SQSTM1/p62 Knockout by Using the CRISPR/Cas9 System Inhibits Migration and Invasion of Hepatocellular Carcinoma
Abstract
1. Introduction
2. Materials and Methods
2.1. Bioinformatics Analysis
2.2. Cell Culture and Treatment
2.3. Generation of SQSTM1/p62 KO HepG2 Cells by CRISPR/Cas9 System
2.4. MTT Assay
2.5. Wound Healing Assay
2.6. Transwell Migration Assay
2.7. Transwell Invasion Assay
2.8. Quantitative Real-Time Polymerase Chain Reaction (RT-PCR) Assay
2.9. Western Blotting Assay
2.10. Gelatin Zymography Assay
2.11. siRNA Transfection
2.12. Animal Experiments
2.13. Statistical Analysis
3. Results
3.1. SQSTM1/p62 Is Overexpressed in HCC Tissues and Seriously Affects the Prognosis
3.2. SQSTM1 WT HepG2 Cells and SQSTM1 KO HepG2 Cells Are Generated Using CRISPR/Cas9 System
3.3. SQSTM1/p62 Promotes the Migration and Invasion of HCC In Vitro
3.4. SQSTM1/p62 Might Regulate HCC Migration and Invasion through the Keap1/Nrf2/MMP2 Signaling Pathway In Vitro
3.5. SQSTM1/p62 Regulates the Migration and Invasion of HCC through the Keap1/Nrf2/MMP2 Signaling Pathway In Vitro
3.6. SQSTM1/p62 Promotes the Migration and Invasion of HCC In Vivo
3.7. DDP Inhibits Migration and Invasion of HCC Based on SQSTM1/p62 Target
3.8. SQSTM1/p62 Promotes the Migration and Invasion of HCC More Vigorously in the Inflammatory Microenvironment
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Primers | Primer Sequence (5′-3′) |
---|---|
R1-h-p62-2 | TGTCCTACGTGAAGGATGACGGTGTTTCGTCCTTTCC |
F2-h-p62-2 | GTCATCCTTCACGTAGGACAGTTTTAGAGCTAGAAATAGCAA |
R1-h-p62-3 | ACGTGAAGGATGACATCTTCGGTGTTTCGTCCTTTCC |
F2-h-p62-3 | GAAGATGTCATCCTTCACGTGTTTTAGAGCTAGAAATAGCAA |
R1-h-p62-8 | ACCGTGTGCTCAGGAGGCGCGGTGTTTCGTCCTTTCC |
F2-h-p62-8 | GCGCCTCCTGAGCACACGGTGTTTTAGAGCTAGAAATAGCAA |
R1-h-p62-10 | TTGCAGCCATCGCAGATCACGGTGTTTCGTCCTTTCC |
F2-h-p62-10 | GTGATCTGCGATGGCTGCAAGTTTTAGAGCTAGAAATAGCAA |
F1 | AAACTCGAGTGTACAAAAAAGCAGGCTTTAAAG |
R2 | AAAGCTAGCTAATGCCAACTTTGTACAAGAAAGCTG |
Reagent | Concentration | Manufacturer |
---|---|---|
Tris | 60 mM | Sangon Biotech, China |
Sodium dodecyl sulfate | 2% | Sangon Biotech, China |
Glycerine | 10% | Sangon Biotech, China |
Bromophenol blue | 0.1% | Zhanyun Chemical Co., Ltd., Shanghai, China |
Reagent | Concentration | Manufacturer |
---|---|---|
Triton X-100 | 2.5% | Sangon Biotech, China |
Tris | 50 mM | Sangon Biotech, China |
Calcium chloride | 5 mM | Damao Chemical Reagent Co., Ltd., Tianjin, China |
ZnCl2 | 0.001 mM | JinShi Chemistry Co., Ltd., Zhangye, China |
Reagent | Concentration | Manufacturer |
---|---|---|
Tris | 50 mM | Sangon Biotech, China |
Calcium chloride | 5 mM | Damao Chemical Reagent Co., Ltd., China |
ZnCl2 | 0.001 mM | JinShi Chemistry Co., Ltd., China |
Reagent | Concentration | Manufacturer |
---|---|---|
Tris | 50 mM | Sangon Biotech, China |
NaCl | 200 mM | Sangon Biotech, China |
Calcium chloride | 5 mM | Damao Chemical Reagent Co., Ltd., China |
Brij-35 | 0.02% | Sangon Biotech, China |
ZnCl2 | 0.001 mM | JinShi Chemistry Co., Ltd., China |
Clinical Factors | Group | N | p62(−) | p62(+) | p Value |
---|---|---|---|---|---|
Tris | Female | 10 | 6 | 4 | >0.05 |
Male | 83 | 36 | 47 | ||
Age | <50 | 30 | 15 | 15 | >0.05 |
≥50 | 63 | 27 | 36 | ||
Tumor size | <5 cm | 38 | 22 | 16 | <0.05 |
≥5 cm | 55 | 20 | 35 | ||
Histological grade | I–II | 59 | 35 | 24 | <0.01 |
III–IV | 34 | 7 | 27 | ||
Venous invasion | absent | 74 | 41 | 33 | <0.01 |
Present | 19 | 1 | 18 | ||
Metastasis | Negative | 80 | 41 | 39 | <0.01 |
Positive | 13 | 1 | 12 | ||
TNM | I–II | 33 | 20 | 13 | <0.05 |
III–IV | 60 | 22 | 38 |
References
- Jacques, F.; Isabelle, S.; Rajesh, D.; Sultan, E.; Colin, M.; Marise, R.; Maxwell, P.D.; David, F.; Freddie, B. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int. J. Cancer 2015, 136, e359–e386. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2018. CA Cancer J. Clin. 2018, 68, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Zhong, J.; Sun, P.B.; Xu, N.H.; Liao, M.J.; Xu, C.K.; Ding, Y.P.; Cai, J.; Zhang, Y.O.; Xie, W.D. Canagliflozin inhibits p-gp function and early autophagy and improves the sensitivity to the antitumor effect of doxorubicin. Biochem. Pharmacol. 2020, 175, 113856. [Google Scholar] [CrossRef]
- Yang, J.D.; Roberts, L.R. Hepatocellular carcinoma: A global view. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 448–458. [Google Scholar] [CrossRef] [PubMed]
- Forner, A.; Reig, M.; Bruix, J. Hepatocellular carcinoma. Lancet 2018, 391, 1301–1314. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.S.; Li, D.D.; Feng, F.; An, L.; Hui, F.H.; Dang, D.S.; Zhao, Q.C. Progressive and prognosis value of notch receptors and ligands in hepatocellular carcinoma: A systematic review and meta-analysis. Sci. Rep. 2017, 7, 14809. [Google Scholar] [CrossRef]
- Valastyan, S.; Weinberg, R.A. Tumor metastasis: Molecular insights and evolving paradigms. Cell 2011, 147, 275–292. [Google Scholar] [CrossRef] [PubMed]
- Colecchia, A.; Schiumerini, R.; Cucchetti, A.; Cescon, M.; Taddia, M.; Marasco, G.; Festi, D. Prognostic factors for hepatocellular carcinoma recurrence. World J. Gastroenterol. 2014, 20, 5935–5950. [Google Scholar] [CrossRef]
- Svenning, S.; Lamark, T.; Krause, K.; Johansen, T. Plant NBR1 is a selective autophagy substrate and a functional hybrid of the mammalian autophagic adapters NBR1 and p62/SQSTM1. Autophagy 2011, 7, 993–1010. [Google Scholar] [CrossRef] [PubMed]
- Shin, J. P62 and the sequestosome, a novel mechanism for protein metabolism. Arch. Pharm. Res. 1998, 21, 629–633. [Google Scholar] [CrossRef] [PubMed]
- Ning, S.B.; Wang, L. The multifunctional protein p62 and its mechanistic roles in cancers. Curr. Cancer Drug. Targets 2019, 19, 468–478. [Google Scholar] [CrossRef]
- Moscat, J.; Karin, M.; Diaz-Meco, M.T. p62 in cancer: Signaling adaptor beyond autophagy. Cell 2016, 167, 606–609. [Google Scholar] [CrossRef] [PubMed]
- Iwadate, R.; Inoue, J.; Tsuda, H.; Takano, M.; Furuya, K.; Hirasawa, A.; Aoki, D.; Inazawa, J. High expression of p62 protein is associated with poor prognosis and aggressive phenotypes in endometrial cancer. Am. J. Pathol. 2015, 185, 2523–2533. [Google Scholar] [CrossRef] [PubMed]
- Mao, Y.; Deng, S.J.; Su, Y.J.; Diao, C.; Peng, Y.; Ma, J.F.; Cheng, R.C. The role of P62 in the development of human thyroid cancer and its possible mechanism. Cancer Genet. 2021, 256–257, 5–16. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.Z.; Liu, D.Y.; Jin, X.X.; Gao, P.; Wang, Q.Y.; Zhang, J.W.; Zhang, N. PA-MSHA inhibits the growth of doxorubicin-resistant MCF-7/ADR human breast cancer cells by downregulating Nrf2/p62. Cancer Med. 2016, 5, 3520–3531. [Google Scholar] [CrossRef]
- Rolland, P.; Madjd, Z.; Durrant, L.; Ellis, I.O.; Layfield, R.; Spendlove, I. The ubiquitin-binding protein p62 is expressed in breast cancers showing features of aggressive disease. Endocr. Relat. Cancer 2007, 14, 73–80. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.F.; Ou, Z.H.; Chen, R.C.; Niu, X.H.; Chen, D.; Kang, R.; Tang, D.L. Activation of the p62-Keap1-NRF2 pathway protects against ferroptosis in hepatocellular carcinoma cells. Hepatology 2016, 63, 173–184. [Google Scholar] [CrossRef] [PubMed]
- Lau, A.; Wang, X.J.; Zhao, F.; Villeneuve, N.F.; Wu, T.D.; Jiang, T.; Sun, Z.; White, E.; Zhang, D.D. A noncanonical mechanism of Nrf2 activation by autophagy deficiency: Direct interaction between Keap1 and p62. Mol. Cell. Biol. 2010, 30, 3275–3285. [Google Scholar] [CrossRef]
- Ngo, H.K.C.; Kim, D.H.; Suh, J.Y.; Park, S.A.; Kim, S.J.; Saeidi, S.; Na, H.K.; Surh, Y.J. Differential roles for the redox sensitive transcription factor Nrf2 in carcinogenesis. Free Radic. Biol. Med. 2018, 120, S19. [Google Scholar] [CrossRef]
- Lamoreaux, W.J.; Fitzgerald, M.E.C.; Reiner, A.; Hasty, K.A.; Charles, S.T. Vascular endothelial growth factor increases release of gelatinase a and decreases release of tissue inhibitor of metalloproteinases by microvascular endothelial cells in vitro. Microvasc. Res. 1998, 55, 29–42. [Google Scholar] [CrossRef] [PubMed]
- Hojilla, C.V.; Wood, G.A.; Khokha, R. Inflammation and breast cancer: Metalloproteinases as common effectors of inflammation and extracellular matrix breakdown in breast cancer. Breast Cancer Res. BCR 2008, 10, 205. [Google Scholar] [CrossRef]
- Liubomirski, Y.; Lerrer, S.; Meshel, T.; Rubinstein-Achiasaf, L.; Morein, D.; Wiemann, S.; Körner, C.; Ben-Baruch, A. Tumor-stroma-inflammation networks promote pro-metastatic chemokines and aggressiveness characteristics in triple-negative breast cancer. Front. Immunol. 2019, 10, 757. [Google Scholar] [CrossRef]
- Mantovani, A.; Allavena, P.; Sica, A.; Balkwill, F. Cancer-related inflammation. Nature 2008, 454, 436–444. [Google Scholar] [CrossRef] [PubMed]
- Sumimoto, H.; Imabayashi, F.; Yutaka Kawakami, T.I. The BRAF-MAPK signaling pathway is essential for cancer-immune evasion in human melanoma cells. J. Exp. Med. 2006, 203, 1651–1656. [Google Scholar] [CrossRef] [PubMed]
- Feller, L.; Altini, M.; Lemmer, J. Inflammation in the context of oral cancer. Oral. Oncol. 2013, 49, 887–892. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.H.; Wang, L.D.; Yang, M.S.; Hu, J.Q.; Zhang, E.; Peng, L.P. Oridonin attenuates LPS-induced early pulmonary fibrosis by regulating impaired autophagy, oxidative stress, inflammation and EMT. Eur. J. Pharmacol. 2022, 923, 174931. [Google Scholar] [CrossRef]
- Emanuele, S.; Lauricella, M.; D’Anneo, A.; Carlisi, D.; Blasio, A.D.; Liberto, D.D.; Giuliano, M. p62: Friend or foe? evidences for oncoJanus and neuroJanus roles. Int. J. Mol. Sci. 2020, 21, 5029. [Google Scholar] [CrossRef]
- Yang, S.W.; Qiang, L.; Sample, A.; Shah, P.; He, Y.Y. NF-κB signaling activation induced by chloroquine requires autophagosome, p62 protein, and c-Jun N-terminal Kinase (JNK) signaling and promotes tumor cell resistance. J. Biol. Chem. 2017, 292, 3379–3388. [Google Scholar] [CrossRef]
- Zhong, Z.Y.; Umemura, A.; Sanchez-Lopez, E.; Liang, S.; Shalapour, S.; Wong, J.; He, F.; Boassa, D.; Perkins, G.; Raza Ali, S.; et al. NF-kappa B restricts inflammasome activation via elimination of damaged mitochondria. Cell 2016, 164, 896–910. [Google Scholar] [CrossRef]
- Mirzaei, S.; Mohammadi, A.T.; Gholami, M.H.; Hashemi, F.; Zarrabi, A.; Zabolian, A.; Hushmandi, K.; Makvandi, P.; Samec, M.; Liskova, A.; et al. Nrf2 signaling pathway in cisplatin chemotherapy: Potential involvement in organ protection and chemoresistance. Pharmacol. Res. 2021, 167, 105575. [Google Scholar] [CrossRef]
- Han, X.J.; Yang, Z.J.; Jiang, L.P.; Wei, Y.F.; Liao, M.F.; Qian, Y.S.; Li, Y.; Huang, X.; Wang, J.B.; Xin, H.B.; et al. Mitochondrial dynamics regulates hypoxia-induced migration and antineoplastic activity of cisplatin in breast cancer cells. Int. J. Oncol. 2015, 46, 691–700. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Du, C.; Yang, F.; Zheng, X.; Qiu, D.; Zhang, Q.; Chen, W.; Xu, Y. Generation of hepatocyte-like cells from human urinary epithelial cells and the role of autophagy during direct reprogramming. Biochem. Biophys. Res. Commun. 2020, 527, 723–729. [Google Scholar] [CrossRef]
- Pai Bellare, G.; Saha, B.; Patro, B.S. Targeting autophagy reverses de novo resistance in homologous recombination repair proficient breast cancers to PARP inhibition. Br. J. Cancer 2021, 124, 1260–1274. [Google Scholar] [CrossRef]
- Li, T.W.; Fu, J.X.; Zeng, Z.X.; Cohen, D.; Li, J.; Chen, Q.M.; Li, B.; Liu, X.S. TIMER2.0 for analysis of tumor-infiltrating immune cells. Nucleic Acids Res. 2020, 48, w509–w514. [Google Scholar] [CrossRef]
- Tang, Z.F.; Li, C.W.; Kang, B.X.; Gao, G.; Li, C.; Zhang, Z.M. GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017, 45, w98–w102. [Google Scholar] [CrossRef]
- Wang, T.; Wei, J.J.; Sabatini, D.M.; Lander, E.S. Genetic screens in human cells using the CRISPR-Cas9 system. Science 2014, 343, 80–84. [Google Scholar] [CrossRef]
- Jiang, X.; Xu, C.; Lei, F.; Liao, M.; Wang, W.; Xu, N.; Zhang, Y.; Xie, W. MiR-30a targets IL-1α and regulates islet functions as an inflammation buffer and response factor. Sci. Rep. 2017, 7, 5270. [Google Scholar] [CrossRef] [PubMed]
- Sun, P.B.; Wang, Y.Y.; Ding, Y.P.; Luo, J.Y.; Zhong, J.; Xu, N.H.; Zhang, Y.O.; Xie, W.D. Canagliflozin attenuates lipotoxicity in cardiomyocytes and protects diabetic mouse hearts by inhibiting the mTOR/HIF-1α pathway. iScience 2021, 24, 102521. [Google Scholar] [CrossRef] [PubMed]
- Ha, K.T.; Kim, J.K.; Kang, S.K.; Kim, D.W.; Lee, Y.C.; Kim, H.M.; Kim, C.H. Inhibitory effect of Sihoga-Yonggol-Moryo-Tang on matrix metalloproteinase-2 and -9 activities and invasiveness potential of hepatocellular carcinoma. Pharmacol. Res. 2004, 50, 279–285. [Google Scholar] [CrossRef] [PubMed]
- Xie, W.D.; Nie, Y.; Du, L.J.; Zhang, Y.O.; Cai, G.P. Preventive effects of fenofibrate on insulin resistance, hyperglycaemia, visceral fat accumulation in NIH mice induced by small-dose streptozotocin and lard. Pharmacol. Res. 2007, 55, 392–399. [Google Scholar] [CrossRef] [PubMed]
- Wu, B. Expression and Clinical Significance of ADAM10 and p62 in Hepatocellular Carcinoma. Master’s Thesis, Jilin University, Jilin, China, 2018. (In Chinese). [Google Scholar]
- Brezgin, S.; Kostyusheva, A.; Kostyushev, D.; Chulanov, V. Dead cas systems: Types, principles, and applications. Int. J. Mol. Sci. 2019, 20, 6041. [Google Scholar] [CrossRef]
- Cidon, E.U. Systemic treatment of hepatocellular carcinoma: Past, present and future. World J. Hepatol. 2017, 9, 797–807. [Google Scholar] [CrossRef]
- Komatsu, M.; Waguri, S.; Koike, M.; Sou, Y.S.; Ueno, T.; Hara, T.; Mizushima, N.; Iwata, J.I.; Ezaki, J.; Murata, S.; et al. Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice. Cell 2007, 131, 1149–1163. [Google Scholar] [CrossRef]
- Thijssen, V.L.; Paulis, Y.W.; Sliwinska, P.N.; Deumelandt, K.L.; Hosaka, K.; Soetekouw, P.M.; Cimpean, A.M.; Raica, M.; Pauwels, P.; Oord, J.J.V.D.; et al. Targeting PDGF-mediated recruitment of pericytes blocks vascular mimicry and tumor growth. J. Pathol. 2018, 246, 447–458. [Google Scholar] [CrossRef] [PubMed]
- DeNicola, G.M.; Karreth, F.A.; Humpton, T.J.; Gopinathan, A.; Wei, C.; Frese, K.; Mangal, D.; Yu, K.H.; Yeo, C.J.; Calhoun, E.S.; et al. Oncogene-induced Nrf2 transcription promotes ROS detoxification and tumorigenesis. Nature 2011, 475, 106–109. [Google Scholar] [CrossRef] [PubMed]
- Kuźniak, V.K.; Paluszczak, J.; Dubowska, W.B. The Nrf2-ARE signaling pathway: An update on its regulation and possible role in cancer prevention and treatment. Pharmacol. Rep. 2017, 69, 393–402. [Google Scholar] [CrossRef]
- Kwiecien, I.; Stelmaszczyk-Emmel, A.; Polubiec-Kownacka, M.; Dziedzic, D.; Domagala-Kulawik, J. Elevated regulatory T cells, surface and intracellular CTLA-4 expression and interleukin-17 in the lung cancer microenvironment in humans. Cancer Immunol. Immunother. 2017, 66, 161–170. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.H.; Yu, C.W.; Lai, L.C.; Tsao, C.H.; Ho, K.T.; Yang, S.C.; Lee, H.; Cheng, Y.W.; Wu, T.C.; Shiau, M.Y. Up-regulation of interleukin-17 expression by human papillomavirus type 16 E6 in nonsmall cell lung cancer. Cancer 2010, 116, 4800–4809. [Google Scholar] [CrossRef]
- Wang, B.; Liu, T.; Wu, J.C.; Luo, S.Z.; Chen, R.; Lu, L.G.; Xu, M. STAT3 aggravates TGF-β1-induced hepatic epithelial-to-mesenchymal transition and migration. Biomed. Pharmacother. 2018, 98, 214–221. [Google Scholar] [CrossRef]
- Duff, D.; Long, A. Roles for RACK1 in cancer cell migration and invasion. Cell. Signal. 2017, 35, 250–255. [Google Scholar] [CrossRef]
- Brozovic, A.; Ambriović-Ristov, A.; Osmak, M. The relationship between cisplatin-induced reactive oxygen species, glutathione, and BCL-2 and resistance to cisplatin. Crit. Rev. Toxicol. 2010, 40, 347–359. [Google Scholar] [CrossRef] [PubMed]
- Desoize, B. Cancer and metals and metal compounds: Part I—carcinogenesis. Crit. Rev. Oncol. Hematol. 2002, 42, 1–3. [Google Scholar] [CrossRef] [PubMed]
- Clodfelter, J.E.; Gentry, M.B.; Drotschmann, K. MSH2 missense mutations alter cisplatin cytotoxicity and promote cisplatin-induced genome instability. Nucleic Acids Res. 2005, 33, 3323–3330. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.P.; Dong, X.; Lin, L.; Jiang, X.; Wei, Z.; Zhai, B.; Sun, B.; Zhang, Q.; Wan, X.; Jiang, H.; et al. Up-regulation of survivin by AKT and hypoxia-inducible factor 1a contributes to cisplatin resistance in gastric cancer. FEBS J. 2014, 281, 115–128. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, J.; Ding, Y.; Zhang, W.; Qi, Y.; Zhou, J.; Xu, N.; Zhang, Y.; Xie, W. SQSTM1/p62 Knockout by Using the CRISPR/Cas9 System Inhibits Migration and Invasion of Hepatocellular Carcinoma. Cells 2023, 12, 1238. https://doi.org/10.3390/cells12091238
Lu J, Ding Y, Zhang W, Qi Y, Zhou J, Xu N, Zhang Y, Xie W. SQSTM1/p62 Knockout by Using the CRISPR/Cas9 System Inhibits Migration and Invasion of Hepatocellular Carcinoma. Cells. 2023; 12(9):1238. https://doi.org/10.3390/cells12091238
Chicago/Turabian StyleLu, Jinghua, Yipei Ding, Wanqiu Zhang, Yuanyuan Qi, Jin Zhou, Naihan Xu, Yaou Zhang, and Weidong Xie. 2023. "SQSTM1/p62 Knockout by Using the CRISPR/Cas9 System Inhibits Migration and Invasion of Hepatocellular Carcinoma" Cells 12, no. 9: 1238. https://doi.org/10.3390/cells12091238
APA StyleLu, J., Ding, Y., Zhang, W., Qi, Y., Zhou, J., Xu, N., Zhang, Y., & Xie, W. (2023). SQSTM1/p62 Knockout by Using the CRISPR/Cas9 System Inhibits Migration and Invasion of Hepatocellular Carcinoma. Cells, 12(9), 1238. https://doi.org/10.3390/cells12091238