers (Supplemental Table S1). In agreement with our previous findings, endogenous hsa-miR-206-3p levels are significantly downregulated following MDI-GSH conjugate exposure from 1.46-fold to 2.43-fold, respectively (Figure 1A). Of the 10 candidate hsa-miR-206-3p sponging/targeting circRNAs identified from the literature, MDI-GSH conjugate treatment significantly upregulated endogenous hsa_circ_0008726 levels by 2.57- to 3.01-fold (Figure 1G), whereas the endogenous hsa_circ_0001982 levels remained unchanged (Figure 1D). We failed to detect other reported candidate hsa-miR-206-3p sponging/targeting circRNAs hsa_circ_0000199, hsa_circ_0001264, hsa_circ_0004662, hsa_circ_0007428, hsa_circ_0056618, hsa_circ_0057558, hsa_circ_0058141, and hsa_circ_0072088 in differentiated/enhanced THP-1 macrophages exposed to MDI-GSH conjugate (Figure 1B,C,E,F,H–K). These results suggest that exposure to MDI-GSH conjugate results in upregulation of endogenous hsa_circ_0008726 and downregulation of hsa-miR-206-3p in macrophages.

3.2. MDI-GSH Conjugates Upregulate the Endogenous hsa_circ_0008726 Host Gene DNAJB6 RNA Transcript in Macrophages

In silico query of the Circular RNA Interactome database (https://circinteractome.nia.nih.gov/) [56] reveals that mature hsa_circ_0008726 consists of 281 nucleotides and is backspliced from the host gene DNAJB6 located at chromosome 7 (Figure 2A). The mature DNAJB6 mRNA transcript (NM_058246) consists of nine different exons after splicing. Mature hsa_circ_0008726 is derived from exons 4, 5, and 6 of the DNAJB6 pre-mRNA transcript via a backsplicing mechanism during DNAJB6 mRNA maturation in the nucleus (Figure 2B). To determine whether or not hsa_circ_0008726 is indeed expressed in differentiated/enhanced THP-1 macrophages, we treated total RNA isolated from differentiated/enhanced THP-1 macrophages with RNAse R to deplete the linear RNA species and performed RT-PCR using DNAJB6 convergent primers (to detect mature DNAJB6 mRNA) and the hsa_circ_0008726 divergent primers (to detect the mature form of hsa_circ_0008726 including the backsplice junction) (Figure 2B). We were able to detect hsa_circ_0008726 in both THP-1 RNAs treated with and without RNAse R using hsa_circ_0008726 divergent primers; however, we did not detect hsa_circ_0008726 host DNAJB6 mRNA expression in RNAse R-treated THP-1 RNA using the DNAJB6 convergent primers (Figure 2C). The PCR results indicate that hsa_circ_0008726 is indeed expressed in differentiated/enhanced THP-1 macrophages. To determine whether MDI-GSH conjugate exposure results in upregulation of hsa_circ_0008726 via induction of DNAJB6 RNA transcript, differentiated/enhanced THP-1 macrophages were treated with 0, 1, and 10 µM MDI-GSH conjugate for 24 h. The endogenous DNAJB6 transcripts were significantly upregulated from 1.36- to 1.75-fold (Figure 2D), indicating that hsa_circ_0008726 is expressed in THP-1 macrophages and MDI-GSH conjugate exposure may upregulate endogenous hsa_circ_0008726 through induction of hsa_circ_0008726 host DNAJB6 RNA transcript in macrophages.

3.3. Circular RNA hsa_circ_0008726 Interacts with hsa-miR-206-3p in THP-1 Macrophages

Previous studies have shown that hsa_circ_0008726 can target/sponge hsa-miR-206-3p in esophageal squamous carcinoma cells and trophoblast cells [42,43]. However, the ability of hsa_circ_0008726 to regulate hsa-miR-206-3p through binding/sponging in macrophages is currently unknown. To further elucidate a potential molecular mechanism through which hsa_circ_0008726 regulates hsa-miR-206-3p via sponging/targeting using microRNA response element (MRE) site(s) on hsa_circ_0008726, we examined the potential interaction between hsa_circ_0008726 and hsa-miR-206-3p and hsa-miR-381-3p using the in silico tool Circbank (http://www.circbank.cn/) [57]. There is one potential hsa-miR-206-3p MRE site located on hsa_circ_0008726 at position 193–216 (Figure 3A); however, no hsa-miR-381-3p MRE site was found on hsa_circ_0008726 (Supplemental Figure S1).
CircRNAs are theoretically stable due to the closed structure that prevents them from degradation by exonucleases, which degrade linear RNAs. Endogenous circRNA degradation can be initiated after the binding of endogenous miRs with the MRE on the circRNA sequences. The binding between miRs and circRNA requires miR-mediated recruitment of the argonaute (AGO) protein containing RNA-induced silencing complexes (RISC) onto the circRNA through the MRE sites. In vivo/vitro exposure to MDI/MDI-GSH in BALCs and macrophages downregulates endogenous mmu/hsa-miR-206-3p and -381-3p [34,35]. To determine whether hsa_circ_0008726 is directly involved in downregulation of either hsa-miR-206-3p or hsa-miR-381-3p, it was necessary to first confirm the potential hsa-miR-206-3p and hsa-miR-381-3p binding to circRNA hsa_circ_0008726 by performing an AGO antibody pulldown to precipitate the RISC containing AGOs/miRs/circRNAs (RISC-IP). This was followed by confirmation of hsa-miR-206-3p or hsa-miR-381-3p regulation of hsa_circ_0008726 using gain- and loss-of-function studies by transfecting miR-mimics/inhibitors. Consistent with the in silico prediction that hsa_circ_0008726 contains the MRE site of hsa-miR-206-3p but not hsa-miR-381-3p, transfection of miR-mimic-206-3p results in increased precipitated hsa_circ_0008726 by 112.9-fold compared to the non-targeting miR-mimic control. Transfection of miR-mimic-381-3p did not result in increased precipitated hsa_circ_0008726 transcripts when compared to the non-targeting control (Figure 3B). These results indicate that the hsa_circ_0008726 transcript binds to RISCs containing hsa-miR-206-3p but not hsa-miR-381-3p.
To investigate the possibility that hsa-miR-206-3p can regulate endogenous hsa_circ_0008726 through a binding/sponging/miR-mediated degradation mechanism in macrophages, we performed gain- and loss-of-function studies by transfection of either miR-mimics or miR-inhibitors of hsa-miR-206-3p and hsa-miR-381-3p into differentiated/enhanced THP-1 macrophages. Transfection of miR-mimic-206-3p downregulates endogenous hsa_circ_0008726 by 2.81-fold (Figure 3C), whereas transfection of miR-inhibitor-206-3p upregulates endogenous hsa_circ_0008726 by 1.48-fold (Figure 3D) compared to the nontargeting miR-mimic or miR-inhibitor control transfected THP-1 macrophages. To further investigate whether the sponging/binding/miR-mediated degradation mechanism between hsa-miR-206-3p and hsa_circ_0008726 can regulate endogenous levels of hsa-miR-206-3p and hsa_circ_0008726 through direct binding of the miRs on responding MREs, we transfected miR-mimic/inhibitor of hsa-miR-381-3p, an endogenous miR that can be downregulated by MDI-GSH conjugate exposure, into THP-1 macrophages. Given that hsa_circ_0008726 does not contain MRE sites to hsa-miR-381-3p, transfection of either miR-mimic-381-3p or miR-inhibitor-381-3p had no impact on endogenous hsa_circ_0008726 levels (Figure 3C,D). This further indicates that hsa_circ_0008726 binds to hsa-miR-206-3p via the MRE site and can be potentially regulated by endogenous hsa-miR-206-3p in macrophages.

3.4. Circular RNA hsa_circ_0008726 Regulates Endogenous hsa-miR-206-3p Expression in Differentiated/Enhanced THP-1 Macrophages

To investigate the role of hsa_circ_0008726 in regulation of hsa-miR-206-3p, we designed two different siRNAs for hsa_circ_0008726 and performed a loss-of-function experiment to knockdown endogenous hsa_circ_0008726 in differentiated/enhanced THP-1 macrophages. Differentiated/enhanced THP-1 macrophages were transfected with either si-hsa_circ_0008726#1 or si-hsa_circ_0008726#2, which were designed to target two different sites in hsa_circ_0008726. Transfection of si-hsa_circ_0008726#1 significantly inhibits the endogenous expression of hsa_circ_0008726 levels by 3.51-fold, whereas si-hsa_circ_0008726#2 failed to inhibit endogenous levels of hsa_circ_0008726 (Figure 4A). Consistent with the finding that hsa_circ_0008726 sponges/targets endogenous hsa-miR-206-3p in macrophages (Figure 3), transfection of si-hsa_circ_0008726#1 significantly upregulated the endogenous expression of hsa-miR-206-3p levels by 1.75-fold, whereas si-hsa_circ_0008726#2 transfection failed to induce endogenous hsa-miR-206-3p (Figure 4B). These results suggest that endogenous hsa_circ_0008726 can regulate endogenous hsa-miR-206-3p levels in macrophages.

3.5. Circular RNA hsa_circ_0008726 Regulates Endogenous KLF4 and M2 Macrophage-Associated Markers CD206, TGM2, CCL17, CCL22, and CCL24 Transcript Levels

Our previous report showed that in vivo/in vitro MDI/MDI-GSH conjugate exposure upregulates transcription factor Klf4/KLF4 and M2 macrophage-associated markers and chemokines, including Ccl17/CCL17, Ccl22/CCL22, and Ccl24/CCL24, through KLF4-mediated activation in BALCs/macrophages [20]. Other reports have shown that KLF4 transcripts can be regulated by endogenous hsa-miR-206-3p in many different cell types [58,59]. Recently, our laboratory reported that MDI-GSH exposure downregulates endogenous hsa-miR-206-3p, which directly targets the KLF4 transcript in macrophages, inducing KLF4 and KLF4-mediated M2 macrophage-associated markers and chemokines CD206, TGM2, CCL17, CCL22, and CCL24 transcription [22]. To study the role of hsa_circ_0008726 in regulation of MDI-GSH conjugate-mediated induction of M2 macrophage-associated gene transcription in macrophages, we performed a loss-of-function experiment using the si-hsa_circ_0008726#1 siRNA to knockdown endogenous hsa_circ_0008726 in macrophages. Transfection of si-hsa_circ_0008726#1 siRNA to the macrophages downregulated the endogenous hsa_circ_0008726, KLF4, CD206, TGM2, CCL17, CCL22, and CCL24 mRNAs by 1.65-, 2.45-, 3.93-, 2.66-, 8.42-, 1.60-, and 3.80-fold, respectively (Figure 5A,C–H), whereas it upregulated endogenous hsa-miR-206-3p by 1.61-fold (Figure 5B) when compared to control-treated, nontargeting siCtl transfected macrophages.
Consistent with previous findings that exposure to MDI-GSH conjugate upregulates endogenous KLF4 transcription factor, M2 macrophage-associated marker and chemokine mRNA transcripts in THP-1 macrophages [20], as well as the endogenous hsa_circ_0008726 as shown in Figure 1, independent treatment of 10 µM MDI-GSH conjugates with nontargeting siRNA control (siCtl) transfected THP-1 macrophages upregulated endogenous hsa_circ_0008726, KLF4, CD206, TGM2, CCL17, CCL22, and CCL24 mRNAs by 2.92-, 1.61-, 2.09-, 1.63-, 1.98-, 2.16-, and 1.62-fold, respectively (Figure 5A,C–H), whereas it downregulated endogenous hsa-miR-206-3p by 1.88-fold (Figure 5B) compared to control-treated nontargeting siCtl transfected THP-1 macrophages. In addition, MDI-GSH conjugate treatments did not induce endogenous levels of hsa_circ_0008726, KLF4, CD206, TGM2, CCL17, CCL22, and CCL24 mRNAs in si-hsa_circ_0008726#1 siRNA transfected THP-1 macrophages (Figure 5A,C–H). This suggests that hsa_circ_0008726 may play an important role in regulating the expression of M2 macrophage-associated transcription factor KLF4, markers CD206 and TGM2, as well as chemokines CCL17, CCL22, and CCL24 following macrophage exposure to MDI-GSH conjugate.

3.6. Overexpression of hsa_circ_0008726 Induces Endogenous KLF4 as Well as M2 Macrophage-Associated Markers and Chemokine Transcript Expression

To investigate whether hsa_circ_0008726 can mediate M2 macrophage-associated marker and chemokine transcript expression through hsa-miR-206-3p-regulated KLF4, we characterized the expression of M2 macrophage-associated transcription factor, markers, and chemokines KLF4, CD206, TGM2, CCL17, CCL22, and CCL24 using an in vitro hsa_circ_0008726 overexpression model in THP-1 macrophages. Compared to vector-transfected differentiated/enhanced THP-1 macrophages, transfection of hsa_circ_0008726 overexpression plasmids for 48 h significantly induced hsa_circ_0008726 levels by 3.76-fold (Figure 6A), as well as endogenous KLF4, CD206, and TGM2 mRNAs by 1.99-, 9.64-, and 2.99-fold, respectively (Figure 6C–E), whereas hsa_circ_0008726 overexpression plasmid transfection reduced endogenous hsa-miR-206-3p by 3.30-fold in macrophages (Figure 6B). Furthermore, hsa_circ_0008726 overexpression upregulated the endogenous chemokines CCL17, CCL22, and CCL24 mRNAs by 5.02-, 2.12-, and 2.36-fold, respectively (Figure 6F–H). These results indicate that induction of hsa_circ_0008726 following MDI-GSH conjugate exposure downregulates endogenous hsa-miR-206-3p while inducing KLF4, CD206, TGM2, CCL17, CCL22, and CCL24 transcription and expression in human macrophages.

3.7. Circular RNA hsa_circ_0008726 Induces Naïve T-Cell and Eosinophil Chemoattraction by Upregulation of Chemokine CCL17, CCL22, and CCL24 in Macrophages

M2 macrophages can secrete mediators and chemokines to attract T-cells, eosinophils, and other immune cell types [60]. In addition to T-cells, previous reports have established that CCL24 can attract eosinophils [61]. Our previous reports demonstrate that MDI-GSH conjugate-exposed macrophages attract naïve T-cells and eosinophils [20,48]. Furthermore, MDI-GSH conjugate exposure-mediated induction of M2 macrophage-associated chemokines CCL17, CCL22, and CCL24 expression may be regulated by KLF4 in macrophages. MDI-GSH conjugate exposure upregulates hsa_circ_0008726, KLF4, as well as CCL17, CCL22, and CCL24 transcripts (Figure 5A,C,F–H) and these chemokines may contribute to T-cell, eosinophil, and other immune cell chemoattraction. We hypothesize that endogenous hsa_circ_0008726 is involved in regulation of T-cell and/or eosinophil chemotaxis following MDI-GSH exposure in macrophages by secreting CCL17, CCL22, and CCL24. We first examined secreted CCL17, CCL22, and CCL24 protein levels in conditioned media collected from hsa_circ_0008726 overexpression plasmid transfected differentiated/enhanced macrophages. Overexpression of hsa_circ_0008726 induced chemokine CCL17, CCL22, and CCL24 protein levels by 7.83-, 5.63-, and 2.52-fold, respectively, when compared to vector-transfected THP-1 macrophages (Figure 7A–C). In addition, we performed chemotaxis/migration assays using conditioned media collected from hsa_circ_0008726 overexpression plasmid transfected THP-1 macrophages. When compared to the conditioned media collected from vector-transfected differentiated/enhanced THP-1 macrophages, media collected from hsa_circ_0008726 overexpressed macrophages induced naïve T-cell (Jurkat_E6-1 cells) chemotaxis/migration by 2.26-fold (Figure 7D), whereas it induced eosinophil (butyric acid differentiated HL-60_C15 cells) chemotaxis/migration by 1.79-fold (Figure 7E), indicating that MDI-GSH-induced hsa_circ_0008726 plays a role in regulation of macrophage-mediated T-cell and eosinophil chemoattraction/migration.

4. Discussion

Our previous reports demonstrate that macrophages exposed to MDI/MDI-GSH downregulate endogenous hsa-miR-206-3p and hsa-miR-381-3p levels [34,35,48]; additionally, the exposure upregulates endogenous KLF4 transcription factor-mediated M2 macrophage-associated markers and chemokines in vivo and in vitro, where KLF4 may play an important role as downstream regulator/effector for MDI exposure-mediated induction of M2 macrophage-associated markers and chemokines in macrophages [20]. However, the detailed molecular mechanism(s) that result in the downregulation of hsa-miR-206-3p/hsa-miR-381-3p after MDI-GSH exposure is currently unknown. In the current study, we focus on the potential molecular mechanism involved in downregulating hsa-miR-206-3p, and we have identified a circular RNA-regulated mechanism that may be involved in the downregulation of hsa-miR-206-3p after MDI-GSH conjugate exposure in macrophages. Endogenous hsa-miR-206-3p was downregulated in an in vitro MDI-GSH conjugate exposure human THP-1 macrophage model as previously reported [34,48]. Furthermore, MDI-GSH conjugate exposure upregulates endogenous circular RNA hsa_circ_0008726 and its host gene DNAJB6 transcript in the macrophages (Figure 1 and Figure 2). The MDI-GSH exposure-induced endogenous hsa_circ_0008726 contains the hsa-miR-206-3p MRE site, allowing hsa_circ_0008726 to sponge/bind endogenous hsa-miR-206-3p, causing downregulation/degradation of endogenous hsa-miR-206-3p after MDI-GSH conjugate exposure. Additionally, downregulation of endogenous hsa-miR-206-3p results in the upregulation of KLF4 transcription factor expression. Induction of KLF4 and KLF4-mediated activation of downstream gene transcription upregulates expression of M2 macrophage-associated markers and chemokines, including CD206, TGM2, CCL17, CCL22, and CCL24 transcripts. (Figure 5 and Figure 6). Using an in vitro THP-1 macrophage culture model, we identified that hsa_circ_0008726 sponges/binds endogenous hsa-miR-206-3p, resulting in downregulation/degradation of hsa-miR-206-3p, which targets the KLF4 mRNA transcript, suppresses KLF4 translation, and decreases KLF4 transcripts in macrophages (Figure 8). Although hsa_circ_0008726 has been reported to target hsa-miR-206-3p in other cell types, including esophageal squamous cell carcinoma and fibroblast cells [42,43], to our knowledge, the current report is the first to identify and verify that hsa_circ_0008726 is expressed in macrophages and can regulate the expression of endogenous hsa-miR-206-3p and hsa-miR-206-3p-mediated posttranscriptional regulation of endogenous gene function in macrophages.
Macrophages exposed to MDI-GSH conjugate induced endogenous hsa_circ_0008726 through upregulation of hsa_circ_0008726 host gene DNAJB6 primary transcript production (Figure 2); however, the mechanism by which MDI-GSH conjugate exposure induces DNAJB6 is currently unknown. The induction of DNAJB6 transcripts may be cellular stress responses within the macrophages in response to the MDI/MDI-GSH conjugate exposure. The human DNAJB6 protein is a member of the DNAJ protein family, which functions as one of the two major classes of molecular chaperones involved in different cellular processes, such as protein folding regulation, oligomeric protein complex assembly, and toxic protein aggregation prevention [62]. It has been implicated in a variety of molecular pathways associated with cellular stress responses in different cell types, including cellular responses to stimuli, heat stresses, and viral infections [63,64,65,66,67]. DNAJB6 is involved in the pathogenesis of many different types of cancers [68,69,70,71]. In colon cancer cells, DNAJB6 promotes cell adhesion, migration, and invasion through stabilizing the urokinase plasminogen activator receptor (uPAR), as well as activating many signaling transduction proteins through phosphorylation, including FAK, ERK1/2, and AKT [71]. In the colon macrophages, the uPAR promotes phagocytosis and regulates macrophage polarization toward the M2-phenotype [72]. Although the function of DNAJB6 in macrophages has been shown to be a cellular stress response to regulate the different stages of viral replication and infection [73], the role of DNAJB6 in macrophage polarization has never been investigated. We speculate that the induction of DNAJB6 transcription in macrophages exposed to MDI/MDI-GSH conjugate may facilitate macrophage uPAR stabilization and therefore promote M2 macrophage polarization and phagocytosis. Further investigation into the roles of DNAJB6 and macrophage polarization is needed. Furthermore, the detailed molecular mechanism(s) by which MDI/MDI-GSH conjugate induces DNAJB6 transcription should be investigated to understand the role of DNAJB6 in MDI-OA pathogenesis.
Dysfunction of alveolar macrophages has been shown to play an important role in asthma pathogenesis and treatment [16]. The dysfunction of molecular gene regulation and gene expression homeostasis affects the role of alveolar macrophages, such as macrophage polarization and production/secretion of macrophage mediators. Among the gene regulators that contribute to alveolar macrophage dysfunction in asthma, circRNA has been suggested as a major player in asthma progression and pathogenesis [74]. Using an OVA-induced asthma mouse model, Shang et al. revealed that murine circRNA mmu_circ_0001359 was significantly decreased in OVA-treated mice, and murine mmu_circ_0001359 was involved in protective effects that prevent asthma development in the mice [75]. Murine mmu_circ_0001359 contributes to M2 macrophage polarization through sponging/targeting mmu-miR-183-5p with MRE sites on mmu_circ_0001359 and induces FoxO1, a mmu-miR-183-5p target. Induction of FoxO1 attenuated airway remodeling by reducing M1 macrophage activation-induced inflammatory cytokine expression and the progression of pulmonary fibrosis [75]. Similarly, Gong et al. demonstrated that hsa_circ_0001326 prevented THP-1 macrophages from undergoing M2 polarization, instead promoting the macrophages toward M1 polarization by directly regulating the hsa-miR-136-5p/USP4 axis, which decreases the expression and secretion of pro-inflammatory factors TNF-α and IL-6 and instead promotes the expression of anti-inflammatory factor IL-10 [76]. These studies suggest endogenous circRNAs in macrophages may participate in asthma pathogenesis by modulating M2 macrophage polarization via targeting the miRs involved. Given that MDI exposure in the form of MDI-GSH conjugate promotes M2 macrophage-associated markers and chemokines that represent M2 macrophage polarization, whether MDI-GSH conjugate exposure may affect endogenous human homologues of murine mmu_circ_0001359, hsa_circ_0001326, or other M2 macrophage-promoting circRNA(s) will be of interest in future studies.
The role of endogenous circRNAs in macrophages that contribute to M2 macrophage polarization and activation has been recently demonstrated in human and murine asthma models. Liang et al. demonstrated that hsa_circ_0014208 (hsa_circ_S100A11) is highly expressed in monocytes and remarkably upregulated in children with asthma [77]. The circRNA hsa_circ_0014208 promotes the translation of its host gene S100A11, inducing S100A11 protein expression in the macrophages. S100A11 proteins contribute to M2 macrophage polarization through SP3-mediated induction of STAT6, which promotes M2 macrophage polarization and activation [77]. Using a cockroach allergen-induced murine asthma model, Liang et al. demonstrated that the S100A11 protein exacerbates lung inflammation by increasing the production and secretion of Th2 chemokines CCL17 and CCL22 in lung macrophages, further inducing inflammatory pulmonary injury in allergic asthma [77]. Similar to Liang’s observation that hsa_circ_0014208 promotes translation of its host gene S100A11 as well as production and secretion of Th2 chemokines CCL17 and CCL22, our current report demonstrates that hsa_circ_0008726 promotes the expression and secretion of M2 macrophage-associated chemokines CCL17, CCL22, and CCL24 as well as the chemotactic ability of naïve T-cells and eosinophils through induction of KLF4 transcription factor expression via targeting hsa-miR-206-3p (Figure 6 and Figure 7). Although the function of the hsa_circ_0008726 host gene DNAJB6 in regulation of M2 macrophage-associated chemokines CCL17, CCL22, and CCL24 is currently unknown, future studies must characterize the role of DNAJB6 in macrophages. Furthermore, whether MDI/MDI-GSH conjugate exposure can induce expression of hsa_circ_0014208 given its demonstrated role in allergic pathogenesis should be investigated.
Strengths of the current in vitro THP-1 macrophage MDI-GSH conjugate exposure model include the ability to perform gain- or loss-of-function experiments with miR mimics/inhibitors and circRNA hsa_circ_0008726 overexpression plasmid transfections, as well as the siRNA transfection experiments to knockdown endogenous hsa_circ_0008726 with identical genetics from a single cell type to investigate the underlying circRNA-mediated molecular regulatory mechanisms involved in observed MDI-GSH conjugate-mediated effects in macrophages. However, one inherent limitation of the model is that it leaves uncertain whether or not the identified hsa_circ_0008726-mediated induction of KLF4 via downregulation of endogenous hsa-miR-206-3p and the hsa_circ_0008726/hsa-miR-206-3p/KLF4 regulatory axis-mediated induction of M2 macrophage-associated markers and chemokines mechanism reflects similar lung immune responses that may participate in the early steps of asthma pathogenesis in occupational MDI-OA. Furthermore, the current study is based on the identification of candidate hsa-miR-206-3p sponging/targeting circRNA from the published literature. This experimental design omits other potential hsa-miR-206-3p targeting circRNAs that may be regulated by MDI-GSH conjugate exposure in macrophages. Future studies will be needed to better elucidate potential connections of diisocyanate exposure with circRNA/miR targeting gene regulatory mechanisms in real-world MDI workers.

5. Conclusions

In conclusion, this report implicates hsa_circ_0008726 as an important regulator of hsa-miR-206-3p, KLF4 transcripts, and KLF4-mediated signaling, ultimately targeting M2 macrophage-associated markers and chemokine transcription in macrophages after MDI-GSH conjugate exposure. MDI-GSH conjugate exposure in an in vitro human THP-1 macrophage cell culture model results in the induction of hsa_circ_0008726 and downregulation of endogenous hsa-miR-206-3p. This hsa_circ_0008726/hsa-miR-206-3p/KLF4 regulatory axis may contribute to upregulation of M2 macrophage-associated markers and chemokines, including CD206, TGM2, CCL17, CCL22, and CCL24 transcripts in macrophages following MDI/MDI-GSH exposure. The circRNA hsa_circ_0008726 may play an important role in regulation of MDI-OA pathogenesis through macrophage-mediated chemokine expression and induction of immune cell chemotaxis to the lung microenvironment.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cells13201725/s1, Table S1: Candidate hsa-miR-206-3p binding circRNA divergent primer sequences; Figure S1: Screenshot from CircBank showing no predicted binding between hsa-miR-381-3p and hsa_circ_0008726.

Author Contributions

Conceptualization, C.-C.L.; methodology, C.-C.L.; writing—original draft preparation, C.-C.L.; writing—review and editing, C.-C.L., B.F.L. and J.M.H.; visualization, C.-C.L.; supervision, C.-C.L. and J.M.H.; project administration, B.F.L.; funding acquisition, J.M.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by intramural funds (CAN#19390BN8 and #39390KK5) from the National Institute for Occupational Safety and Health, Centers for Disease Control and Prevention.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

All data required to evaluate the conclusions of this paper are included in the main text and the Results Section.

Conflicts of Interest

The authors declare that they have no conflicting financial interests. The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of the National Institute for Occupational Safety and Health, Centers for Disease Control and Prevention.

References

  1. Allport, D.C.; Gilbert, D.S.; Outterside, S.M. MDI and TDI: A Safety, Health and the Environment: A Source Book and Practical Guide; J. Wiley: New York, NY, USA, 2003. [Google Scholar]
  2. Statista. Demand for Methylene Diphenyl Diisocyanate Worldwide from 2011 to 2023. 2024. Available online: https://www.statista.com/statistics/750809/mdi-demand-worldwide/ (accessed on 10 October 2024).
  3. NIOSH. Letter from NIOSH to Distinctive Designs International Inc. with a Study Report. 1994. Available online: https://www.cdc.gov/niosh/hhe/reports/pdfs/1991-0386-2427.pdf (accessed on 10 October 2024).
  4. Lofgren, D.J.; Walley, T.L.; Peters, P.M.; Weis, M.L. MDI Exposure for Spray-On Truck Bed Lining. Appl. Occup. Environ. Hyg. 2003, 18, 772–779. [Google Scholar] [CrossRef] [PubMed]
  5. Redlich, C.A.; Karol, M.H. Diisocyanate asthma: Clinical aspects and immunopathogenesis. Int. Immunopharmacol. 2002, 2, 213–224. [Google Scholar] [CrossRef] [PubMed]
  6. Engfeldt, M.; Isaksson, M.; Zimerson, E.; Bruze, M. Several cases of work-related allergic contact dermatitis caused by isocyanates at a company manufacturing heat exchangers. Contact Dermat. 2013, 68, 175–180. [Google Scholar] [CrossRef] [PubMed]
  7. Jan, R.L.; Chen, S.H.; Chang, H.Y.; Yeh, H.J.; Shieh, C.C.; Wang, J.Y. Asthma-like syndrome in school children after accidental exposure to xylene and methylene diphenyl diisocyanate. J. Microbiol. Immunol. Infect. 2008, 41, 337–341. [Google Scholar] [PubMed]
  8. Wisnewski, A.V.; Cooney, R.; Hodgson, M.; Giese, K.; Liu, J.; Redlich, C.A. Severe asthma and death in a worker using methylene diphenyl diisocyanate MDI asthma death. Am. J. Ind. Med. 2022, 65, 166–172. [Google Scholar] [CrossRef]
  9. Cantin, A.M.; North, S.L.; Hubbard, R.C.; Crystal, R.G. Normal alveolar epithelial lining fluid contains high levels of glutathione. J. Appl. Physiol. (1985) 1987, 63, 152–157. [Google Scholar] [CrossRef]
  10. Day, B.W.; Jin, R.; Basalyga, D.M.; Kramarik, J.A.; Karol, M.H. Formation, solvolysis, and transcarbamoylation reactions of bis(S-glutathionyl) adducts of 2,4- and 2,6-diisocyanatotoluene. Chem. Res. Toxicol. 1997, 10, 424–431. [Google Scholar] [CrossRef]
  11. Reisser, M.; Schmidt, B.F.; Brown, W.E. Synthesis, characterization, and solvolysis of mono- and bis-S-(glutathionyl) adducts of methylene-bis-(phenylisocyanate) (MDI). Chem. Res. Toxicol. 2002, 15, 1235–1241. [Google Scholar] [CrossRef]
  12. Wisnewski, A.V.; Liu, J.; Redlich, C.A. Connecting glutathione with immune responses to occupational methylene diphenyl diisocyanate exposure. Chem. Biol. Interact. 2013, 205, 38–45. [Google Scholar] [CrossRef]
  13. Barnes, P.J. Immunology of asthma and chronic obstructive pulmonary disease. Nat. Rev. Immunol. 2008, 8, 183–192. [Google Scholar] [CrossRef]
  14. Holgate, S.T. Pathogenesis of asthma. Clin. Exp. Allergy 2008, 38, 872–897. [Google Scholar] [CrossRef] [PubMed]
  15. Boonpiyathad, T.; Sozener, Z.C.; Satitsuksanoa, P.; Akdis, C.A. Immunologic mechanisms in asthma. Semin. Immunol. 2019, 46, 101333. [Google Scholar] [CrossRef] [PubMed]
  16. Fricker, M.; Gibson, P.G. Macrophage dysfunction in the pathogenesis and treatment of asthma. Eur. Respir. J. 2017, 50, 1700196. [Google Scholar] [CrossRef] [PubMed]
  17. Girodet, P.O.; Nguyen, D.; Mancini, J.D.; Hundal, M.; Zhou, X.; Israel, E.; Cernadas, M. Alternative Macrophage Activation Is Increased in Asthma. Am. J. Respir. Cell Mol. Biol. 2016, 55, 467–475. [Google Scholar] [CrossRef] [PubMed]
  18. Wisnewski, A.V.; Liu, J.; Redlich, C.A. Analysis of Lung Gene Expression Reveals a Role for Cl(-) Channels in Diisocyanate-induced Airway Eosinophilia in a Mouse Model of Asthma Pathology. Am. J. Respir. Cell Mol. Biol. 2020, 63, 25–35. [Google Scholar] [CrossRef]
  19. Wisnewski, A.V.; Liu, J.; Colangelo, C.M. Glutathione reaction products with a chemical allergen, methylene-diphenyl diisocyanate, stimulate alternative macrophage activation and eosinophilic airway inflammation. Chem. Res. Toxicol. 2015, 28, 729–737. [Google Scholar] [CrossRef]
  20. Lin, C.C.; Law, B.F.; Hettick, J.M. 4,4′-Methylene diphenyl diisocyanate exposure induces expression of alternatively activated macrophage-associated markers and chemokines partially through Kruppel-like factor 4 mediated signaling in macrophages. Xenobiotica 2023, 53, 653–669. [Google Scholar] [CrossRef]
  21. Park, C.S.; Shen, Y.; Lewis, A.; Lacorazza, H.D. Role of the reprogramming factor KLF4 in blood formation. J. Leukoc. Biol. 2016, 99, 673–685. [Google Scholar] [CrossRef]
  22. Lin, C.C.; Law, B.F.; Hettick, J.M. MicroRNA-mediated Kruppel-like factor 4 upregulation induces alternatively activated macrophage-associated marker and chemokine transcription in 4,4′-methylene diphenyl diisocyanate exposed macrophages. Xenobiotica 2024, 54, 1–19. [Google Scholar] [CrossRef]
  23. Peng, F.; Gong, W.; Li, S.; Yin, B.; Zhao, C.; Liu, W.; Chen, X.; Luo, C.; Huang, Q.; Chen, T.; et al. circRNA_010383 Acts as a Sponge for miR-135a, and Its Downregulated Expression Contributes to Renal Fibrosis in Diabetic Nephropathy. Diabetes 2021, 70, 603–615. [Google Scholar] [CrossRef]
  24. Ding, T.; Zhu, Y.; Jin, H.; Zhang, P.; Guo, J.; Zheng, J. Circular RNA circ_0057558 Controls Prostate Cancer Cell Proliferation Through Regulating miR-206/USP33/c-Myc Axis. Front. Cell Dev. Biol. 2021, 9, 644397. [Google Scholar] [CrossRef] [PubMed]
  25. Zhu, H.; Zhu, S.; Shang, X.; Meng, X.; Jing, S.; Yu, L.; Deng, Y. Exhausting circ_0136474 and Restoring miR-766-3p Attenuate Chondrocyte Oxidative Injury in IL-1beta-Induced Osteoarthritis Progression Through Regulating DNMT3A. Front. Genet. 2021, 12, 648709. [Google Scholar] [CrossRef]
  26. Zeng, H.; Gao, H.; Zhang, M.; Wang, J.; Gu, Y.; Wang, Y.; Zhang, H.; Liu, P.; Zhang, X.; Zhao, L. Atractylon Treatment Attenuates Pulmonary Fibrosis via Regulation of the mmu_circ_0000981/miR-211-5p/TGFBR2 Axis in an Ovalbumin-Induced Asthma Mouse Model. Inflammation 2021, 44, 1856–1864. [Google Scholar] [CrossRef] [PubMed]
  27. Huang, Z.; Cao, Y.; Zhou, M.; Qi, X.; Fu, B.; Mou, Y.; Wu, G.; Xie, J.; Zhao, J.; Xiong, W. Hsa_circ_0005519 increases IL-13/IL-6 by regulating hsa-let-7a-5p in CD4(+) T cells to affect asthma. Clin. Exp. Allergy 2019, 49, 1116–1127. [Google Scholar] [CrossRef] [PubMed]
  28. Salmena, L.; Poliseno, L.; Tay, Y.; Kats, L.; Pandolfi, P.P. A ceRNA hypothesis: The Rosetta Stone of a hidden RNA language? Cell 2011, 146, 353–358. [Google Scholar] [CrossRef]
  29. Zhang, Y.; Zhang, Y.; Li, X.; Zhang, M.; Lv, K. Microarray analysis of circular RNA expression patterns in polarized macrophages. Int. J. Mol. Med. 2017, 39, 373–379. [Google Scholar] [CrossRef]
  30. Zhang, J.; Cheng, F.; Rong, G.; Tang, Z.; Gui, B. Circular RNA hsa_circ_0005567 overexpression promotes M2 type macrophage polarization through miR-492/SOCS2 axis to inhibit osteoarthritis progression. Bioengineered 2021, 12, 8920–8930. [Google Scholar] [CrossRef]
  31. Wang, Y.; Gao, R.; Li, J.; Tang, S.; Li, S.; Tong, Q.; Li, S. Downregulation of hsa_circ_0074854 Suppresses the Migration and Invasion in Hepatocellular Carcinoma via Interacting with HuR and via Suppressing Exosomes-Mediated Macrophage M2 Polarization. Int. J. Nanomed. 2021, 16, 2803–2818. [Google Scholar] [CrossRef]
  32. Zhang, C.; Han, X.; Yang, L.; Fu, J.; Sun, C.; Huang, S.; Xiao, W.; Gao, Y.; Liang, Q.; Wang, X.; et al. Circular RNA circPPM1F modulates M1 macrophage activation and pancreatic islet inflammation in type 1 diabetes mellitus. Theranostics 2020, 10, 10908–10924. [Google Scholar] [CrossRef]
  33. Song, H.; Yang, Y.; Sun, Y.; Wei, G.; Zheng, H.; Chen, Y.; Cai, D.; Li, C.; Ma, Y.; Lin, Z.; et al. Circular RNA Cdyl promotes abdominal aortic aneurysm formation by inducing M1 macrophage polarization and M1-type inflammation. Mol. Ther. 2022, 30, 915–931. [Google Scholar] [CrossRef]
  34. Lin, C.C.; Law, B.F.; Hettick, J.M. Acute 4,4′-Methylene Diphenyl Diisocyanate Exposure-Mediated Downregulation of miR-206-3p and miR-381-3p Activates Inducible Nitric Oxide Synthase Transcription by Targeting Calcineurin/NFAT Signaling in Macrophages. Toxicol. Sci. 2020, 173, 100–113. [Google Scholar] [CrossRef] [PubMed]
  35. Lin, C.C.; Law, B.F.; Siegel, P.D.; Hettick, J.M. Circulating miRs-183-5p, -206-3p and -381-3p may serve as novel biomarkers for 4,4′-methylene diphenyl diisocyanate exposure. Biomarkers 2019, 24, 76–90. [Google Scholar] [CrossRef] [PubMed]
  36. Patop, I.L.; Wust, S.; Kadener, S. Past, present, and future of circRNAs. EMBO J. 2019, 38, e100836. [Google Scholar] [CrossRef] [PubMed]
  37. Zhang, B.; Huo, S.; Cen, X.; Pan, X.; Huang, X.; Zhao, Z. circAKT3 positively regulates osteogenic differentiation of human dental pulp stromal cells via miR-206/CX43 axis. Stem Cell Res. Ther. 2020, 11, 531. [Google Scholar] [CrossRef] [PubMed]
  38. Wang, Y.; Guo, T.; Liu, Q.; Xie, X. CircRAD18 Accelerates the Progression of Acute Myeloid Leukemia by Modulation of miR-206/PRKACB Axis. Cancer Manag. Res. 2020, 12, 10887–10896. [Google Scholar] [CrossRef]
  39. Li, H.; Xia, Z.; Liu, L.; Pan, G.; Ding, J.; Liu, J.; Kang, J.; Li, J.; Jiang, D.; Liu, W. Astragalus IV Undermines Multi-Drug Resistance and Glycolysis of MDA-MB-231/ADR Cell Line by Depressing hsa_circ_0001982-miR-206/miR-613 Axis. Cancer Manag. Res. 2021, 13, 5821–5833. [Google Scholar] [CrossRef]
  40. Mei, X.; Cui, X.B.; Li, Y.; Chen, S.Y. CircSOD2: A Novel Regulator for Smooth Muscle Proliferation and Neointima Formation. Arterioscler. Thromb. Vasc. Biol. 2021, 41, 2961–2973. [Google Scholar] [CrossRef]
  41. Wang, X.; Bai, M. CircTM7SF3 contributes to oxidized low-density lipoprotein-induced apoptosis, inflammation and oxidative stress through targeting miR-206/ASPH axis in atherosclerosis cell model in vitro. BMC Cardiovasc. Disord. 2021, 21, 51. [Google Scholar] [CrossRef]
  42. Zhang, Y.; Fang, S.; Wang, J.; Chen, S.; Xuan, R. Hsa_circ_0008726 regulates the proliferation, migration, and invasion of trophoblast cells in preeclampsia through modulating the miR-1290-LHX6 signaling pathway. J. Clin. Lab. Anal. 2022, 36, e24540. [Google Scholar] [CrossRef]
  43. Han, T.; Shi, M.; Chen, G.; Hao, J. Circ_0008726 promotes malignant progression of ESCC cells through miR-206/HOXA13 pathway. Gen. Thorac. Cardiovasc. Surg. 2023, 71, 33–45. [Google Scholar] [CrossRef]
  44. Zheng, X.; Ma, Y.F.; Zhang, X.R.; Li, Y.; Zhao, H.H.; Han, S.G. Circ_0056618 promoted cell proliferation, migration and angiogenesis through sponging with miR-206 and upregulating CXCR4 and VEGF-A in colorectal cancer. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 4190–4202. [Google Scholar] [CrossRef] [PubMed]
  45. Li, H.; Yao, G.; Feng, B.; Lu, X.; Fan, Y. Circ_0056618 and CXCR4 act as competing endogenous in gastric cancer by regulating miR-206. J. Cell Biochem. 2018, 119, 9543–9551. [Google Scholar] [CrossRef] [PubMed]
  46. Feng, W.; Han, S. lncRNA ADAMTS9-AS1/circFN1 Competitively Binds to miR-206 to Elevate the Expression of ACTB, Thus Inducing Hypertrophic Cardiomyopathy. Oxid. Med. Cell Longev. 2022, 2022, 1450610. [Google Scholar] [CrossRef] [PubMed]
  47. Wang, M.; Gao, Y.; Liu, J. Silencing circZFR inhibits the proliferation, migration and invasion of human renal carcinoma cells by regulating miR-206. Onco Targets Ther. 2019, 12, 7537–7550. [Google Scholar] [CrossRef] [PubMed]
  48. Lin, C.C.; Law, B.F.; Hettick, J.M. MicroRNA-mediated calcineurin signaling activation induces CCL2, CCL3, CCL5, IL8, and chemotactic activities in 4,4′-methylene diphenyl diisocyanate exposed macrophages. Xenobiotica 2021, 51, 1436–1452. [Google Scholar] [CrossRef]
  49. Maess, M.B.; Wittig, B.; Cignarella, A.; Lorkowski, S. Reduced PMA enhances the responsiveness of transfected THP-1 macrophages to polarizing stimuli. J. Immunol. Methods 2014, 402, 76–81. [Google Scholar] [CrossRef]
  50. Baxter, E.W.; Graham, A.E.; Re, N.A.; Carr, I.M.; Robinson, J.I.; Mackie, S.L.; Morgan, A.W. Standardized protocols for differentiation of THP-1 cells to macrophages with distinct M(IFNgamma+LPS), M(IL-4) and M(IL-10) phenotypes. J. Immunol. Methods 2020, 478, 112721. [Google Scholar] [CrossRef]
  51. Fischkoff, S.A. Graded increase in probability of eosinophilic differentiation of HL-60 promyelocytic leukemia cells induced by culture under alkaline conditions. Leuk. Res. 1988, 12, 679–686. [Google Scholar] [CrossRef]
  52. Tiffany, H.L.; Li, F.; Rosenberg, H.F. Hyperglycosylation of eosinophil ribonucleases in a promyelocytic leukemia cell line and in differentiated peripheral blood progenitor cells. J. Leukoc. Biol. 1995, 58, 49–54. [Google Scholar] [CrossRef]
  53. Badewa, A.P.; Hudson, C.E.; Heiman, A.S. Regulatory effects of eotaxin, eotaxin-2, and eotaxin-3 on eosinophil degranulation and superoxide anion generation. Exp. Biol. Med. (Maywood) 2002, 227, 645–651. [Google Scholar] [CrossRef]
  54. Liang, D.; Wilusz, J.E. Short intronic repeat sequences facilitate circular RNA production. Genes. Dev. 2014, 28, 2233–2247. [Google Scholar] [CrossRef] [PubMed]
  55. Lin, C.C.; Liu, L.Z.; Addison, J.B.; Wonderlin, W.F.; Ivanov, A.V.; Ruppert, J.M. A KLF4-miRNA-206 autoregulatory feedback loop can promote or inhibit protein translation depending upon cell context. Mol. Cell Biol. 2011, 31, 2513–2527. [Google Scholar] [CrossRef] [PubMed]
  56. Dudekula, D.B.; Panda, A.C.; Grammatikakis, I.; De, S.; Abdelmohsen, K.; Gorospe, M. CircInteractome: A web tool for exploring circular RNAs and their interacting proteins and microRNAs. RNA Biol. 2016, 13, 34–42. [Google Scholar] [CrossRef] [PubMed]
  57. Liu, M.; Wang, Q.; Shen, J.; Yang, B.B.; Ding, X. Circbank: A comprehensive database for circRNA with standard nomenclature. RNA Biol. 2019, 16, 899–905. [Google Scholar] [CrossRef] [PubMed]
  58. Parasramka, M.A.; Dashwood, W.M.; Wang, R.; Saeed, H.H.; Williams, D.E.; Ho, E.; Dashwood, R.H. A role for low-abundance miRNAs in colon cancer: The miR-206/Kruppel-like factor 4 (KLF4) axis. Clin. Epigenetics 2012, 4, 16. [Google Scholar] [CrossRef]
  59. Tang, X.; Tian, X.; Zhang, Y.; Wu, W.; Tian, J.; Rui, K.; Tong, J.; Lu, L.; Xu, H.; Wang, S. Correlation between the frequency of Th17 cell and the expression of microRNA-206 in patients with dermatomyositis. Clin. Dev. Immunol. 2013, 2013, 345347. [Google Scholar] [CrossRef]
  60. Mantovani, A.; Sica, A.; Sozzani, S.; Allavena, P.; Vecchi, A.; Locati, M. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 2004, 25, 677–686. [Google Scholar] [CrossRef]
  61. White, J.R.; Imburgia, C.; Dul, E.; Appelbaum, E.; O’Donnell, K.; O’Shannessy, D.J.; Brawner, M.; Fornwald, J.; Adamou, J.; Elshourbagy, N.A.; et al. Cloning and functional characterization of a novel human CC chemokine that binds to the CCR3 receptor and activates human eosinophils. J. Leukoc. Biol. 1997, 62, 667–675. [Google Scholar] [CrossRef]
  62. Hageman, J.; Rujano, M.A.; van Waarde, M.A.W.H.; Kakkar, V.; Dirks, R.P.; Govorukhina, N.; Oosterveld-Hut, H.M.J.; Lubsen, N.H.; Kampinga, H.H. A DNAJB Chaperone Subfamily with HDAC-Dependent Activities Suppresses Toxic Protein Aggregation. Mol. Cell 2010, 37, 355–369. [Google Scholar] [CrossRef]
  63. Kumar, M.; Mitra, D. Heat Shock Protein 40 Is Necessary for Human Immunodeficiency Virus-1 Nef-mediated Enhancement of Viral Gene Expression and Replication*. J. Biol. Chem. 2005, 280, 40041–40050. [Google Scholar] [CrossRef]
  64. Cheng, X.; Belshan, M.; Ratner, L. Hsp40 facilitates nuclear import of the human immunodeficiency virus type 2 Vpx-mediated preintegration complex. J. Virol. 2008, 82, 1229–1237. [Google Scholar] [CrossRef] [PubMed]
  65. Kumar, M.; Rawat, P.; Khan, S.Z.; Dhamija, N.; Chaudhary, P.; Ravi, D.S.; Mitra, D. Reciprocal regulation of human immunodeficiency virus-1 gene expression and replication by heat shock proteins 40 and 70. J. Mol. Biol. 2011, 410, 944–958. [Google Scholar] [CrossRef] [PubMed]
  66. Pei, Y.; Fu, W.; Yang, E.; Shen, A.; Chen, Y.C.; Gong, H.; Chen, J.; Huang, J.; Xiao, G.; Liu, F. A Hsp40 Chaperone Protein Interacts with and Modulates the Cellular Distribution of the Primase Protein of Human Cytomegalovirus. PLoS Pathog. 2012, 8, e1002968. [Google Scholar] [CrossRef] [PubMed]
  67. Fan, C.Y.; Lee, S.; Cyr, D.M. Mechanisms for regulation of Hsp70 function by Hsp40. Cell Stress. Chaperones 2003, 8, 309–316. [Google Scholar] [CrossRef] [PubMed]
  68. Sterrenberg, J.N.; Blatch, G.L.; Edkins, A.L. Human DNAJ in cancer and stem cells. Cancer Lett. 2011, 312, 129–142. [Google Scholar] [CrossRef]
  69. Mitra, A.; Menezes, M.E.; Shevde, L.A.; Samant, R.S. DNAJB6 Induces Degradation of β-Catenin and Causes Partial Reversal of Mesenchymal Phenotype*. J. Biol. Chem. 2010, 285, 24686–24694. [Google Scholar] [CrossRef]
  70. Mitra, A.; Fillmore, R.A.; Metge, B.J.; Rajesh, M.; Xi, Y.; King, J.; Ju, J.; Pannell, L.; Shevde, L.A.; Samant, R.S. Large isoform of MRJ (DNAJB6) reduces malignant activity of breast cancer. Breast Cancer Res. 2008, 10, R22. [Google Scholar] [CrossRef]
  71. Lin, Y.; Peng, N.; Zhuang, H.; Zhang, D.; Wang, Y.; Hua, Z.C. Heat shock proteins HSP70 and MRJ cooperatively regulate cell adhesion and migration through urokinase receptor. BMC Cancer 2014, 14, 639. [Google Scholar] [CrossRef]
  72. Genua, M.; D’Alessio, S.; Cibella, J.; Gandelli, A.; Sala, E.; Correale, C.; Spinelli, A.; Arena, V.; Malesci, A.; Rutella, S.; et al. The urokinase plasminogen activator receptor (uPAR) controls macrophage phagocytosis in intestinal inflammation. Gut 2015, 64, 589–600. [Google Scholar] [CrossRef]
  73. Ko, S.H.; Huang, L.M.; Tarn, W.Y. The Host Heat Shock Protein MRJ/DNAJB6 Modulates Virus Infection. Front. Microbiol. 2019, 10, 2885. [Google Scholar] [CrossRef]
  74. Liu, X.; Ali, M.K.; Dua, K.; Mao, Y.; Liu, J. Circular RNAs: Emerging players in asthma and COPD. Front. Cell Dev. Biol. 2023, 11, 1267792. [Google Scholar] [CrossRef] [PubMed]
  75. Shang, Y.; Sun, Y.; Xu, J.; Ge, X.; Hu, Z.; Xiao, J.; Ning, Y.; Dong, Y.; Bai, C. Exosomes from mmu_circ_0001359-Modified ADSCs Attenuate Airway Remodeling by Enhancing FoxO1 Signaling-Mediated M2-like Macrophage Activation. Mol. Ther. Nucleic Acids 2020, 19, 951–960. [Google Scholar] [CrossRef] [PubMed]
  76. Gong, B.; Zheng, Y.; Li, J.; Lei, H.; Liu, K.; Tang, J.; Peng, Y. Luteolin activates M2 macrophages and suppresses M1 macrophages by upregulation of hsa_circ_0001326 in THP-1 derived macrophages. Bioengineered 2022, 13, 5079–5090. [Google Scholar] [CrossRef] [PubMed]
  77. Liang, Q.; Fu, J.; Wang, X.; Liu, L.; Xiao, W.; Gao, Y.; Yang, L.; Yu, H.; Xie, X.; Tu, Z.; et al. circS100A11 enhances M2a macrophage activation and lung inflammation in children with asthma. Allergy 2023, 78, 1459–1472. [Google Scholar] [CrossRef]
Figure 1. MDI-GSH conjugate treatment induces endogenous circRNA hsa_circ_0008726 in differentiated/enhanced THP-1 macrophages. Total RNA was isolated from the indicated MDI-GSH conjugate-treated differentiated/enhanced THP-1 macrophages by the mirVana miR isolation kit, reverse transcribed, and subjected to SYBR green-based or TaqMan stem-loop miR RT-qPCR. Endogenous miR/circRNA expressions of (A) hsa-miR-206-3p, (B) hsa_circ_0000199, (C) hsa_circ_0001264, (D) hsa_circ_0001982, (E) hsa_circ_0004662, (F) hsa_circ_0007428, (G) hsa_circ_0008726, (H) hsa_circ_0056618, (I) hsa_circ_0057558, (J) hsa_circ_0058141, and (K) hsa_circ_0072088 were determined 24 h after MDI-GSH conjugate treatments (N = 3; bars, SEM). MDI: 4,4′-methylene diphenyl diisocyanate. GSH: Glutathione. (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 1. MDI-GSH conjugate treatment induces endogenous circRNA hsa_circ_0008726 in differentiated/enhanced THP-1 macrophages. Total RNA was isolated from the indicated MDI-GSH conjugate-treated differentiated/enhanced THP-1 macrophages by the mirVana miR isolation kit, reverse transcribed, and subjected to SYBR green-based or TaqMan stem-loop miR RT-qPCR. Endogenous miR/circRNA expressions of (A) hsa-miR-206-3p, (B) hsa_circ_0000199, (C) hsa_circ_0001264, (D) hsa_circ_0001982, (E) hsa_circ_0004662, (F) hsa_circ_0007428, (G) hsa_circ_0008726, (H) hsa_circ_0056618, (I) hsa_circ_0057558, (J) hsa_circ_0058141, and (K) hsa_circ_0072088 were determined 24 h after MDI-GSH conjugate treatments (N = 3; bars, SEM). MDI: 4,4′-methylene diphenyl diisocyanate. GSH: Glutathione. (* p < 0.05, ** p < 0.01, *** p < 0.001).
Cells 13 01725 g001
Figure 2. Circular RNA hsa_circ_0008726 is presented in THP-1 macrophages, and MDI-GSH conjugates upregulate endogenous hsa_circ_0008726 parental host gene transcript DNAJB6. (A) Characteristics of hsa_circ_0008726 obtained from the Circular RNA Interactome database. (B) Illustration shows exon numbers and designed convergent and divergent primer sites on the mature DNAJB6 transcripts. RNAse R degrades linear RNA species, including the DNAJB6 transcript. CircRNA hsa_circ_0008726 is back spliced from exon 3–5 of the DNAJB6 transcript. (C) Total RNA was isolated from THP-1 macrophages by the mirVana miR isolation kit and treated with or without RNAse R, further purified using the mirVana miR isolation kit, reverse transcribed, and subjected to RT-PCR using convergent or divergent primers. RT-NTC: Templates from a cDNA synthesis reaction without adding reverse transcriptase. PCR-NTC: Use only water to replace cDNA templates during PCR reaction. (D) Total RNA was isolated from MDI-GSH-treated differentiated/enhanced THP-1 macrophages at indicated concentrations for 24 h by the mirVana miR isolation kit, reverse transcribed, and subjected to TaqMan RT-qPCR assays. Endogenous levels of DNAJB6 were determined at 24 h after MDI-GSH conjugate treatment (N = 3; bars, SEM). MDI: 4,4′-methylene diphenyl diisocyanate. GSH: Glutathione (** p < 0.01, *** p < 0.001).
Figure 2. Circular RNA hsa_circ_0008726 is presented in THP-1 macrophages, and MDI-GSH conjugates upregulate endogenous hsa_circ_0008726 parental host gene transcript DNAJB6. (A) Characteristics of hsa_circ_0008726 obtained from the Circular RNA Interactome database. (B) Illustration shows exon numbers and designed convergent and divergent primer sites on the mature DNAJB6 transcripts. RNAse R degrades linear RNA species, including the DNAJB6 transcript. CircRNA hsa_circ_0008726 is back spliced from exon 3–5 of the DNAJB6 transcript. (C) Total RNA was isolated from THP-1 macrophages by the mirVana miR isolation kit and treated with or without RNAse R, further purified using the mirVana miR isolation kit, reverse transcribed, and subjected to RT-PCR using convergent or divergent primers. RT-NTC: Templates from a cDNA synthesis reaction without adding reverse transcriptase. PCR-NTC: Use only water to replace cDNA templates during PCR reaction. (D) Total RNA was isolated from MDI-GSH-treated differentiated/enhanced THP-1 macrophages at indicated concentrations for 24 h by the mirVana miR isolation kit, reverse transcribed, and subjected to TaqMan RT-qPCR assays. Endogenous levels of DNAJB6 were determined at 24 h after MDI-GSH conjugate treatment (N = 3; bars, SEM). MDI: 4,4′-methylene diphenyl diisocyanate. GSH: Glutathione (** p < 0.01, *** p < 0.001).
Cells 13 01725 g002
Figure 3. Human circular RNA hsa_circ_0008726 is a target of hsa-miR-206-3p. (A) Alignment of the hsa_circ_0008726 sequence regions of potential hsa-miR-206-3p binding sites. (B) Differentiated/enhanced THP-1 macrophages were transfected with 25 nM of indicated miR-mimic or nontargeting miR-mimic control (miR-mimic-Ctl) for 24 h. The cells were collected and immunoprecipitated using the panAGO or isotype IgG antibody after 24 h transfection. RNA was isolated, and the fold enrichment of hsa_circ_0008726 was measured (N = 3; bars, SEM). (C,D) THP-1 macrophages were transfected with 25 nM of either miR-mimic/inhibitor-206-3p, miR-mimic/inhibitor-381-3p, or nontargeting miR-mimic/inhibitor control for 24 h. Total RNA was isolated from the indicated miR-mimics/inhibitors transfected THP-1 macrophages by the mirVana miR isolation kit, reverse transcribed, and subjected to RT-qPCR. The endogenous hsa_circ_0008726 levels from indicated (C) miR-mimics or (D) miR-inhibitors transfected THP-1 macrophages were determined by SYBR Green RT-qPCR assays (N = 3; bars, SEM). (* p < 0.05, ** p < 0.01).
Figure 3. Human circular RNA hsa_circ_0008726 is a target of hsa-miR-206-3p. (A) Alignment of the hsa_circ_0008726 sequence regions of potential hsa-miR-206-3p binding sites. (B) Differentiated/enhanced THP-1 macrophages were transfected with 25 nM of indicated miR-mimic or nontargeting miR-mimic control (miR-mimic-Ctl) for 24 h. The cells were collected and immunoprecipitated using the panAGO or isotype IgG antibody after 24 h transfection. RNA was isolated, and the fold enrichment of hsa_circ_0008726 was measured (N = 3; bars, SEM). (C,D) THP-1 macrophages were transfected with 25 nM of either miR-mimic/inhibitor-206-3p, miR-mimic/inhibitor-381-3p, or nontargeting miR-mimic/inhibitor control for 24 h. Total RNA was isolated from the indicated miR-mimics/inhibitors transfected THP-1 macrophages by the mirVana miR isolation kit, reverse transcribed, and subjected to RT-qPCR. The endogenous hsa_circ_0008726 levels from indicated (C) miR-mimics or (D) miR-inhibitors transfected THP-1 macrophages were determined by SYBR Green RT-qPCR assays (N = 3; bars, SEM). (* p < 0.05, ** p < 0.01).
Cells 13 01725 g003
Figure 4. Transfection of hsa_circ_0008726 siRNA knocks down endogenous hsa_circ_0008726 levels and upregulates hsa-miR-206-3p in differentiated/enhanced THP-1 macrophages. Differentiated/enhanced THP-1 macrophages were transfected with 25 nM of either si-hsa_circ_0008726#1, si-hsa_circ_0008726#2 siRNA, or nontargeting siRNA control (siCtl). After 24 h, the endogenous levels of (A) hsa_circ_0008726 and (B) hsa-miR-206-3p were measured by RT-qPCR (N = 3; bars, SEM). (* p < 0.05, ** p < 0.01).
Figure 4. Transfection of hsa_circ_0008726 siRNA knocks down endogenous hsa_circ_0008726 levels and upregulates hsa-miR-206-3p in differentiated/enhanced THP-1 macrophages. Differentiated/enhanced THP-1 macrophages were transfected with 25 nM of either si-hsa_circ_0008726#1, si-hsa_circ_0008726#2 siRNA, or nontargeting siRNA control (siCtl). After 24 h, the endogenous levels of (A) hsa_circ_0008726 and (B) hsa-miR-206-3p were measured by RT-qPCR (N = 3; bars, SEM). (* p < 0.05, ** p < 0.01).
Cells 13 01725 g004
Figure 5. CircRNA hsa_circ_0008726 as a downstream effector to MDI-GSH conjugate exposure for regulating hsa-miR-206-3p/KLF4 and KLF4-mediated M2 macrophage-associated markers and chemokines in macrophages. Differentiated/enhanced THP-1 macrophages were transfected with 25 nM of either si-hsa_circ_0008726#1 or nontargeting siRNA control (siCtl) for 24 h, followed by treatment either with or without 10 µM MDI-GSH conjugate for 24 h. Total RNA was isolated from macrophages with indicated treatments/transfections by the mirVana miR isolation kit, reverse transcribed, and subjected to SYBR green-based or TaqMan stem-loop miR RT-qPCR. The endogenous levels of (A) hsa_circ_0008726 and (B) hsa-miR-206-3p as well as the M2 macrophage-associated transcription factor (C) KLF4, markers (D) CD206, (E) TGM2, (F) CCL17, (G) CCL22, and (H) CCL24 mRNA levels were determined in total RNA isolated from macrophages as indicated treatments (N = 3; bars, SEM). (* p < 0.05, ** p < 0.01, *** p < 0.001 when compared to vehicle-treated macrophages with transfection of or nontargeting siRNA control (siCtl); # p < 0.05, ## p < 0.01, ### p < 0.001, when compared to macrophages treated with 10 µM MDI-GSH conjugate as well as with transfection of indicated either si-hsa_circ_0008726#1 or nontargeting siRNA control (siCtl)).
Figure 5. CircRNA hsa_circ_0008726 as a downstream effector to MDI-GSH conjugate exposure for regulating hsa-miR-206-3p/KLF4 and KLF4-mediated M2 macrophage-associated markers and chemokines in macrophages. Differentiated/enhanced THP-1 macrophages were transfected with 25 nM of either si-hsa_circ_0008726#1 or nontargeting siRNA control (siCtl) for 24 h, followed by treatment either with or without 10 µM MDI-GSH conjugate for 24 h. Total RNA was isolated from macrophages with indicated treatments/transfections by the mirVana miR isolation kit, reverse transcribed, and subjected to SYBR green-based or TaqMan stem-loop miR RT-qPCR. The endogenous levels of (A) hsa_circ_0008726 and (B) hsa-miR-206-3p as well as the M2 macrophage-associated transcription factor (C) KLF4, markers (D) CD206, (E) TGM2, (F) CCL17, (G) CCL22, and (H) CCL24 mRNA levels were determined in total RNA isolated from macrophages as indicated treatments (N = 3; bars, SEM). (* p < 0.05, ** p < 0.01, *** p < 0.001 when compared to vehicle-treated macrophages with transfection of or nontargeting siRNA control (siCtl); # p < 0.05, ## p < 0.01, ### p < 0.001, when compared to macrophages treated with 10 µM MDI-GSH conjugate as well as with transfection of indicated either si-hsa_circ_0008726#1 or nontargeting siRNA control (siCtl)).
Cells 13 01725 g005
Figure 6. Circular RNA hsa_circ_0008726 overexpression increases M2 macrophage associate markers and chemokines in differentiated/enhanced THP-1 macrophages. Differentiated/enhanced THP-1 macrophages were transfected with 2.5 µg of either pcDNA3.1(+)_Circ_Mini-hsa_circ_0008726 or pcDNA3.1(+)_Circ_Mini vector plasmids for 48 h. Total RNA was isolated from plasmids transfected THP-1 macrophages by the mirVana miR isolation kit, reverse transcribed, and subjected to SYBR green or TaqMan RT-qPCR. The transgene of (A) hsa_circ_0008726 and (B) hsa-miR-206-3p as well as the endogenous M2 macrophage-associated markers (C) KLF4, (D) CD206, (E) TGM2, (F) CCL17, (G) CCL22, and (H) CCL24 mRNA levels were determined by RT-qPCR (N = 3; bars, SEM). (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 6. Circular RNA hsa_circ_0008726 overexpression increases M2 macrophage associate markers and chemokines in differentiated/enhanced THP-1 macrophages. Differentiated/enhanced THP-1 macrophages were transfected with 2.5 µg of either pcDNA3.1(+)_Circ_Mini-hsa_circ_0008726 or pcDNA3.1(+)_Circ_Mini vector plasmids for 48 h. Total RNA was isolated from plasmids transfected THP-1 macrophages by the mirVana miR isolation kit, reverse transcribed, and subjected to SYBR green or TaqMan RT-qPCR. The transgene of (A) hsa_circ_0008726 and (B) hsa-miR-206-3p as well as the endogenous M2 macrophage-associated markers (C) KLF4, (D) CD206, (E) TGM2, (F) CCL17, (G) CCL22, and (H) CCL24 mRNA levels were determined by RT-qPCR (N = 3; bars, SEM). (* p < 0.05, ** p < 0.01, *** p < 0.001).
Cells 13 01725 g006
Figure 7. CircRNA hsa_circ_0008726 plays an important role for the secretion of chemokines CCL17, CCL22, and CCL24 and regulates T-cell and eosinophil chemotaxis/migration in macrophages. Cell-free conditioned media were obtained from THP-1 macrophages transfected with either the hsa_circ_0008726 overexpression plasmid or the empty vector for 48 h. The secreted protein levels of (A) CCL17, (B) CCL22, and (C) CCL24 in conditioned media from either hsa_circ_0008726 overexpressed THP-1 macrophages or empty vector transfected THP-1 macrophages were determined by ELISA according to the manufacturer’s instructions. The isolated conditioned media were used as chemoattractants to attract (D) Jurkat T-cell clone E6-1 or differentiated (E) HL-60 C_15 eosinophils. T-cell and eosinophil migration responding to the conditioned media was measured after 6 h. Percent of cells migrated towards the bottom chamber are shown (** p < 0.01, *** p < 0.001).
Figure 7. CircRNA hsa_circ_0008726 plays an important role for the secretion of chemokines CCL17, CCL22, and CCL24 and regulates T-cell and eosinophil chemotaxis/migration in macrophages. Cell-free conditioned media were obtained from THP-1 macrophages transfected with either the hsa_circ_0008726 overexpression plasmid or the empty vector for 48 h. The secreted protein levels of (A) CCL17, (B) CCL22, and (C) CCL24 in conditioned media from either hsa_circ_0008726 overexpressed THP-1 macrophages or empty vector transfected THP-1 macrophages were determined by ELISA according to the manufacturer’s instructions. The isolated conditioned media were used as chemoattractants to attract (D) Jurkat T-cell clone E6-1 or differentiated (E) HL-60 C_15 eosinophils. T-cell and eosinophil migration responding to the conditioned media was measured after 6 h. Percent of cells migrated towards the bottom chamber are shown (** p < 0.01, *** p < 0.001).
Cells 13 01725 g007
Figure 8. Proposed mechanisms by which MDI-GSH conjugate exposure induces M2 macrophage-associated markers and chemokine CCL17, CCL22, and CCL24 via hsa_circ_0008726/hsa-miR-206-3p-regulated KLF4 activation in macrophages. MDI: 4,4′-methylene diphenyl diisocyanate; TFs: transcription factors; CDS: coding sequences; KLF4: Krüppel-like factor 4. Note: Some illustrated schematics were obtained from motifolio templates (Motifolio Inc., Ellicott City, MD, USA).
Figure 8. Proposed mechanisms by which MDI-GSH conjugate exposure induces M2 macrophage-associated markers and chemokine CCL17, CCL22, and CCL24 via hsa_circ_0008726/hsa-miR-206-3p-regulated KLF4 activation in macrophages. MDI: 4,4′-methylene diphenyl diisocyanate; TFs: transcription factors; CDS: coding sequences; KLF4: Krüppel-like factor 4. Note: Some illustrated schematics were obtained from motifolio templates (Motifolio Inc., Ellicott City, MD, USA).
Cells 13 01725 g008
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lin, C.-C.; Law, B.F.; Hettick, J.M. Circular RNA hsa_circ_0008726 Targets the hsa-miR-206-3p/KLF4 Axis to Modulate 4,4′-Methylene Diphenyl Diisocyanate-Glutathione Conjugate-Induced Chemokine Transcription in Macrophages. Cells 2024, 13, 1725. https://doi.org/10.3390/cells13201725

AMA Style

Lin C-C, Law BF, Hettick JM. Circular RNA hsa_circ_0008726 Targets the hsa-miR-206-3p/KLF4 Axis to Modulate 4,4′-Methylene Diphenyl Diisocyanate-Glutathione Conjugate-Induced Chemokine Transcription in Macrophages. Cells. 2024; 13(20):1725. https://doi.org/10.3390/cells13201725

Chicago/Turabian Style

Lin, Chen-Chung, Brandon F. Law, and Justin M. Hettick. 2024. "Circular RNA hsa_circ_0008726 Targets the hsa-miR-206-3p/KLF4 Axis to Modulate 4,4′-Methylene Diphenyl Diisocyanate-Glutathione Conjugate-Induced Chemokine Transcription in Macrophages" Cells 13, no. 20: 1725. https://doi.org/10.3390/cells13201725

APA Style

Lin, C.-C., Law, B. F., & Hettick, J. M. (2024). Circular RNA hsa_circ_0008726 Targets the hsa-miR-206-3p/KLF4 Axis to Modulate 4,4′-Methylene Diphenyl Diisocyanate-Glutathione Conjugate-Induced Chemokine Transcription in Macrophages. Cells, 13(20), 1725. https://doi.org/10.3390/cells13201725

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop