New SDS-Based Polyelectrolyte Multicore Nanocarriers for Paclitaxel Delivery—Synthesis, Characterization, and Activity against Breast Cancer Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of Polyelectrolyte Multicore Nanocarriers
2.3. Determination of Particle Size, Shape, and Zeta Potential
2.4. Stability Studies
2.5. Cells and Treatments
2.6. MTT Assay
2.7. ATP Measurements
2.8. Cell Morphology
2.9. CyQUANT® Direct Cell Proliferation Assay
2.10. Annexin V/PI Staining Assay
2.11. Measurement of Caspase 3/7 Activity
2.12. Mitochondrial Membrane Potential (ΔΨm)
2.13. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.14. Statistics
3. Results
3.1. Characterization of NCs
3.2. Cytotoxicity of SDS-Based Polyelectrolyte Nanocarriers without and with Drug
3.3. PTX-Loaded Nanocarriers Exert Antiproliferative Action towards Breast Cancer Cell Lines and Non-Cancerous Endothelial Cells
3.4. PTX Trapped in Polyelectrolyte Multicore Nanocarriers Possess Pro-Apoptotic Activity
3.5. Mitochondrial Homeostasis Is Altered by PTX-Loaded Multicore Polyelectrolyte Nanocarriers
4. Discussion
5. Conclusions
6. Patents
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Rubovszky, G.; Kocsis, J.; Boér, K.; Chilingirova, N.; Dank, M.; Kahán, Z.; Kaidarova, D.; Kövér, E.; Krakovská, B.V.; Máhr, K.; et al. Systemic Treatment of Breast Cancer. 1st Central-Eastern European Professional Consensus Statement on Breast Cancer. Pathol. Oncol. Res. 2022, 28, 1610383. [Google Scholar] [CrossRef] [PubMed]
- Nishi, M.; Wang, P.Y.; Hwang, P.M. Cardiotoxicity of Cancer Treatments: Focus on Anthracycline Cardiomyopathy. Arterioscler. Thromb. Vasc. Biol. 2021, 41, 2648–2660. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Gullotti, E.; Tong, L.; Highley, C.B.; Errabelli, D.R.; Hasan, T.; Cheng, J.X.; Kohane, D.S.; Yeo, Y. Intracellular drug delivery by poly(lactic-co-glycolic acid) nanoparticles, revisited. Mol. Pharm. 2009, 6, 190–201. [Google Scholar] [CrossRef]
- Deng, F.; Ghemtio, L.; Grazhdankin, E.; Wipf, P.; Xhaard, H.; Kidron, H. Binding Site Interactions of Modulators of Breast Cancer Resistance Protein, Multidrug Resistance-Associated Protein 2, and P-Glycoprotein Activity. Mol. Pharm. 2020, 17, 2398–2410. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Zhang, H.; Wanyan, Y.; Liu, K.; Lv, T.; Li, M.; Chen, Y. Effect of Hydrophobicity on the Anticancer Activity of Fatty-Acyl-Conjugated CM4 in Breast Cancer Cells. ACS Omega 2020, 5, 21513–21523. [Google Scholar] [CrossRef]
- Rasool, M.; Malik, A.; Waquar, S.; Arooj, M.; Zahid, S.; Asif, M.; Shaheen, S.; Hussain, A.; Ullah, H.; Gan, S.H. New challenges in the use of nanomedicine in cancer therapy. Bioengineered 2022, 13, 759–773. [Google Scholar] [CrossRef]
- van der Meel, R.; Sulheim, E.; Shi, Y.; Kiessling, F.; Mulder, W.J.M.; Lammers, T. Smart cancer nanomedicine. Nat. Nanotechnol. 2019, 14, 1007–1017. [Google Scholar] [CrossRef] [PubMed]
- Blanco, E.; Shen, H.; Ferrari, M. Principles of nanoparticle design for overcoming biological barriers to drug delivery. Nat. Biotechnol. 2015, 33, 941–951. [Google Scholar] [CrossRef]
- Jordan, M.A.; Wilson, L. Microtubules as a target for anticancer drugs. Nat. Rev. Cancer 2004, 4, 253–265. [Google Scholar] [CrossRef]
- Hu, J.; Fu, S.; Peng, Q.; Han, Y.; Xie, J.; Zan, N.; Chen, Y.; Fan, J. Paclitaxel-loaded polymeric nanoparticles combined with chronomodulated chemotherapy on lung cancer: In vitro and in vivo evaluation. Int. J. Pharm. 2017, 516, 313–322. [Google Scholar] [CrossRef] [PubMed]
- Abu Samaan, T.M.; Samec, M.; Liskova, A.; Kubatka, P.; Büsselberg, D. Paclitaxel’s Mechanistic and Clinical Effects on Breast Cancer. Biomolecules 2019, 9, 789. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Heidrich, F.M.; DeGray, B.; Boehmerle, W.; Ehrlich, B.E. Paclitaxel accelerates spontaneous calcium oscillations in cardiomyocytes by interacting with NCS-1 and the InsP3R. J. Mol. Cell. Cardiol. 2010, 49, 829–835. [Google Scholar] [CrossRef] [PubMed]
- Torchilin, V.P. Multifunctional, stimuli-sensitive nanoparticulate systems for drug delivery. Nat. Rev. Drug Discov. 2014, 13, 813–827. [Google Scholar] [CrossRef]
- Shi, J.; Kantoff, P.W.; Wooster, R.; Farokhzad, O.C. Cancer nanomedicine: Progress, challenges and opportunities. Nat. Rev. Cancer 2017, 17, 20–37. [Google Scholar] [CrossRef]
- Björnmalm, M.; Thurecht, K.J.; Michael, M.; Scott, A.M.; Caruso, F. Bridging Bio-Nano Science and Cancer Nanomedicine. ACS Nano 2017, 11, 9594–9613. [Google Scholar] [CrossRef]
- Theek, B.; Baues, M.; Gremse, F.; Pola, R.; Pechar, M.; Negwer, I.; Koynov, K.; Weber, B.; Barz, M.; Jahnen-Dechent, W.; et al. Histidine-rich glycoprotein-induced vascular normalization improves EPR-mediated drug targeting to and into tumors. J. Control. Release 2018, 282, 25–34. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, W.; Wang, Y.; Zhu, J.; Zhou, M.; Peng, C.; He, Z.; Sun, J.; Li, Z.; Gui, S. Emerging nanotaxanes for cancer therapy. Biomaterials 2021, 272, 120790. [Google Scholar] [CrossRef]
- Parhi, P.; Mohanty, C.; Sahoo, S.K. Nanotechnology-based combinational drug delivery: An emerging approach for cancer therapy. Drug Discov. Today 2012, 17, 1044–1052. [Google Scholar] [CrossRef]
- Sukhorukov, G.B.; Donath, E.; Lichtenfeld, H.; Knippel, E.; Knippel, M.; Budde, A.; Möhwald, H. Layer-by-layer self assembly of polyelectrolytes on colloidal particles. Colloids Surf. A Physicochem. Eng. Asp. 1998, 137, 253–266. [Google Scholar] [CrossRef]
- Voigt, A.; Lichtenfeld, H.; Sukhorukov, G.B.; Zastrow, H.; Donath, E.; Bäumler, H.; Möhwald, H. Membrane Filtration for Microencapsulation and Microcapsules Fabrication by Layer-by-Layer Polyelectrolyte Adsorption. Ind. Eng. Chem. Res. 1999, 38, 4037–4043. [Google Scholar] [CrossRef]
- Borodina, T.N.; Rumsh, L.D.; Kunizhev, S.M.; Sukhorukov, G.B.; Vorozhtsov, G.N.; Fel’dman, B.M.; Markvicheva, E.A. Polyelectrolyte microcapsules as systems for delivery of biologically active substances. Biomed. Khim. 2007, 53, 557–565. [Google Scholar] [PubMed]
- Hashemi, M.; Omidi, M.; Muralidharan, B.; Tayebi, L.; Herpin, M.J.; Mohagheghi, M.A.; Mohammadi, J.; Smyth, H.D.C.; Milner, T.E. Layer-by-layer assembly of graphene oxide on thermosensitive liposomes for photo-chemotherapy. Acta Biomater. 2018, 65, 376–392. [Google Scholar] [CrossRef]
- Zhang, X.; Liang, T.; Ma, Q. Layer-by-Layer assembled nano-drug delivery systems for cancer treatment. Drug Deliv. 2021, 28, 655–669. [Google Scholar] [CrossRef]
- Szafraniec, J.; Janik, M.; Odrobińska, J.; Zapotoczny, S. Nanocapsules templated on liquid cores stabilized by graft amphiphilic polyelectrolytes. Nanoscale 2015, 7, 5525–5536. [Google Scholar] [CrossRef]
- Ślusarczyk, J.; Piotrowski, M.; Szczepanowicz, K.; Regulska, M.; Leśkiewicz, M.; Warszyński, P.; Budziszewska, B.; Lasoń, W.; Basta-Kaim, A. Nanocapsules with Polyelectrolyte Shell as a Platform for 1,25-dihydroxyvitamin D3 Neuroprotection: Study in Organotypic Hippocampal Slices. Neurotox. Res. 2016, 30, 581–592. [Google Scholar] [CrossRef]
- Szczepanowicz, K.; Hoel, H.J.; Szyk-Warszynska, L.; Bielańska, E.; Bouzga, A.M.; Gaudernack, G.; Simon, C.; Warszynski, P. Formation of biocompatible nanocapsules with emulsion core and pegylated shell by polyelectrolyte multilayer adsorption. Langmuir 2010, 26, 12592–12597. [Google Scholar] [CrossRef] [PubMed]
- Szwed, M.; Wrona, D.; Kania, K.D.; Koceva-Chyla, A.; Marczak, A. Doxorubicin-transferrin conjugate triggers pro-oxidative disorders in solid tumor cells. Toxicol. In Vitro 2016, 31, 60–71. [Google Scholar] [CrossRef]
- Szwed, M.; Torgersen, M.L.; Kumari, R.V.; Yadava, S.K.; Pust, S.; Iversen, T.G.; Skotland, T.; Giri, J.; Sandvig, K. Biological response and cytotoxicity induced by lipid nanocapsules. J. Nanobiotechnol. 2020, 18, 5. [Google Scholar] [CrossRef]
- Szwed, M.; Laroche-Clary, A.; Robert, J.; Jozwiak, Z. Induction of apoptosis by doxorubicin-transferrin conjugate compared to free doxorubicin in the human leukemia cell lines. Chem. Biol. Interact. 2014, 220, 140–148. [Google Scholar] [CrossRef]
- Nawara, H.M.; Afify, S.M.; Hassan, G.; Zahra, M.H.; Seno, A.; Seno, M. Paclitaxel-Based Chemotherapy Targeting Cancer Stem Cells from Mono- to Combination Therapy. Biomedicines 2021, 9, 500. [Google Scholar] [CrossRef] [PubMed]
- Szwed, M.; Laroche-Clary, A.; Robert, J.; Jozwiak, Z. Efficacy of doxorubicin-transferrin conjugate in apoptosis induction in human leukemia cells through reactive oxygen species generation. Cell. Oncol. 2016, 39, 107–118. [Google Scholar] [CrossRef]
- Jänicke, R.U. MCF-7 breast carcinoma cells do not express caspase-3. Breast Cancer Res. Treat. 2009, 117, 219–221. [Google Scholar] [CrossRef] [PubMed]
- Grancara, S.; Ohkubo, S.; Artico, M.; Ciccariello, M.; Manente, S.; Bragadin, M.; Toninello, A.; Agostinelli, E. Milestones and recent discoveries on cell death mediated by mitochondria and their interactions with biologically active amines. Amino Acids 2016, 48, 2313–2326. [Google Scholar] [CrossRef] [PubMed]
- Stowe, D.F.; Camara, A.K. Mitochondrial reactive oxygen species production in excitable cells: Modulators of mitochondrial and cell function. Antioxid. Redox Signal. 2009, 11, 1373–1414. [Google Scholar] [CrossRef]
- Louage, B.; De Wever, O.; Hennink, W.E.; De Geest, B.G. Developments and future clinical outlook of taxane nanomedicines. J. Control. Release 2017, 253, 137–152. [Google Scholar] [CrossRef]
- Karabasz, A.; Bzowska, M.; Łukasiewicz, S.; Bereta, J.; Szczepanowicz, K. Cytotoxic activity of paclitaxel incorporated into polyelectrolyte nanocapsules. J. Nanopart. Res. 2014, 16, 2340. [Google Scholar] [CrossRef]
- Łukasiewicz, S.; Szczepanowicz, K. In vitro interaction of polyelectrolyte nanocapsules with model cells. Langmuir 2014, 30, 1100–1107. [Google Scholar] [CrossRef]
- Christensen, S.B. Drugs That Changed Society: Microtubule-Targeting Agents Belonging to Taxanoids, Macrolides and Non-Ribosomal Peptides. Molecules 2022, 27, 5648. [Google Scholar] [CrossRef]
- Perez, E.A.; Buckwalter, C.A. Sequence-dependent cytotoxicity of etoposide and paclitaxel in human breast and lung cancer cell lines. Cancer Chemother. Pharmacol. 1998, 41, 448–452. [Google Scholar] [CrossRef]
- Giannakakou, P.; Robey, R.; Fojo, T.; Blagosklonny, M.V. Low concentrations of paclitaxel induce cell type-dependent p53, p21 and G1/G2 arrest instead of mitotic arrest: Molecular determinants of paclitaxel-induced cytotoxicity. Oncogene 2001, 20, 3806–3813. [Google Scholar] [CrossRef] [PubMed]
- Abotaleb, M.; Kubatka, P.; Caprnda, M.; Varghese, E.; Zolakova, B.; Zubor, P.; Opatrilova, R.; Kruzliak, P.; Stefanicka, P.; Büsselberg, D. Chemotherapeutic agents for the treatment of metastatic breast cancer: An update. Biomed. Pharmacother. 2018, 101, 458–477. [Google Scholar] [CrossRef] [PubMed]
- Trivedi, R.; Kompella, U.B. Nanomicellar formulations for sustained drug delivery: Strategies and underlying principles. Nanomedicine 2010, 5, 485–505. [Google Scholar] [CrossRef] [PubMed]
- Iversen, T.-G.; Skotland, T.; Sandvig, K. Endocytosis and intracellular transport of nanoparticles: Present knowledge and need for future studies. Nano Today 2011, 6, 176–185. [Google Scholar] [CrossRef]
- Sandvig, K.; Kavaliauskiene, S.; Skotland, T. Clathrin-independent endocytosis: An increasing degree of complexity. Histochem. Cell Biol. 2018, 150, 107–118. [Google Scholar] [CrossRef]
- Valsalakumari, R.; Yadava, S.K.; Szwed, M.; Pandya, A.D.; Mælandsmo, G.M.; Torgersen, M.L.; Iversen, T.G.; Skotland, T.; Sandvig, K.; Giri, J. Mechanism of cellular uptake and cytotoxicity of paclitaxel loaded lipid nanocapsules in breast cancer cells. Int. J. Pharm. 2021, 597, 120217. [Google Scholar] [CrossRef]
- Rafiyath, S.M.; Rasul, M.; Lee, B.; Wei, G.; Lamba, G.; Liu, D. Comparison of safety and toxicity of liposomal doxorubicin vs. conventional anthracyclines: A meta-analysis. Exp. Hematol. Oncol. 2012, 1, 10. [Google Scholar] [CrossRef]
- Fukuda, A.; Tahara, K.; Hane, Y.; Matsui, T.; Sasaoka, S.; Hatahira, H.; Motooka, Y.; Hasegawa, S.; Naganuma, M.; Abe, J.; et al. Comparison of the adverse event profiles of conventional and liposomal formulations of doxorubicin using the FDA adverse event reporting system. PLoS ONE 2017, 12, e0185654. [Google Scholar] [CrossRef]
- Perugini, V.; Schmid, R.; Mørch, Ý.; Texier, I.; Brodde, M.; Santin, M. A multistep in vitro hemocompatibility testing protocol recapitulating the foreign body reaction to nanocarriers. Drug Deliv. Transl. Res. 2022, 12, 2089–2100. [Google Scholar] [CrossRef]
- Ernst, L.M.; Casals, E.; Italiani, P.; Boraschi, D.; Puntes, V. The Interactions between Nanoparticles and the Innate Immune System from a Nanotechnologist Perspective. Nanomaterials 2021, 11, 2991. [Google Scholar] [CrossRef]
- Wigner, P.; Zielinski, K.; Labieniec-Watala, M.; Marczak, A.; Szwed, M. Doxorubicin-transferrin conjugate alters mitochondrial homeostasis and energy metabolism in human breast cancer cells. Sci. Rep. 2021, 11, 4544. [Google Scholar] [CrossRef]
- Sukhanova, A.; Bozrova, S.; Sokolov, P.; Berestovoy, M.; Karaulov, A.; Nabiev, I. Dependence of Nanoparticle Toxicity on Their Physical and Chemical Properties. Nanoscale Res. Lett. 2018, 13, 44. [Google Scholar] [CrossRef]
- Wang, Q.; Zhu, Y.; Song, B.; Fu, R.; Zhou, Y. The In Vivo Toxicity Assessments of Water-Dispersed Fluorescent Silicon Nanoparticles in Caenorhabditis elegans. Int. J. Environ. Res. Public Health 2022, 19, 4101. [Google Scholar] [CrossRef] [PubMed]
- Ren, X.; Zhao, B.; Chang, H.; Xiao, M.; Wu, Y.; Liu, Y. Paclitaxel suppresses proliferation and induces apoptosis through regulation of ROS and the AKT/MAPK signaling pathway in canine mammary gland tumor cells. Mol. Med. Rep. 2018, 17, 8289–8299. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Wang, B.; Gao, J.; Zhang, Y.; Xu, W.; Tao, L. Spinosad induces programmed cell death involves mitochondrial dysfunction and cytochrome C release in Spodoptera frugiperda Sf9 cells. Chemosphere 2017, 169, 155–161. [Google Scholar] [CrossRef] [PubMed]
- Faria, R.S.; de Lima, L.I.; Bonadio, R.S.; Longo, J.P.F.; Roque, M.C.; de Matos Neto, J.N.; Moya, S.E.; de Oliveira, M.C.; Azevedo, R.B. Liposomal paclitaxel induces apoptosis, cell death, inhibition of migration capacity and antitumoral activity in ovarian cancer. Biomed. Pharmacother. 2021, 142, 112000. [Google Scholar] [CrossRef]
- Tran, B.N.; Nguyen, H.T.; Kim, J.O.; Yong, C.S.; Nguyen, C.N. Developing combination of artesunate with paclitaxel loaded into poly-d,l-lactic-co-glycolic acid nanoparticle for systemic delivery to exhibit synergic chemotherapeutic response. Drug Dev. Ind. Pharm. 2017, 43, 1952–1962. [Google Scholar] [CrossRef]









| Gene | Strand | Sequence 5′-> 3′ |
|---|---|---|
| Hypoxanthine-guanine phosphoribosyltransferase (HPRT1) | Forward Reverse | TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT |
| Bcl2-like protein 4 (Bax) | Forward Reverse | GTTTCATCCAGGATCGAGCAG CATCTTCTTCCAGATGGTGA |
| Apoptosis induction factor (AIF) | Forward Reverse | AGACGATCCCAAATAATGCAG TAGCTCTAGGTGATCTTGG |
| Caspase -3 (casp-3) | Forward Reverse | AGGCCCCTGGATACTCTTACACAG TCAGTGTATCCTCTCCCCAGATG |
| Cytochrome c (Cyt c) | Forward Reverse | AGGCCCCTGGATACTCTTACACAG TCAGTGTATCCTCTCCCCAGATG |
| Abbreviation | The Range of Size | Zeta Potential | Nanocarrier Concentration | PTX Concentration |
|---|---|---|---|---|
| SDS/PLL | 70–90 nm | +43 mV | 1 × 108 nanoparticles/mL | - |
| SDS/PLL/PGA | 90–110 nm | −33 mV | 1 × 108 nanoparticles/mL | - |
| SDS/PLL/PTX | 70–90 nm | +49 mV | 1 × 108 nanoparticles/mL | 2.07 mg/L |
| SDS/PLL/PGA/PTX | 90–10 nm | −32 mV | 1 × 108 nanoparticles/mL | 1.85 mg/L |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szwed, M.; Michlewska, S.; Kania, K.; Szczęch, M.; Marczak, A.; Szczepanowicz, K. New SDS-Based Polyelectrolyte Multicore Nanocarriers for Paclitaxel Delivery—Synthesis, Characterization, and Activity against Breast Cancer Cells. Cells 2023, 12, 2052. https://doi.org/10.3390/cells12162052
Szwed M, Michlewska S, Kania K, Szczęch M, Marczak A, Szczepanowicz K. New SDS-Based Polyelectrolyte Multicore Nanocarriers for Paclitaxel Delivery—Synthesis, Characterization, and Activity against Breast Cancer Cells. Cells. 2023; 12(16):2052. https://doi.org/10.3390/cells12162052
Chicago/Turabian StyleSzwed, Marzena, Sylwia Michlewska, Katarzyna Kania, Marta Szczęch, Agnieszka Marczak, and Krzysztof Szczepanowicz. 2023. "New SDS-Based Polyelectrolyte Multicore Nanocarriers for Paclitaxel Delivery—Synthesis, Characterization, and Activity against Breast Cancer Cells" Cells 12, no. 16: 2052. https://doi.org/10.3390/cells12162052
APA StyleSzwed, M., Michlewska, S., Kania, K., Szczęch, M., Marczak, A., & Szczepanowicz, K. (2023). New SDS-Based Polyelectrolyte Multicore Nanocarriers for Paclitaxel Delivery—Synthesis, Characterization, and Activity against Breast Cancer Cells. Cells, 12(16), 2052. https://doi.org/10.3390/cells12162052

