MAGI1 Prevents Senescence and Promotes the DNA Damage Response in ER+ Breast Cancer
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Design of MAGI1 KO CRISPR Constructs and LV Production
2.3. RNA Sequencing, Data Processing, and Enrichment Analysis
2.4. Chemicals and Reagents
2.5. Antibodies
2.6. Cell Treatments
2.7. Senescence-Associated β-Galactosidase Staining of Cultured Cells
2.8. Cell Viability (MTT Assay)
2.9. Real-Time Reverse Transcription PCR (RT-qPCR)
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
| MAGI1 | TTCAAGGCCGTCAGACAA | ATGGGGGTAAAGGTTATCCC |
| GAPDH | GGACCTGACCTGCCGTCTAG | CCACCACCCTGTTGCTGTAG |
| P21 | GATTCGGGATATGCTGTTGG | GTTCTGAGCTGGCACAGTGA |
| P27 | GGTTAGCGGAGCAATGCG | TCCACAGAACCGGCATTTG |
| E2F1 | GGGGAGAAGTCACGCTATGA | CTCAGGGCACAGGAAAACAT |
| YWHAZ | ACTTTTGGTACATTGTGGCTTCAA | CCGCCAGGACAAACCAGTAT |
2.10. Western Blotting
2.11. Comet Assay
2.12. Transcriptomic Analysis of Human Patient’s Data
2.13. Bioinformatic Analysis of Predicted Histone Acetylation Sites and HDAC2 Binding Partners Motifs along the MAGI1 Promoter Region
3. Results
3.1. Transcriptome Analyses Revealed Biological Processes and Pathways Related to Estrogen and mTOR Signaling, Cell Cycle, DNA Damage Checkpoints, and DNA Damage Response Being Altered in MCF7 MAGI1 KO Cells
3.2. Combined TNF-α/IFN-γ Treatment Promotes a Deep Quiescence/Senescence Phenotype in MCF7 MAGI1 KO Cells and Activates the PI3K/AKT and MAPK Signaling Pathways
3.3. MCF7 MAGI1 KO Cells Fail to Activate DNA Repair Proteins, Accumulate DNA Damage, and Induce the PI3K/AKT Pathway after Exposure to Ionizing Radiation (IR)
3.4. Transcriptome Analyses of Human Patients Shows a Correlation between Low MAGI1 Levels and Increased Tumor Mutational Burden (TMB), Homologous Recombination Deficiency (HRD), and AKT/MAPK Signaling
3.5. MCF7 MAG1 KO Cells Are More Sensitive to the Combination of Cisplatin and Pharmacological Inhibition of PARP1
3.6. The PI3K Inhibitor Alpelisib Sensitizes MCF7 MAGI1 KO Cells to Fulvestrant
3.7. Pharmacological and Genomic Evidence for Transcriptional Regulation of MAGI1 Expression by HDACs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Giaquinto, A.N.; Sung, H.; Miller, K.D.; Kramer, J.L.; Newman, L.A.; Minihan, A.; Jemal, A.; Siegel, R.L. Breast Cancer Statistics, 2022. CA Cancer J. Clin. 2022, 72, 524–541. [Google Scholar] [CrossRef] [PubMed]
- Scabia, V.; Ayyanan, A.; De Martino, F.; Agnoletto, A.; Battista, L.; Laszlo, C.; Treboux, A.; Zaman, K.; Stravodimou, A.; Jallut, D.; et al. Estrogen receptor positive breast cancers have patient specific hormone sensitivities and rely on progesterone receptor. Nat. Commun. 2022, 13, 3127. [Google Scholar] [CrossRef] [PubMed]
- Szostakowska, M.; Trebinska-Stryjewska, A.; Grzybowska, E.A.; Fabisiewicz, A. Resistance to endocrine therapy in breast cancer: Molecular mechanisms and future goals. Breast Cancer Res. Treat. 2019, 173, 489–497. [Google Scholar] [CrossRef] [PubMed]
- Kaklamani, V.G.; Richardson, A.L.; Arteaga, C.L. Exploring Biomarkers of Phosphoinositide 3-Kinase Pathway Activation in the Treatment of Hormone Receptor Positive, Human Epidermal Growth Receptor 2 Negative Advanced Breast Cancer. Oncologist 2019, 24, 305–312. [Google Scholar] [CrossRef]
- Kuilman, T.; Michaloglou, C.; Mooi, W.J.; Peeper, D.S. The essence of senescence. Genes Dev. 2010, 24, 2463–2479. [Google Scholar] [CrossRef]
- Coller, H.A.; Sang, L.; Roberts, J.M. A new description of cellular quiescence. PLoS Biol. 2006, 4, e83. [Google Scholar] [CrossRef]
- Santos-de-Frutos, K.; Djouder, N. When dormancy fuels tumour relapse. Commun. Biol. 2021, 4, 747. [Google Scholar] [CrossRef]
- Kumari, R.; Jat, P. Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype. Front. Cell Dev. Biol. 2021, 9, 645593. [Google Scholar] [CrossRef]
- Chatterjee, N.; Walker, G.C. Mechanisms of DNA damage, repair, and mutagenesis. Environ. Mol. Mutagen. 2017, 58, 235–263. [Google Scholar] [CrossRef] [PubMed]
- Mills, K.D.; Ferguson, D.O.; Alt, F.W. The role of DNA breaks in genomic instability and tumorigenesis. Immunol. Rev. 2003, 194, 77–95. [Google Scholar] [CrossRef]
- Van Gent, D.C.; Kanaar, R. Exploiting DNA repair defects for novel cancer therapies. Mol. Biol. Cell 2016, 27, 2145–2148. [Google Scholar] [CrossRef] [PubMed]
- Asati, V.; Mahapatra, D.K.; Bharti, S.K. PI3K/Akt/mTOR and Ras/Raf/MEK/ERK signaling pathways inhibitors as anticancer agents: Structural and pharmacological perspectives. Eur. J. Med. Chem. 2016, 109, 314–341. [Google Scholar] [CrossRef] [PubMed]
- Gan, W.; Liu, P.; Wei, W. Akt promotes tumorigenesis in part through modulating genomic instability via phosphorylating XLF. Nucleus 2015, 6, 261–265. [Google Scholar] [CrossRef] [PubMed]
- Helleday, T. The underlying mechanism for the PARP and BRCA synthetic lethality: Clearing up the misunderstandings. Mol. Oncol. 2011, 5, 387–393. [Google Scholar] [CrossRef]
- Menezes, M.C.S.; Raheem, F.; Mina, L.; Ernst, B.; Batalini, F. PARP Inhibitors for Breast Cancer: Germline BRCA1/2 and beyond. Cancers 2022, 14, 4332. [Google Scholar] [CrossRef]
- Worthmuller, J.; Ruegg, C. MAGI1, a Scaffold Protein with Tumor Suppressive and Vascular Functions. Cells 2021, 10, 1494. [Google Scholar] [CrossRef]
- Lu, Y.; Sun, W.; Zhang, L.; Li, J. Silencing of MAGI1 Promotes The Proliferation And Inhibits Apoptosis of Glioma Cells via the Wnt/beta-Catenin and PTEN/AKT Signaling Pathways. OncoTargets Ther. 2019, 12, 9639–9650. [Google Scholar] [CrossRef]
- Li, Z.Y.; Li, X.H.; Tian, G.W.; Zhang, D.Y.; Gao, H.; Wang, Z.Y. MAGI1 Inhibits the Proliferation, Migration and Invasion of Glioma Cells. OncoTargets Ther. 2019, 12, 11281–11290. [Google Scholar] [CrossRef]
- Zaric, J.; Joseph, J.M.; Tercier, S.; Sengstag, T.; Ponsonnet, L.; Delorenzi, M.; Ruegg, C. Identification of MAGI1 as a tumor-suppressor protein induced by cyclooxygenase-2 inhibitors in colorectal cancer cells. Oncogene 2012, 31, 48–59. [Google Scholar] [CrossRef]
- Alday-Parejo, B.; Richard, F.; Worthmuller, J.; Rau, T.; Galvan, J.A.; Desmedt, C.; Santamaria-Martinez, A.; Ruegg, C. MAGI1, a New Potential Tumor Suppressor Gene in Estrogen Receptor Positive Breast Cancer. Cancers 2020, 12, 223. [Google Scholar] [CrossRef]
- Kantar, D.; Mur, E.B.; Mancini, M.; Slaninova, V.; Salah, Y.B.; Costa, L.; Forest, E.; Lassus, P.; Geminard, C.; Boissiere-Michot, F.; et al. MAGI1 inhibits the AMOTL2/p38 stress pathway and prevents luminal breast tumorigenesis. Sci. Rep. 2021, 11, 5752. [Google Scholar] [CrossRef]
- Jia, S.; Lu, J.; Qu, T.; Feng, Y.; Wang, X.; Liu, C.; Ji, J. MAGI1 inhibits migration and invasion via blocking MAPK/ERK signaling pathway in gastric cancer. Chin. J. Cancer Res. 2017, 29, 25–35. [Google Scholar] [CrossRef]
- Joung, J.; Konermann, S.; Gootenberg, J.S.; Abudayyeh, O.O.; Platt, R.J.; Brigham, M.D.; Sanjana, N.E.; Zhang, F. Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat. Protoc. 2017, 12, 828–863. [Google Scholar] [CrossRef] [PubMed]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastq_screen/ (accessed on 18 June 2021).
- Davis, M.P.; van Dongen, S.; Abreu-Goodger, C.; Bartonicek, N.; Enright, A.J. Kraken: A set of tools for quality control and analysis of high-throughput sequence data. Methods 2013, 63, 41–49. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Wang, L.; Wang, S.; Li, W. RSeQC: Quality control of RNA-seq experiments. Bioinformatics 2012, 28, 2184–2185. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Law, C.W.; Alhamdoosh, M.; Su, S.; Dong, X.; Tian, L.; Smyth, G.K.; Ritchie, M.E. RNA-seq analysis is easy as 1-2-3 with limma, Glimma and edgeR. F1000Res 2016, 5, 1408. [Google Scholar] [CrossRef]
- Johnson, W.E.; Li, C.; Rabinovic, A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics 2007, 8, 118–127. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef]
- Yu, D.; Danku, J.M.; Baxter, I.; Kim, S.; Vatamaniuk, O.K.; Vitek, O.; Ouzzani, M.; Salt, D.E. High-resolution genome-wide scan of genes, gene-networks and cellular systems impacting the yeast ionome. BMC Genom. 2012, 13, 623. [Google Scholar] [CrossRef] [PubMed]
- Gyori, B.M.; Venkatachalam, G.; Thiagarajan, P.S.; Hsu, D.; Clement, M.V. OpenComet: An automated tool for comet assay image analysis. Redox Biol. 2014, 2, 457–465. [Google Scholar] [CrossRef] [PubMed]
- Nik-Zainal, S.; Davies, H.; Staaf, J.; Ramakrishna, M.; Glodzik, D.; Zou, X.; Martincorena, I.; Alexandrov, L.B.; Martin, S.; Wedge, D.C.; et al. Landscape of somatic mutations in 560 breast cancer whole-genome sequences. Nature 2016, 534, 47–54. [Google Scholar] [CrossRef]
- Ciriello, G.; Gatza, M.L.; Beck, A.H.; Wilkerson, M.D.; Rhie, S.K.; Pastore, A.; Zhang, H.; McLellan, M.; Yau, C.; Kandoth, C.; et al. Comprehensive Molecular Portraits of Invasive Lobular Breast Cancer. Cell 2015, 163, 506–519. [Google Scholar] [CrossRef]
- Stoica, G.E.; Franke, T.F.; Moroni, M.; Mueller, S.; Morgan, E.; Iann, M.C.; Winder, A.D.; Reiter, R.; Wellstein, A.; Martin, M.B.; et al. Effect of estradiol on estrogen receptor-alpha gene expression and activity can be modulated by the ErbB2/PI 3-K/Akt pathway. Oncogene 2003, 22, 7998–8011. [Google Scholar] [CrossRef]
- Desmedt, C.; Haibe-Kains, B.; Wirapati, P.; Buyse, M.; Larsimont, D.; Bontempi, G.; Delorenzi, M.; Piccart, M.; Sotiriou, C. Biological processes associated with breast cancer clinical outcome depend on the molecular subtypes. Clin. Cancer Res. 2008, 14, 5158–5165. [Google Scholar] [CrossRef]
- Creighton, C.J. A gene transcription signature of the Akt/mTOR pathway in clinical breast tumors. Oncogene 2007, 26, 4648–4655. [Google Scholar] [CrossRef]
- Majumder, P.K.; Febbo, P.G.; Bikoff, R.; Berger, R.; Xue, Q.; McMahon, L.M.; Manola, J.; Brugarolas, J.; McDonnell, T.J.; Golub, T.R.; et al. mTOR inhibition reverses Akt-dependent prostate intraepithelial neoplasia through regulation of apoptotic and HIF-1-dependent pathways. Nat. Med. 2004, 10, 594–601. [Google Scholar] [CrossRef] [PubMed]
- Loi, S.; Haibe-Kains, B.; Majjaj, S.; Lallemand, F.; Durbecq, V.; Larsimont, D.; Gonzalez-Angulo, A.M.; Pusztai, L.; Symmans, W.F.; Bardelli, A.; et al. PIK3CA mutations associated with gene signature of low mTORC1 signaling and better outcomes in estrogen receptor-positive breast cancer. Proc. Natl. Acad. Sci. USA 2010, 107, 10208–10213. [Google Scholar] [CrossRef]
- Saal, L.H.; Johansson, P.; Holm, K.; Gruvberger-Saal, S.K.; She, Q.B.; Maurer, M.; Koujak, S.; Ferrando, A.A.; Malmstrom, P.; Memeo, L.; et al. Poor prognosis in carcinoma is associated with a gene expression signature of aberrant PTEN tumor suppressor pathway activity. Proc. Natl. Acad. Sci. USA 2007, 104, 7564–7569. [Google Scholar] [CrossRef] [PubMed]
- Bild, A.H.; Yao, G.; Chang, J.T.; Wang, Q.; Potti, A.; Chasse, D.; Joshi, M.B.; Harpole, D.; Lancaster, J.M.; Berchuck, A.; et al. Oncogenic pathway signatures in human cancers as a guide to targeted therapies. Nature 2006, 439, 353–357. [Google Scholar] [CrossRef] [PubMed]
- Creighton, C.J.; Hilger, A.M.; Murthy, S.; Rae, J.M.; Chinnaiyan, A.M.; El-Ashry, D. Activation of mitogen-activated protein kinase in estrogen receptor alpha-positive breast cancer cells in vitro induces an in vivo molecular phenotype of estrogen receptor alpha-negative human breast tumors. Cancer Res. 2006, 66, 3903–3911. [Google Scholar] [CrossRef]
- Dry, J.R.; Pavey, S.; Pratilas, C.A.; Harbron, C.; Runswick, S.; Hodgson, D.; Chresta, C.; McCormack, R.; Byrne, N.; Cockerill, M.; et al. Transcriptional pathway signatures predict MEK addiction and response to selumetinib (AZD6244). Cancer Res. 2010, 70, 2264–2273. [Google Scholar] [CrossRef]
- Chang, H.Y.; Sneddon, J.B.; Alizadeh, A.A.; Sood, R.; West, R.B.; Montgomery, K.; Chi, J.T.; van de Rijn, M.; Botstein, D.; Brown, P.O. Gene expression signature of fibroblast serum response predicts human cancer progression: Similarities between tumors and wounds. PLoS Biol. 2004, 2, E7. [Google Scholar] [CrossRef]
- Ignatiadis, M.; Singhal, S.K.; Desmedt, C.; Haibe-Kains, B.; Criscitiello, C.; Andre, F.; Loi, S.; Piccart, M.; Michiels, S.; Sotiriou, C. Gene modules and response to neoadjuvant chemotherapy in breast cancer subtypes: A pooled analysis. J. Clin. Oncol. 2012, 30, 1996–2004. [Google Scholar] [CrossRef]
- Grant, C.E.; Bailey, T.L.; Noble, W.S. FIMO: Scanning for occurrences of a given motif. Bioinformatics 2011, 27, 1017–1018. [Google Scholar] [CrossRef] [PubMed]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
- Kulakovskiy, I.V.; Vorontsov, I.E.; Yevshin, I.S.; Sharipov, R.N.; Fedorova, A.D.; Rumynskiy, E.I.; Medvedeva, Y.A.; Magana-Mora, A.; Bajic, V.B.; Papatsenko, D.A.; et al. HOCOMOCO: Towards a complete collection of transcription factor binding models for human and mouse via large-scale ChIP-Seq analysis. Nucleic Acids Res. 2018, 46, D252–D259. [Google Scholar] [CrossRef] [PubMed]
- Merlo, L.M.; Shah, N.A.; Li, X.; Blount, P.L.; Vaughan, T.L.; Reid, B.J.; Maley, C.C. A comprehensive survey of clonal diversity measures in Barrett’s esophagus as biomarkers of progression to esophageal adenocarcinoma. Cancer Prev. Res. 2010, 3, 1388–1397. [Google Scholar] [CrossRef] [PubMed]
- Olive, J.F.; Qin, Y.; DeCristo, M.J.; Laszewski, T.; Greathouse, F.; McAllister, S.S. Accounting for tumor heterogeneity when using CRISPR-Cas9 for cancer progression and drug sensitivity studies. PLoS ONE 2018, 13, e0198790. [Google Scholar] [CrossRef] [PubMed]
- Boettcher, M.; Covarrubias, S.; Biton, A.; Blau, J.; Wang, H.; Zaitlen, N.; McManus, M.T. Tracing cellular heterogeneity in pooled genetic screens via multi-level barcoding. BMC Genom. 2019, 20, 107. [Google Scholar] [CrossRef]
- Denechaud, P.D.; Fajas, L.; Giralt, A. E2F1, a Novel Regulator of Metabolism. Front. Endocrinol. 2017, 8, 311. [Google Scholar] [CrossRef]
- Yoshida, K.; Miki, Y. Role of BRCA1 and BRCA2 as regulators of DNA repair, transcription, and cell cycle in response to DNA damage. Cancer Sci. 2004, 95, 866–871. [Google Scholar] [CrossRef]
- Gomis, R.R.; Gawrzak, S. Tumor cell dormancy. Mol. Oncol. 2017, 11, 62–78. [Google Scholar] [CrossRef]
- Cuddihy, A.R.; O’Connell, M.J. Cell-cycle responses to DNA damage in G2. Int. Rev. Cytol. 2003, 222, 99–140. [Google Scholar] [CrossRef]
- Braumuller, H.; Wieder, T.; Brenner, E.; Assmann, S.; Hahn, M.; Alkhaled, M.; Schilbach, K.; Essmann, F.; Kneilling, M.; Griessinger, C.; et al. T-helper-1-cell cytokines drive cancer into senescence. Nature 2013, 494, 361–365. [Google Scholar] [CrossRef]
- Rosemblit, C.; Datta, J.; Lowenfeld, L.; Xu, S.; Basu, A.; Kodumudi, K.; Wiener, D.; Czerniecki, B.J. Oncodriver inhibition and CD4(+) Th1 cytokines cooperate through Stat1 activation to induce tumor senescence and apoptosis in HER2+ and triple negative breast cancer: Implications for combining immune and targeted therapies. Oncotarget 2018, 9, 23058–23077. [Google Scholar] [CrossRef]
- Harper, J.W.; Adami, G.R.; Wei, N.; Keyomarsi, K.; Elledge, S.J. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993, 75, 805–816. [Google Scholar] [CrossRef] [PubMed]
- Dimri, G.P.; Lee, X.; Basile, G.; Acosta, M.; Scott, G.; Roskelley, C.; Medrano, E.E.; Linskens, M.; Rubelj, I.; Pereira-Smith, O.; et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. USA 1995, 92, 9363–9367. [Google Scholar] [CrossRef] [PubMed]
- Kwon, J.S.; Everetts, N.J.; Wang, X.; Wang, W.; Della Croce, K.; Xing, J.; Yao, G. Controlling Depth of Cellular Quiescence by an Rb-E2F Network Switch. Cell Rep. 2017, 20, 3223–3235. [Google Scholar] [CrossRef]
- Johnson, D.G.; Schwarz, J.K.; Cress, W.D.; Nevins, J.R. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature 1993, 365, 349–352. [Google Scholar] [CrossRef]
- Soto-Gamez, A.; Quax, W.J.; Demaria, M. Regulation of Survival Networks in Senescent Cells: From Mechanisms to Interventions. J. Mol. Biol. 2019, 431, 2629–2643. [Google Scholar] [CrossRef]
- Chen, Z.; Trotman, L.C.; Shaffer, D.; Lin, H.K.; Dotan, Z.A.; Niki, M.; Koutcher, J.A.; Scher, H.I.; Ludwig, T.; Gerald, W.; et al. Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature 2005, 436, 725–730. [Google Scholar] [CrossRef] [PubMed]
- Kotelevets, L.; van Hengel, J.; Bruyneel, E.; Mareel, M.; van Roy, F.; Chastre, E. Implication of the MAGI-1b/PTEN signalosome in stabilization of adherens junctions and suppression of invasiveness. FASEB J. 2005, 19, 115–117. [Google Scholar] [CrossRef]
- Collin, G.; Huna, A.; Warnier, M.; Flaman, J.M.; Bernard, D. Transcriptional repression of DNA repair genes is a hallmark and a cause of cellular senescence. Cell Death Dis. 2018, 9, 259. [Google Scholar] [CrossRef]
- Chu, G. Double strand break repair. J. Biol. Chem. 1997, 272, 24097–24100. [Google Scholar] [CrossRef]
- Podhorecka, M.; Skladanowski, A.; Bozko, P. H2AX Phosphorylation: Its Role in DNA Damage Response and Cancer Therapy. J. Nucleic Acids 2010, 2010, 920161. [Google Scholar] [CrossRef]
- Zhou, B.B.; Elledge, S.J. The DNA damage response: Putting checkpoints in perspective. Nature 2000, 408, 433–439. [Google Scholar] [CrossRef] [PubMed]
- Falck, J.; Coates, J.; Jackson, S.P. Conserved modes of recruitment of ATM, ATR and DNA-PKcs to sites of DNA damage. Nature 2005, 434, 605–611. [Google Scholar] [CrossRef] [PubMed]
- Bowden, R.D.; Buckwalter, M.R.; McBride, J.F.; Johnson, D.A.; Murray, B.K.; O’Neill, K.L. Tail profile: A more accurate system for analyzing DNA damage using the Comet assay. Mutat. Res. 2003, 537, 1–9. [Google Scholar] [CrossRef]
- Costa, J.P.T.S. Comet Assay in Encyclopedia of Toxicology, 3rd ed.; Elsevier: Amsterdam, The Netherlands, 2014; pp. 1020–1023. [Google Scholar]
- Lu, Y.; Liu, Y.; Yang, C. Evaluating In Vitro DNA Damage Using Comet Assay. J. Vis. Exp. 2017, 128, e56450. [Google Scholar] [CrossRef]
- Kumaravel, T.S.; Vilhar, B.; Faux, S.P.; Jha, A.N. Comet Assay measurements: A perspective. Cell Biol. Toxicol. 2009, 25, 53–64. [Google Scholar] [CrossRef]
- Plo, I.; Laulier, C.; Gauthier, L.; Lebrun, F.; Calvo, F.; Lopez, B.S. AKT1 inhibits homologous recombination by inducing cytoplasmic retention of BRCA1 and RAD51. Cancer Res. 2008, 68, 9404–9412. [Google Scholar] [CrossRef]
- Piscitello, D.; Varshney, D.; Lilla, S.; Vizioli, M.G.; Reid, C.; Gorbunova, V.; Seluanov, A.; Gillespie, D.A.; Adams, P.D. AKT overactivation can suppress DNA repair via p70S6 kinase-dependent downregulation of MRE11. Oncogene 2018, 37, 427–438. [Google Scholar] [CrossRef]
- De Zio, D.; Cianfanelli, V.; Cecconi, F. New insights into the link between DNA damage and apoptosis. Antioxid. Redox Signal. 2013, 19, 559–571. [Google Scholar] [CrossRef] [PubMed]
- Mangogna, A.; Munari, G.; Pepe, F.; Maffii, E.; Giampaolino, P.; Ricci, G.; Fassan, M.; Malapelle, U.; Biffi, S. Homologous Recombination Deficiency in Ovarian Cancer: From the Biological Rationale to Current Diagnostic Approaches. J. Pers. Med. 2023, 13, 284. [Google Scholar] [CrossRef]
- Bernstein, C.R.A.; Nfonsam, V.; Bernstei, H. DNA Damage, DNA Repair and Cancer. In New Research Directions in DNA Repair; InTech: Rijeka, Croatia, 2013. [Google Scholar]
- Hansson, J. Inherited defects in DNA repair and susceptibility to DNA-damaging agents. Toxicol. Lett. 1992, 64–65, 141–148. [Google Scholar] [CrossRef]
- Javle, M.; Curtin, N.J. The potential for poly (ADP-ribose) polymerase inhibitors in cancer therapy. Ther. Adv. Med. Oncol. 2011, 3, 257–267. [Google Scholar] [CrossRef] [PubMed]
- Dasari, S.; Tchounwou, P.B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharmacol. 2014, 740, 364–378. [Google Scholar] [CrossRef] [PubMed]
- Yde, C.W.; Issinger, O.G. Enhancing cisplatin sensitivity in MCF-7 human breast cancer cells by down-regulation of Bcl-2 and cyclin D1. Int. J. Oncol. 2006, 29, 1397–1404. [Google Scholar] [CrossRef]
- Foucquier, J.; Guedj, M. Analysis of drug combinations: Current methodological landscape. Pharmacol. Res. Perspect. 2015, 3, e00149. [Google Scholar] [CrossRef] [PubMed]
- Jannetti, S.A.; Zeglis, B.M.; Zalutsky, M.R.; Reiner, T. Poly(ADP-Ribose)Polymerase (PARP) Inhibitors and Radiation Therapy. Front. Pharmacol. 2020, 11, 170. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Turner, K.M.; Alfred Yung, W.K.; Chen, K.; Zhang, W. Role of AKT signaling in DNA repair and clinical response to cancer therapy. Neuro Oncol. 2014, 16, 1313–1323. [Google Scholar] [CrossRef]
- Hafsi, S.; Pezzino, F.M.; Candido, S.; Ligresti, G.; Spandidos, D.A.; Soua, Z.; McCubrey, J.A.; Travali, S.; Libra, M. Gene alterations in the PI3K/PTEN/AKT pathway as a mechanism of drug-resistance (review). Int. J. Oncol. 2012, 40, 639–644. [Google Scholar] [CrossRef]
- Fritsch, C.; Huang, A.; Chatenay-Rivauday, C.; Schnell, C.; Reddy, A.; Liu, M.; Kauffmann, A.; Guthy, D.; Erdmann, D.; De Pover, A.; et al. Characterization of the novel and specific PI3Kalpha inhibitor NVP-BYL719 and development of the patient stratification strategy for clinical trials. Mol. Cancer Ther. 2014, 13, 1117–1129. [Google Scholar] [CrossRef]
- Xu, N.; Hegarat, N.; Black, E.J.; Scott, M.T.; Hochegger, H.; Gillespie, D.A. Akt/PKB suppresses DNA damage processing and checkpoint activation in late G2. J. Cell Biol. 2010, 190, 297–305. [Google Scholar] [CrossRef]
- Dufour, M.; Dormond-Meuwly, A.; Pythoud, C.; Demartines, N.; Dormond, O. Reactivation of AKT signaling following treatment of cancer cells with PI3K inhibitors attenuates their antitumor effects. Biochem. Biophys. Res. Commun. 2013, 438, 32–37. [Google Scholar] [CrossRef]
- Efeyan, A.; Sabatini, D.M. mTOR and cancer: Many loops in one pathway. Curr. Opin. Cell Biol. 2010, 22, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Chiappinelli, K.B.; Zahnow, C.A.; Ahuja, N.; Baylin, S.B. Combining Epigenetic and Immunotherapy to Combat Cancer. Cancer Res. 2016, 76, 1683–1689. [Google Scholar] [CrossRef]
- Dong, Q.; Sharma, S.; Liu, H.; Chen, L.; Gu, B.; Sun, X.; Wang, G. HDAC inhibitors reverse acquired radio resistance of KYSE-150R esophageal carcinoma cells by modulating Bmi-1 expression. Toxicol. Lett. 2014, 224, 121–129. [Google Scholar] [CrossRef]
- Lai, C.J.; Bao, R.; Tao, X.; Wang, J.; Atoyan, R.; Qu, H.; Wang, D.G.; Yin, L.; Samson, M.; Forrester, J.; et al. CUDC-101, a multitargeted inhibitor of histone deacetylase, epidermal growth factor receptor, and human epidermal growth factor receptor 2, exerts potent anticancer activity. Cancer Res. 2010, 70, 3647–3656. [Google Scholar] [CrossRef] [PubMed]
- Flotho, C.; Claus, R.; Batz, C.; Schneider, M.; Sandrock, I.; Ihde, S.; Plass, C.; Niemeyer, C.M.; Lubbert, M. The DNA methyltransferase inhibitors azacitidine, decitabine and zebularine exert differential effects on cancer gene expression in acute myeloid leukemia cells. Leukemia 2009, 23, 1019–1028. [Google Scholar] [CrossRef] [PubMed]
- Billam, M.; Sobolewski, M.D.; Davidson, N.E. Effects of a novel DNA methyltransferase inhibitor zebularine on human breast cancer cells. Breast Cancer Res. Treat. 2010, 120, 581–592. [Google Scholar] [CrossRef]
- Wei, W.; Liu, X.; Chen, J.; Gao, S.; Lu, L.; Zhang, H.; Ding, G.; Wang, Z.; Chen, Z.; Shi, T.; et al. Class I histone deacetylases are major histone decrotonylases: Evidence for critical and broad function of histone crotonylation in transcription. Cell Res. 2017, 27, 898–915. [Google Scholar] [CrossRef]
- Spruijt, C.G.; Grawe, C.; Kleinendorst, S.C.; Baltissen, M.P.A.; Vermeulen, M. Cross-linking mass spectrometry reveals the structural topology of peripheral NuRD subunits relative to the core complex. FEBS J. 2021, 288, 3231–3245. [Google Scholar] [CrossRef]
- Le Guezennec, X.; Vermeulen, M.; Brinkman, A.B.; Hoeijmakers, W.A.; Cohen, A.; Lasonder, E.; Stunnenberg, H.G. MBD2/NuRD and MBD3/NuRD, two distinct complexes with different biochemical and functional properties. Mol. Cell Biol. 2006, 26, 843–851. [Google Scholar] [CrossRef]
- Sun, J.M.; Chen, H.Y.; Moniwa, M.; Litchfield, D.W.; Seto, E.; Davie, J.R. The transcriptional repressor Sp3 is associated with CK2-phosphorylated histone deacetylase 2. J. Biol. Chem. 2002, 277, 35783–35786. [Google Scholar] [CrossRef]
- Tian, B.; Liu, J.; Liu, B.; Dong, Y.; Liu, J.; Song, Y.; Sun, Z. p53 Suppresses lung resistance-related protein expression through Y-box binding protein 1 in the MCF-7 breast tumor cell line. J. Cell Physiol. 2011, 226, 3433–3441. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.M.; Chen, H.Y.; Davie, J.R. Differential distribution of unmodified and phosphorylated histone deacetylase 2 in chromatin. J. Biol. Chem. 2007, 282, 33227–33236. [Google Scholar] [CrossRef]
- Consortium, E.P.; Moore, J.E.; Purcaro, M.J.; Pratt, H.E.; Epstein, C.B.; Shoresh, N.; Adrian, J.; Kawli, T.; Davis, C.A.; Dobin, A.; et al. Expanded encyclopaedias of DNA elements in the human and mouse genomes. Nature 2020, 583, 699–710. [Google Scholar] [CrossRef] [PubMed]
- Consortium, E.P. An integrated encyclopedia of DNA elements in the human genome. Nature 2012, 489, 57–74. [Google Scholar] [CrossRef] [PubMed]
- Campisi, J. Senescent cells, tumor suppression, and organismal aging: Good citizens, bad neighbors. Cell 2005, 120, 513–522. [Google Scholar] [CrossRef]
- Yang, J.; Liu, M.; Hong, D.; Zeng, M.; Zhang, X. The Paradoxical Role of Cellular Senescence in Cancer. Front. Cell Dev. Biol. 2021, 9, 722205. [Google Scholar] [CrossRef]
- Fujimaki, K.; Li, R.; Chen, H.; Della Croce, K.; Zhang, H.H.; Xing, J.; Bai, F.; Yao, G. Graded regulation of cellular quiescence depth between proliferation and senescence by a lysosomal dimmer switch. Proc. Natl. Acad. Sci. USA 2019, 116, 22624–22634. [Google Scholar] [CrossRef]
- Nogueira, V.; Park, Y.; Chen, C.C.; Xu, P.Z.; Chen, M.L.; Tonic, I.; Unterman, T.; Hay, N. Akt determines replicative senescence and oxidative or oncogenic premature senescence and sensitizes cells to oxidative apoptosis. Cancer Cell 2008, 14, 458–470. [Google Scholar] [CrossRef]
- Astle, M.V.; Hannan, K.M.; Ng, P.Y.; Lee, R.S.; George, A.J.; Hsu, A.K.; Haupt, Y.; Hannan, R.D.; Pearson, R.B. AKT induces senescence in human cells via mTORC1 and p53 in the absence of DNA damage: Implications for targeting mTOR during malignancy. Oncogene 2012, 31, 1949–1962. [Google Scholar] [CrossRef]
- Anerillas, C.; Abdelmohsen, K.; Gorospe, M. Regulation of senescence traits by MAPKs. Geroscience 2020, 42, 397–408. [Google Scholar] [CrossRef]
- Jung, S.H.; Hwang, H.J.; Kang, D.; Park, H.A.; Lee, H.C.; Jeong, D.; Lee, K.; Park, H.J.; Ko, Y.G.; Lee, J.S. mTOR kinase leads to PTEN-loss-induced cellular senescence by phosphorylating p53. Oncogene 2019, 38, 1639–1650. [Google Scholar] [CrossRef] [PubMed]
- Guillon, J.; Petit, C.; Toutain, B.; Guette, C.; Lelievre, E.; Coqueret, O. Chemotherapy-induced senescence, an adaptive mechanism driving resistance and tumor heterogeneity. Cell Cycle 2019, 18, 2385–2397. [Google Scholar] [CrossRef] [PubMed]
- Aguirre-Ghiso, J.A. Models, mechanisms and clinical evidence for cancer dormancy. Nat. Rev. Cancer 2007, 7, 834–846. [Google Scholar] [CrossRef] [PubMed]
- Kirkland, J.L.; Tchkonia, T. Senolytic drugs: From discovery to translation. J. Intern. Med. 2020, 288, 518–536. [Google Scholar] [CrossRef]
- Oshi, M.; Takahashi, H.; Tokumaru, Y.; Yan, L.; Rashid, O.M.; Matsuyama, R.; Endo, I.; Takabe, K. G2M Cell Cycle Pathway Score as a Prognostic Biomarker of Metastasis in Estrogen Receptor (ER)-Positive Breast Cancer. Int. J. Mol. Sci. 2020, 21, 2921. [Google Scholar] [CrossRef]
- Oshi, M.; Takahashi, H.; Tokumaru, Y.; Yan, L.; Rashid, O.M.; Nagahashi, M.; Matsuyama, R.; Endo, I.; Takabe, K. The E2F Pathway Score as a Predictive Biomarker of Response to Neoadjuvant Therapy in ER+/HER2- Breast Cancer. Cells 2020, 9, 1643. [Google Scholar] [CrossRef]
- Xu, J.; Chen, Y.; Olopade, O.I. MYC and Breast Cancer. Genes Cancer 2010, 1, 629–640. [Google Scholar] [CrossRef]
- Gray, M.; Turnbull, A.K.; Ward, C.; Meehan, J.; Martinez-Perez, C.; Bonello, M.; Pang, L.Y.; Langdon, S.P.; Kunkler, I.H.; Murray, A.; et al. Development and characterisation of acquired radioresistant breast cancer cell lines. Radiat. Oncol. 2019, 14, 64. [Google Scholar] [CrossRef]
- Miller, C.A.; Gindin, Y.; Lu, C.; Griffith, O.L.; Griffith, M.; Shen, D.; Hoog, J.; Li, T.; Larson, D.E.; Watson, M.; et al. Aromatase inhibition remodels the clonal architecture of estrogen-receptor-positive breast cancers. Nat. Commun. 2016, 7, 12498. [Google Scholar] [CrossRef]
- Anurag, M.; Punturi, N.; Hoog, J.; Bainbridge, M.N.; Ellis, M.J.; Haricharan, S. Comprehensive Profiling of DNA Repair Defects in Breast Cancer Identifies a Novel Class of Endocrine Therapy Resistance Drivers. Clin. Cancer Res. 2018, 24, 4887–4899. [Google Scholar] [CrossRef]
- Lin, X.; Kong, D.; Chen, Z.S. Editorial: Chemo-Radiation-Resistance in Cancer Therapy. Front. Pharmacol. 2022, 13, 904063. [Google Scholar] [CrossRef] [PubMed]
- Cortesi, L.; Rugo, H.S.; Jackisch, C. An Overview of PARP Inhibitors for the Treatment of Breast Cancer. Target. Oncol. 2021, 16, 255–282. [Google Scholar] [CrossRef] [PubMed]
- Tsang, E.S.; Csizmok, V.; Williamson, L.M.; Pleasance, E.; Topham, J.T.; Karasinska, J.M.; Titmuss, E.; Schrader, I.; Yip, S.; Tessier-Cloutier, B.; et al. Homologous recombination deficiency signatures in gastrointestinal and thoracic cancers correlate with platinum therapy duration. NPJ Precis. Oncol. 2023, 7, 31. [Google Scholar] [CrossRef] [PubMed]
- Cui, S.; Feng, J.; Tang, X.; Lou, S.; Guo, W.; Xiao, X.; Li, S.; Chen, X.; Huan, Y.; Zhou, Y.; et al. The prognostic value of tumor mutation burden (TMB) and its relationship with immune infiltration in breast cancer patients. Eur. J. Med. Res. 2023, 28, 90. [Google Scholar] [CrossRef]
- Guerrero-Zotano, A.; Mayer, I.A.; Arteaga, C.L. PI3K/AKT/mTOR: Role in breast cancer progression, drug resistance, and treatment. Cancer Metastasis Rev. 2016, 35, 515–524. [Google Scholar] [CrossRef]
- Kandel, E.S.; Skeen, J.; Majewski, N.; Di Cristofano, A.; Pandolfi, P.P.; Feliciano, C.S.; Gartel, A.; Hay, N. Activation of Akt/protein kinase B overcomes a G(2)/m cell cycle checkpoint induced by DNA damage. Mol. Cell Biol. 2002, 22, 7831–7841. [Google Scholar] [CrossRef]
- Huang, T.T.; Lampert, E.J.; Coots, C.; Lee, J.M. Targeting the PI3K pathway and DNA damage response as a therapeutic strategy in ovarian cancer. Cancer Treat. Rev. 2020, 86, 102021. [Google Scholar] [CrossRef]
- Qin, H.; Liu, L.; Sun, S.; Zhang, D.; Sheng, J.; Li, B.; Yang, W. The impact of PI3K inhibitors on breast cancer cell and its tumor microenvironment. PeerJ 2018, 6, e5092. [Google Scholar] [CrossRef]
- Andre, F.; Ciruelos, E.; Rubovszky, G.; Campone, M.; Loibl, S.; Rugo, H.S.; Iwata, H.; Conte, P.; Mayer, I.A.; Kaufman, B.; et al. Alpelisib for PIK3CA-Mutated, Hormone Receptor-Positive Advanced Breast Cancer. N. Engl. J. Med. 2019, 380, 1929–1940. [Google Scholar] [CrossRef]
- Clark, A.S.; West, K.; Streicher, S.; Dennis, P.A. Constitutive and inducible Akt activity promotes resistance to chemotherapy, trastuzumab, or tamoxifen in breast cancer cells. Mol. Cancer Ther. 2002, 1, 707–717. [Google Scholar]
- Wu, X.; Xu, Y.; Liang, Q.; Yang, X.; Huang, J.; Wang, J.; Zhang, H.; Shi, J. Recent Advances in Dual PI3K/mTOR Inhibitors for Tumour Treatment. Front. Pharmacol. 2022, 13, 875372. [Google Scholar] [CrossRef] [PubMed]
- Britten, C.D. PI3K and MEK inhibitor combinations: Examining the evidence in selected tumor types. Cancer Chemother. Pharmacol. 2013, 71, 1395–1409. [Google Scholar] [CrossRef] [PubMed]
- Eckschlager, T.; Plch, J.; Stiborova, M.; Hrabeta, J. Histone Deacetylase Inhibitors as Anticancer Drugs. Int. J. Mol. Sci. 2017, 18, 1414. [Google Scholar] [CrossRef] [PubMed]
- Bordin, M.; D’Atri, F.; Guillemot, L.; Citi, S. Histone deacetylase inhibitors up-regulate the expression of tight junction proteins. Mol. Cancer Res. 2004, 2, 692–701. [Google Scholar] [CrossRef] [PubMed]
- Milczarek, M. The Premature Senescence in Breast Cancer Treatment Strategy. Cancers 2020, 12, 1815. [Google Scholar] [CrossRef]






Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wörthmüller, J.; Disler, S.; Pradervand, S.; Richard, F.; Haerri, L.; Ruiz Buendía, G.A.; Fournier, N.; Desmedt, C.; Rüegg, C. MAGI1 Prevents Senescence and Promotes the DNA Damage Response in ER+ Breast Cancer. Cells 2023, 12, 1929. https://doi.org/10.3390/cells12151929
Wörthmüller J, Disler S, Pradervand S, Richard F, Haerri L, Ruiz Buendía GA, Fournier N, Desmedt C, Rüegg C. MAGI1 Prevents Senescence and Promotes the DNA Damage Response in ER+ Breast Cancer. Cells. 2023; 12(15):1929. https://doi.org/10.3390/cells12151929
Chicago/Turabian StyleWörthmüller, Janine, Simona Disler, Sylvain Pradervand, François Richard, Lisa Haerri, Gustavo A. Ruiz Buendía, Nadine Fournier, Christine Desmedt, and Curzio Rüegg. 2023. "MAGI1 Prevents Senescence and Promotes the DNA Damage Response in ER+ Breast Cancer" Cells 12, no. 15: 1929. https://doi.org/10.3390/cells12151929
APA StyleWörthmüller, J., Disler, S., Pradervand, S., Richard, F., Haerri, L., Ruiz Buendía, G. A., Fournier, N., Desmedt, C., & Rüegg, C. (2023). MAGI1 Prevents Senescence and Promotes the DNA Damage Response in ER+ Breast Cancer. Cells, 12(15), 1929. https://doi.org/10.3390/cells12151929

