Next Article in Journal
Blockage of Autophagy Increases Timosaponin AIII-Induced Apoptosis of Glioma Cells In Vitro and In Vivo
Previous Article in Journal
Platelet Aggregation, Mitochondrial Function and Morphology in Cold Storage: Impact of Resveratrol and Cytochrome c Supplementation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1

1
Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, College of Animal Science and Technology, Shandong Agricultural University, Tai’an 271018, China
2
School of Medicine, Huanghe Science and Technology College, Zhengzhou 450063, China
3
Department of Immunology, School of Basic Medical Sciences, Fudan University, Shanghai 200032, China
*
Author to whom correspondence should be addressed.
These authors contribute equally to this work.
Cells 2023, 12(1), 167; https://doi.org/10.3390/cells12010167
Submission received: 29 November 2022 / Revised: 21 December 2022 / Accepted: 27 December 2022 / Published: 30 December 2022

Abstract

Intramuscular fat (IMF) content plays a key role in improving the flavor and palatability of pork. The IMF content varies between species, breeds, and individuals of the same breed. Hence, it is necessary to elucidate the mechanisms of IMF deposition to improve pork quality. Herein, the IMF content in the longissimus dorsi muscles of 29 Laiwu pigs was detected and divided into two groups, the H group (IMF > 12%) and the L group (IMF < 5%). RNA sequencing analysis showed 24 differentially expressed (DE) miRNA, and GO and KEGG analysis demonstrated that the DE miRNAs were significantly enriched in lipid metabolic process, lipid storage, Wnt, mTOR, and PPAR signaling pathways. miR-34a was found to be increased in the H group and 3T3-L1-derived adipocytes, while Lef1 was decreased. Luciferase reporter assays demonstrated that Lef1 was a potential target of miR-34a. Mechanism analysis revealed that miR-34a could increase lipid droplet deposition in 3T3-L1 and C2C12 cells by dampening the suppressive function of Lef1 on the transcription of adipogenic markers (i.e., Pparg, Cebpa, Fabp4, and Plin1). Moreover, overexpression of miR-34a could enhance the lipid deposition in the co-culture system of 3T3-L1 and C2C12 cells as well as in C2C12 cells cultured with conditioned medium from the progress of adipocyte differentiation. Taken together, our study indicated that miR-34a was an important positive modulator in the regulation of fatty metabolism and fat deposition by inhibiting the suppressive function of Lef1. These results might provide insight for the exploration of potential strategies to promote intramuscular fat deposition in livestock.

1. Introduction

Intramuscular fat (IMF) is an essential index of pork quality evaluation, such as tenderness, juiciness, and flavor level [1]. Many factors affect the IMF content of pork, including breed, nutrition, and environment, which ultimately regulate fat deposition by increasing adipocyte proliferation and hypertrophy [2,3]. IMF deposition occurs both inside (intramyocellular) and outside (extramyocellular) the muscle fibers, including the lipid droplets in myoblasts and adipocytes. This biological process is complex and particular. Therefore, the mechanism of IMF accumulation remains a mystery. Evidence has shown that myoblasts can be induced to adipocyte differentiation by means of transcriptional and nutritional factors [4]. Daidzein promotes FAs-induced fat deposition through G-protein-coupled receptor 30 (GPR30) signaling in C2C12 myoblast cells [5]. miR-324-5p inhibits C2C12 myoblast differentiation and promotes lipid deposition in myotubes by targeting long non-coding Dum (lncDum) and peptidase M20 domain containing 1 ang(Pm20d1), respectively [6]. Therefore, the interaction between myoblasts and adipocytes should not be ignored in the process of exploring the mechanisms of IMF deposition. The more interesting finding is that lipid accumulation is heterogeneous within the same cell population [7]. A hypothesis could be established that some specific genes may cause differentiation in lipid droplet deposition in myoblasts or adipocytes.
microRNAs (miRNAs) are a class of endogenous single-stranded highly conserved noncoding RNAs (ncRNAs) with a length of 1822 nt. The seed sequence of miRNAs is the second to eighth nucleotide starting from the 5′ end, which is an important structure for miRNAs to target mRNAs [8]. In addition, similarity in seed sequence is the basis for miRNA family differentiation [9]. The specific sequence of the 3′-untranslated region (3′UTR) of the target gene is complementary to the miRNA seed sequence and binds to the Argonaute (AGO) protein-silencing complex through guidance to inhibit the translation process of the target gene [10]. Therefore, these previous studies demonstrated that most miRNAs interact with mRNAs in a negative correlation at the post-transcriptional level. Further research on miRNA found that the interaction between miRNAs and mRNAs is not static and changeless but rather involves dynamic and ordered biological processes [11]. The evidence shows that miRNAs are also regulated by a changed cellular environment, and this process also depends on mRNA translation [11,12]. In 2007, it was first reported that miR-369 regulated target mRNAs in two ways, depending on whether the cell medium contained serum [13].
Studies have shown that miRNAs are involved in regulating various biological processes associated with IMF deposition, including adipocyte proliferation and differentiation and lipid metabolism [14,15,16,17]. For instance, miR-375 overexpression can promote 3T3-L1 cell differentiation by reducing the ERK1/2 level and increasing the expression of Ppar, Cebpa, Fabp4, and triglycerides [14]. This miRNA also can promote Pparg and Cebpa levels by targeting bone morphogenetic protein receptor type 2 (BMPR2) expression to regulate the differentiation process of pork-derived adipocytes [15]. miR-16-5p has also been shown to promote 3T3-L1 cell differentiation through regulating ethanolamine phosphotransferase 1 (EPT1) [16]. In addition, evidence has shown that miRNAs can regulate lipid droplet accumulation in myoblasts. Myostatin can inhibit the expression of glucocorticoid receptor (GR) by activating miR-124-3p and thus regulates IMF deposition [17]. Overexpression of miR-324-5p significantly promoted oleate-induced lipid accumulation and β-oxidation in C2C12 myoblasts by targeting Pm20d1 [6]. It can be inferred from this evidence that miRNAs play an essential role in regulating fat deposition, especially IMF accumulation.
Lymphocyte enhancer factor-1 (Lef1) is a member of the Lef1/T-cell factor (TCF) family and has no transcriptional activation potential by itself, but it can act as an architectural protein in the assembly of multiprotein enhancer complexes [18]. Lef1 could mediate a nuclear response to the canonical Wnt signaling pathway by interacting with β-catenin to regulate adipogenesis [19]. Among the numerous target genes of miR-34a, Sirtuin 1 (SIRT1) is the most studied to explore the function of miR-34a [20]. Downregulation of miR-34a potentially contributes to altered lipid metabolism in nonalcoholic fatty liver disease (NAFLD) by regulating its targets, PPARα and SIRT1 [21]. However, the relationship between miR-34a and Lef1 and the function of these two genes in IMF deposition remain unclear.
The Laiwu pig is an excellent North Chinese breed of pig with a high IMF content. However, it was discovered in pork production that the IMF content varies widely between individual Laiwu pigs [22,23], which has so far been ignored in exploring the mechanisms of IMF deposition. In this study, the results of whole transcriptome sequencing showed that miR-34a and Lef1 are associated with IMF deposition. Additionally, miR-34a promoted lipid droplet accumulation in 3T3-L1 and C2C12 cells by targeting Lef1 to regulate IMF deposition, which might result in the difference in IMF content among individual Laiwu pigs.

2. Materials and Methods

2.1. Animal Experiments

Twenty-nine 300-day-old male (approximately 96 ± 4 kg) Laiwu pigs, reared at the Laiwu pig breeding farm in Jinan, Shandong Province, China, were fed a commercial pig diet and water ad libitum. Longissimus dorsi (LD) muscle samples from the last rib were obtained immediately after exsanguination and then stored in liquid nitrogen. The samples were stored at −80 °C for RNA and protein analysis. The IMF contents, grouping, and sample selection criteria for the sample groups for whole transcriptome sequencing have been reported in our previous study [23]. In brief, the IMF contents of LD muscle samples from the 29 Laiwu pigs were determined. Then, eight half-sibs of Laiwu pigs were selected and divided into two groups: the high IMF content group (IMF > 12%, in terms of H) and the low IMF content group (IMF < 5%, in terms of L), respectively, according to the IMF content and genetic relationship. The IMF contents in group H are 12.45%, 13.93%, 13.27%, and 13.38%, while the IMF contents in L group are 4.23%, 4.29%, 4.31% and 3.23%. The H group had significantly higher IMF content than the L group (p < 0.05). Oil Red O staining was performed and demonstrated the high content of IMF in the H group compared with that in the L group in the previous study, which was reported in our previous study [23]. In addition, three samples (1 × 1 × 1 cm) form heart, liver, spleen, lung, kidney, and subcutaneous fat were collected and immediately snap-frozen in liquid nitrogen. All samples were stored at −80 °C before RNA analysis.

2.2. RNA Isolation, Library Preparation, and Sequencing Analysis

Total RNA was isolated from eight LD muscle samples using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s recommendations. The RNA purity, concentration, and integrity were measured using the NanoPhotometer® spectrophotometer (IMPLEN, Carlsbad, CA, USA), Qubit® RNA Assay Kit in Qubit® 2.0 Flurometer (Life Technologies, Carlsbad, CA, USA), and the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, Carlsbad, CA, USA). A total of 3 μg of total RNA per sample was used as the input material for the small RNA library. Sequencing libraries were generated using NEBNext® Multiplex Small RNA Library Prep Set for Illumina® (NEB, Beverley, MA, USA) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample. Raw sequence data were submitted to the NCBI Sequence Read Archive under accession number PRJNA769962.
The library preparations were sequenced on an Illumina Hiseq 2500/2000 platform and 50 bp Data analysis (Novogene Gene Regulation Department). Raw data (raw reads) in fastq format were first processed through custom Perl and Python scripts. At the same time, Q20, Q30, and GC content of the raw data were calculated. The small RNA tags were mapped to the reference sequence by Bowtie [24] without mismatch to analyze their expression and distribution on the reference. Mapped small RNA tags were used to look for known miRNA. miRNA expression levels were estimated in transcripts per million (TPM), and differentially expressed miRNAs (DE miRNAs) was determined with Padj ≤ 0.05, and |Log2 FC| ≥ 0.

2.3. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analyses

GO enrichment analysis was used on the target gene candidates of DEMs, “target gene candidates”, in the following. GOseq-based Wallenius non-central hypergeometric distribution [25], which could adjust for gene length bias, was implemented for GO enrichment analysis. KEGG [26] is a database resource for understanding high-level functions and utilities of biological systems, such as the cell, the organism, and the ecosystem, from molecular-level information, especially large-scale molecular datasets generated by genome sequencing and other high-throughput experimental technologies (http://www.genome.jp/kegg/, accessed on 1 October 2020). We used KOBAS [27] software to test the statistical enrichment of the target gene candidates in KEGG pathways.

2.4. Gene and Protein Expression Analyses

microRNAs were isolated using the miRcute miRNA isolation kit (DP501, Tiangen Biotech, Beijing, China). Levels of miR-34a were determined by qPCR (FP411, Tiangen Biotech, Beijing, China). Total RNA was isolated with TRIzol and determined by qPCR (AG11701, Accurate Biotechnology, Hunan, China). Primer sequences are available in Table 1. All experiments were conducted at least three times. Relative gene expression was calculated by the 2−ΔΔ Cq method using β-actin and U6 as the housekeeping genes. For Western blot, total protein was extracted using radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Shanghai, China). A total of 20 μg of protein was separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes (Solarbio, Beijing, China). Membranes were then incubated overnight with primary antibodies as follows: anti-LEF1 (1:1000, ab137872, Abcam, Cambridge, MA, USA), anti-C/EBPα (1:1000, ab40764, Abcam, Cambridge, MA, USA), anti-PPARγ (1:1000, ab272718, Abcam, Cambridge, MA, USA), anti-β-catenin (1:1000, ab32572, Abcam, USA), and GAPDH (1:1000, AF0006, Beyotime, Shanghai, China). All antibodies were diluted using Western dilution buffer (P0023, AF0006, Beyotime, Shanghai, China). The next day, the membranes were washed three times with Tris-buffered saline containing Tween 20 (TBST). Then, the membranes were incubated with a goat anti-rabbit IgG (1:1000, A0208, Beyotime, Shanghai, China), or goat anti-mouse IgG (1:1000, A0216, Beyotime, Shanghai, China) for 1 h at 4 °C with shaking. Finally, the protein bands were visualized through an enhanced chemiluminescence (ECL) reagents (Beyotime, China), and the band intensities were quantified using a gel imager system (Alpha Innotech, San Leandro, CA, USA). The intensities of all the immunoblot bands were normalized to those of the corresponding internal standard bands (GAPDH).

2.5. Cell Culture and Treatments

The 3T3-L1, C2C12, and HEK293 cell lines (Procell, Wuhan, China) were cultured in a humidified CO2 chamber at 37 °C using DMEM (Gibco, GrandIsland, NY, USA) containing penicillin, streptomycin (Invitrogen, Carlsbad, CA, USA), and 10% fetal bovine serum (FBS) (Gibco, GrandIsland, NY, USA) (this complete medium was considered as M1). Cells were regularly subcultured before reaching 70% confluence, and the passage number was less than eight.
3T3-L1 cells were plated on a 100 mm culture dish at a very high density (3–4 million in 20 mL medium) and incubated overnight. On the second day (d 0), the medium was gently replaced with stage I differentiation medium of M1 medium supplemented with 10 mg/L insulin (Fosun Pharma, Shanghai, China), 1 μM dexamethasone (DEX, Solarbio, Beijing, China), and 0.5 mM 3-isobutyl-1-methylxanthine (IBMX, Solarbio, Beijing, China). The medium was switched to DMEM with 10% FBS and insulin only on d 2. Insulin was removed from the medium, and cells were maintained in M1 medium from d 4, changing the medium every 2 days.
For the myogenic differentiation, C2C12 cells were induced with DMEM supplemented with 2% horse serum after reaching the contact inhibition stage. The culture medium was changed every 2 days. After 6 days of C2C12 differentiation, when the myotubes were visible, the cells were incubated with DMEM containing 0.5% FBS and 500 μM oleate for 24 h to achieve the induction of lipid deposition in myotubes [28].
In order to determine the mechanisms of miR-34a/Lef1 function in lipid droplet accumulation in adipocytes and myoblasts, the particularity and complexity of the IMF internal microenvironment were fully considered. Cell treatments were as follows (Figure 1): (1) exploring the function of miR-34a/Lef1 in the differentiation process of preadipocytes (3T3-L1 cells); (2) determining the regulation of miR-34a/Lef1 in the lipid droplet deposition in myoblasts (C2C12 cells); (3) detecting the effects of miR-34a/Lef1 on fat accumulation in co-cultured 3T3-L1 and C2C12 cells; and (4) after miR-34a was overexpressed, the culture medium of preadipocytes during differentiation was collected to prepare the conditioned medium. C2C12 cells were cultured in the conditioned medium for 48 h after inducing C2C12 cells for myoblast differentiation to explore the effect of the conditioned medium of adipocytes on lipid droplet deposition in C2C12 cells, which was based on a similar study performed on macrophages [29].

2.6. Lef1 and miR-34a Mimics and Silencing

miR-34a mimics, a miR-34a inhibitor, and their respective negative controls (NC) were synthesized by GenePharma (Shanghai, China). Sequences are listed in Table 1. A Lef1 sequence was synthesized and subcloned into a transfection plasmid to generate recombinant vector pcDNA3.1-Lef1 (described as Lef1 in Figure 1). The control group was transfected with an empty pcDNA3.1 plasmid (described as pcDNA3.1 in Figure 1). We purchased specific siRNAs for mouse Lef1 from GenePharma. Plasmid and siRNA were transfected into cells using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.

2.7. Oil Red O Staining

Cultured cells were tested for lipid droplet formation using Oil Red O staining. Cells were washed in PBS and then fixed in 4% paraformaldehyde (Solarbio, Beijing, China) for 20 min. Then, the cells were washed briefly in 60% isopropanol (Hushi, Shanghai, China) and stained with 0.5 g Oil Red O (Solarbio, Beijing, China) stain for 30 min. Stained cells were washed in distilled water. Samples were then counterstained with hematoxylin (Solarbio, Beijing, China) for 1 min and then observed under a bright microscope (Nikon Eclipse Ni-U; Nikon, Tokyo, Japan), and images were taken with Nikon Digit sight DS-Fi2 digital camera (Nikon, Tokyo, Japan) and analyzed using image-analyzing program NIS Elements BR (Version 4.20). Then, the cells were treated with 1 mL isopropanol to extract the Oil Red O, followed by OD value detection at 510 nm [28].

2.8. RNA Fluorescence In Situ Hybridization (RNA FISH)

SA-Cy3-labeled miR-34a probes were obtained from GenePharma (Shanghai, China). RNA FISH was performed using a fluorescent in situ hybridization kit (GenePharma) following the manufacturer’s instructions.

2.9. BODIPY Staining

Cells were washed three times with PBS and fixed in 4% paraformaldehyde for 30 min. After washing three times with PBS, BODIPY (MK biotechnology, Shanghai, China) staining was performed for 30 min. Cells were then washed three times (5 min each wash) with PBS, with shaking. Finally, cells were stained with DAPI for 10 min, washed three times, and then imaged under a fluorescence microscope.

2.10. Immunofluorescence Staining

Cells were fixed in 4% paraformaldehyde for 30 min at room temperature, washed three times with PBS, and permeabilized with 0.1% Trition X-100 (Solarbio, Beijing, China) for 10 min. After blocking with 2% BSA (Gibco, GrandIsland, NY, USA) in PBS for 2 h at room temperature, the cells were washed three times with PBS and then incubated overnight at 4 °C with LEF1 antibody (1:100 dilution, ab137872, Abcam, Cambridge, MA, USA) or MyHC antibody (1:100 dilution, ABclonal, Wuhan, China). The next day, the cells were washed three times with PBS, 10 min each wash, and subsequently incubated with secondary antibodies (FITC-labeled Goat Anti-Rabbit IgG (H + L), Beyotime, Shanghai, China and Alexa Fluor 555-conjugated Goat Anti-Rabbit IgG (H + L), ABclonal, Wuhan, China) for 2 h at room temperature, and then washed with PBS. Finally, the cells were counterstained with DAPI (Beyotime, Shanghai, China) and viewed on a Nikon.

2.11. Dual Luciferase Reporter Assay

A dual-luciferase reporter assay was employed to examine the binding activity between miR-34a and Lef1 following established protocols in HEK293T cells [30]. First, we constructed dual-luciferase reporter gene plasmids ligated to both wild-type and mutant forms of Lef1 gene coding sequences. In brief, HEK293T cells from all groups were transfected with a pGLO-Luc plasmid containing candidate binding elements, including Lef1 gene fragments linked to a firefly luciferase neo expression vector, using the approaches mentioned above. After transfection, HEK293T cells were measured for Renilla luciferase activity using the Dual-Luciferase Assay Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Firefly and Renilla luciferase activities were measured by a Full Function Detector (PerkinElmer/envision) and normalized to Renilla luciferase data.

2.12. Statistical Analysis

All the data were included for statistical analyses using GraphPad Prism 8. The unpaired Student t-test (two-tailed) was used for the comparison between two unpaired groups. One-way analysis of variance (ANOVA) was applied for multi-group data comparison. Bar graphs were presented as means ± s.d. Differences were considered statistically significant at p < 0.05.

3. Results

3.1. GO and KEGG Analysis Indicated the Involvement of miRNAs in Lipid Storage and Fatty Acid Metabolism

According to our previous studies [23], we classified the samples into two groups based on fat content: the high intramuscular fat group (H group, IMF content > 12%) and low intramuscular fat group (L group, IMF content < 5%), with 4 samples in each group. Then, mRNA and miRNA-sequencing were performed and analyzed to investigate the DE mRNAs and DE miRNAs profiles. In total, 24 DE miRNA were found, including 8 upregulated miRNAs and 16 downregulated miRNAs (Figure 2A,B). GO analysis showed that the DE miRNAs significantly enriched in positive regulation of lipid storage, lipid metabolic process, cholesterol efflux, and cellular response to lipid (Figure 2C). Moreover, KEGG analysis also demonstrated the enrichment of the Wnt signaling pathway, mTOR signaling pathway, AMPK signaling pathway, and PPAR signaling pathway (Figure 2D).
Then, the co-expression pattern and Pearson correlation analysis were performed to determine the DE miRNA–mRNA potential regulatory networks. Interestingly, the results indicated that three DE miRNA have significant correlation with DE mRNA, including miR-34a-Lef1, miR-532-3p-PLD3, HMCES, miR-6782-3p-ARHGEF7, JARID2, and DDX54. According to GO and KEGG analysis, we found Lef1 mainly enriched in the muscle and adipose tissue development (Figure 3A,B). Therefore, we suspect that miR-34a/Lef1 may play an important role in regulating IMF accumulation.

3.2. miR-34a and Lef1 Show Opposite Expression Patterns during the Differentiation of 3T3-L1-Derived Adipocytes

To verify the expression of miR-34a and Lef1 in the tissues, total RNA was extracted from the heart, liver, spleen, lung, kidney, subcutaneous fat, and muscle of each Laiwu pig from the H and L groups. The results show that these two genes were commonly expressed in these tissues. Additionally, miR-34a was highly expressed in liver, muscle and backfat, and Lef1 was highly expressed in spleen, backfat, and muscle (Figure 4A,B). However, miR-34a expression was upregulated in the high IMF-content group (p < 0.01), while the Lef1 protein level in H group was significantly lower than that in the L group (p < 0.05) (Figure 4C,D). In order to explore the expression patterns of miR-34a and Lef1 during preadipocyte differentiation, 3T3-L1 cells were induced to differentiate into adipocytes (d 0–d 10). With the differentiation degree of adipocytes, the expression of Pparg and lipid droplet accumulation were gradually increased (Figure 4F,G). Interestingly, the expression of miR-34a was gradually upregulated (p < 0.05), which is consistent with the expression pattern in muscle tissue (Figure 4E), while Lef1 expression was significantly decreased at the early stage of differentiation (d 0–d 8) (p < 0.05) and increased subsequently (Figure 4E). Taken together, miR-34a and Lef1 show opposite expression during the differentiation of 3T3-L1-derived adipocytes, indicating the potential regulatory interaction.

3.3. Lef1 Is a Target of miR-34a

Based on the opposite expression pattern of miR-34a and Lef1, we hypothesized that Lef1 may be a potential target of miR-34a. According to the prediction of the TargetScan and Starbase websites, miR-34a was well conserved in multiple species (mice, humans, pigs and cattle). Meanwhile, the seed sequence of miR-34a was complementary to the 7 nt base in the 3 ′UTR of Lef1 (Figure 5A), which indicates that miR-34a may target Lef1 to regulate IMF deposition. To confirm this hypothesis, Lef1 wild-type (WT) or mutant (MUT) luciferase reporter vectors containing miR-34a binding sites were co-transfected with miR-34a or the NC into HEK293T cells. The luciferase reporter assay demonstrated that miR-34a overexpression effectively reduced luciferase activity of the pmirGLO-Lef1-WT reporter but did not decrease that of the pmirGLO-Lef1-MUT reporter (Figure 5B). These results suggest that mutation of the conserved 7 nt seed sequence abrogated the repression induced by miR-34a of the Lef1 3′UTR, demonstrating a targeted relationship between these two genes.
Then, RNA FISH assay and immunofluorescence staining were conducted to detect these respective gene expression locations. The results demonstrate that miR-34a and Lef1 were mainly expressed in the cytoplasm. Interestingly, after 3T3-L1 cell differentiation, Lef1 was found to be located in the nucleus (Figure 5C).

3.4. miR-34a Promoted Adipogenesis

To detect the effects of miR-34a on lipid deposition in adipocytes, miR-34a mimics and their control (mimics NC) were transfected into 3T3-L1 cells. Then, adipogenic markers (Pparg, Cebpa, Fabp4, and Plin1) and Lef1 were detected during 3T3-L1 cell differentiation. Meanwhile, β-catenin, a specific and crucial molecule in the Wnt signaling pathway [31], was also detected in this study. As a result, miR-34a expression was successfully upregulated in 3T3-L1 cells following miR-34a mimic transfection (Figure 6A, p < 0.05). After overexpressing miR-34a, the expressions of Pparg, Cebpa, Fabp4, and Plin1 were also upregulated compared with the NC group (p < 0.05). However, miR-34a mimics significantly reduced Lef1 expression with preadipocytes differentiation (Figure 6B–F). In addition, the Western blot results show that miR-34a mimics significantly promoted the protein expression of PPARγ and C/EBPα and decreased Lef1 and β-catenin levels at d 0 and d 8 differentiation (Figure 6G–K). At the same time, the formation and accumulation of lipid droplet was promoted by overexpressing miR-34a detected via BODIPY (d 8) and oil red O staining (d 0 and d 8) (Figure 6L,M). These results indicated that overexpression miR-34a regulated the adipogenesis-associated molecules, promoting the accumulation of lipid droplets.
To figure out the exact relationship between miR-34a and key adipogenic genes, miR-34a interference was performed. As can be seen from Figure 7A, miR-34a inhibitor successfully decreased miR-34a expression with the differentiation of 3T3-L1 cells (p < 0.001). The results of qPCR and Western blot demonstrate that miR-34a inhibitor significantly reduced the RNA and protein expression of Pparγ, C/ebpα, Fabp4, and Plin1 (Figure 7B–F). Meanwhile, the protein levels of PPARγ and C/EBPα were also decreased; however, the LEF1 and β-catenin protein expression was dramatically increased (p < 0.05) during the differentiation of 3T3-L1 cells into adipocytes (Figure 7G–K). Moreover, BODIPY and Oil Red O staining were also conducted to visually reveal the effect of miR-34a inhibitor on lipid droplet deposition in 3T3-L1 cells. According to Figure 7L,M, the deposition of lipid droplets in 3T3-L1 cells decreased after miR-34a expression was inhibited. Taken together, these results confirmed that silencing miR-34a could downregulate adipogenic genes, thereby suppressing the accumulation of lipid droplets during 3T3-L1-derived adipocyte differentiation.

3.5. miR-34a Promoted Fat Deposition by Suppressing Lef1 during 3T3-L1 Differentiation

In order to investigate the function of Lef1 in the process of fat deposition in 3T3-L1 cells, adipogenic-associated gene expression levels were detected after overexpressing or silencing Lef1. PcDNA3.1-vector-containing Lef1 and Lef1 siRNA could significantly upregulate or silence the expression of Lef1 (Figure 8A). Lef1 overexpression significantly decreased the levels of Pparg, Cebpa, Fabp4, and Plin1; however, when the Lef1 expression was disturbed, the adipogenic markers were dramatically upregulated (p < 0.05) (Figure 8B–E). These results suggest that Lef1 negatively regulated lipid deposition during the differentiation of 3T3-L1 cells.
To further explore whether the effects of miR-34a on lipid accumulation were mediated by Lef1, we conducted a rescue experiment by simultaneous overexpressing or inhibiting miR-34a and Lef1 in 3T3-L1 cells by transfecting miR-34a mimics/inhibitor or pcDNA3.1-NC/Lef1. As is shown in Figure 8F,G, the overexpression caused by transfecting pcDNA3.1-Lef1 was rescued by miR-34a mimics during 3T3-L1 differentiation on day 0 or day 8. Meanwhile, the protein expression of Lef1 also showed no difference after co-transfection of miR-34a and Lef1 to preadipocytes. However, when cells were treated with miR-34a inhibitor plus siLef1, Lef1 expression was significantly decreased (Figure 8F), while the Pparg level was significantly increased before 3T3-L1 cell differentiation (p < 0.05, Figure 8H). After 3T3-L1 cell differentiation at d 8, Lef1 expression was significantly increased, but the Cebpa level was significantly decreased in the group of miR-34a inhibitor plus siLef1 (p < 0.05, Figure 8I). In addition, there was no significant difference in the expression of adipogenic markers in the four treatments during 3T3-L1 cell differentiation. These results suggest that the overexpression of miR-34a reversed the inhibitory function of overexpressed Lef1 on lipid deposition in 3T3-L1 cells.

3.6. miR-34a/Lef1 Promoted Lipid Droplet Accumulation in C2C12 Cells

Different types of cells might have interactions in location microenvironments, thus we suspect that the fat deposition process of adipocytes might affect muscle cell metabolism. Previous studies have found that oleate can promote lipid droplet accumulation in C2C12 cells [28]. Based on this study, the model of lipid droplet deposition in myoblasts was constructed. As shown in Figure 9A–E, 500 μM oleate significantly decreased myogenesis marker (MyHC and MyOD) expression but promoted the expression of Fabp4 and Cebpa (p < 0.05). In addition, BODIPY and Oil Red O staining showed that 500 μM oleate could promote the accumulation of lipid droplets in C2C12 cells (Figure 9F,G). Thus, the model of fat deposition in myoblasts induced by oleate was established successfully.
Then, qPCR was performed to investigate whether miR-34a could affect the lipid droplet deposition in C2C12 cells induced by oleate. The results show that overexpression of miR-34a significantly inhibited the expression of Lef1 (p < 0.05) (Figure 9H). Meanwhile, the overexpression of miR-34a significantly promoted the expression of Pparg, Cebpa, and Fabp4 in C2C12 cells induced by oleate (p < 0.05) but had no significant effect on Plin1 (Figure 9I–L). When miR-34a expression was disrupted, Lef1 expression was significantly increased (p < 0.05); however, the expression of Pparg, Cebpa, Fabp4, and Plin1 was significantly decreased (p < 0.05). To better reveal the effect of miR-34a on lipid droplet deposition in C2C12 cells, BODIPY and Oil Red O staining were performed after the cells were induced by oleate. These results showed that miR-34a mimics promoted the accumulation of lipid droplets in myoblasts (Figure 9M,N). However, miR-34a inhibitor showed the opposite function.

3.7. miR-34a Increased Fat Deposition in 3T3-L1 and C2C12 Cells Co-Culture System

Generally, fat deposition in adipocytes distributed in muscle tissue is the primary reason for intramuscular fat deposition. However, we found miR-34a can promote the lipid droplets deposition in C2C12 cells. Thus, we suspect that the IMF accumulation in muscle might be the co-contribution of adipocytes and muscle cells. Therefore, the co-culture model of C2C12 and 3T3-L1 cells was constructed to detect whether there is an interaction between these two types of cells. miR-34a mimics, inhibitor, and their corresponding controls (mimics NC or inhibitor NC) were transfected into the co-cultured cells. Results, as shown in Figure 10A–F, indicate that miR-34a mimics significantly promoted the expression of Pparg, Cebpa, and Fabp4 and decreased MyOD expression (p < 0.05). While miR-34a inhibitor upregulated the expression of MyHC and Lef1 and repressed adipogenic marker levels (p < 0.05), Oil Red O staining showed that miR-34a overexpression increased the accumulation of lipid droplets, and the OD value of Oil Red O extraction with isopropanol in the miR-34a mimics treatment was significantly increased compared with the NC group (p < 0.05).

3.8. miR-34a Increased IMF Deposition in C2C12 Cells Incubated with the Adipogenic Conditioned Medium

According to the function of miR-34a in the co-culture of 3T3-L1 and C2C12 cells, it is speculated that adipocytes have a relationship with the lipid accumulation in myoblasts through intercellular communication. Therefore, we transfected miR-34a mimics into 3T3-L1 cells. Then, the supernatant during preadipocyte differentiation (d 0–d 8) was collected and used as conditioned medium for the culture of C2C12 cells after C2C12 cell differentiation. The results show that with the preadipocytes’ differentiation, the conditioned medium significantly inhibited Lef1 expression and promoted the levels of adipogenic markers (Figure 10H–K, p < 0.05). Oil Red O staining on d 8 in conditioned medium was significantly increased compared with the d 0 group (p < 0.05) (Figure 10L).

4. Discussion

IMF (marbling) is an essential index for pork quality in terms of tenderness and juiciness. The content of it is mainly associated with the number and size of intramuscular adipocytes [32]. The IMF content of Laiwu pigs was higher than that of other pigs. To date, most studies selected the DEGs related to IMF deposition through comparisons between Laiwu pigs and other breeds of pig [33], but few have focused on variation among individuals belonging to the same breed. Our previous study demonstrated that the IMF content of individual Laiwu pigs varies greatly (about 2.17–13.93%) [23], which has been replicated in other studies over the past year [22]. The knowledge regarding this phenomenon is still in its infancy. This study is the first to propose why there are differences in IMF deposition among different individual pigs of the same breed.
The miR-34a family consists of miR-34a, miR-34b, and miR-34c. miR-34a is commonly expressed in multiple tissues, while miR-34b and miR-34c are mainly expressed in the lungs [34]. This study found that miR-34a was highly expressed in liver, subcutaneous fat, and muscle tissues of Laiwu pigs. Evidence has shown that miR-34a is significantly elevated in the liver of obese mice [35] and upregulated during adipogenesis [36]. These results suggest that miR-34a may play an important role in IMF deposition. There are multiple target genes for miR-34a, and SIRT1 is the most studied target gene at present [20,21,37]. In addition, miR-34a could target PDGFRα to regulate the differentiation of intramuscular preadipocytes through the ERK signaling pathway [38]. However, the mechanisms of miR-34a regulating porcine IMF deposition by targeting Lef1 have not been reported yet.
Mature miRNAs mainly exist in the cytoplasm, and current studies show that they are also distributed in the nucleus, mitochondria, and exosomes [39,40,41]. Therefore, the expression and localization of miRNAs in cells is the basis for studying their functions. Our results show that miR-34a and Lef1 were mainly expressed in the cytoplasm. This is consistent with the general environment in which the relationship between miRNA and mRNA operates. Studies have shown that the transcription factor Lef1 can transfer into the nucleus and bind with β-catenin to regulate downstream gene expression [42]. Our results in this study also confirm that Lef1 was transferred into the nucleus after preadipocyte differentiation. According to the analysis of TargetScan and Starbase, the targeted binding site of miR-34a and Lef1 was predicted, which was confirmed by the dual luciferase reporter assay. In addition, during preadipocyte differentiation, Lef1 expression was negatively correlated with miR-34a at the early stage of differentiation, but this negative correlation is not strict at the late stage of differentiation. There was evidence to explain this phenomenon. The interaction between miRNAs and their target genes is not a constant negative correlation but a dynamic biological change process under different environments [12]. miRNAs could activate translation of targeted mRNAs, which may be triggered by changes in growth microenvironment [43].
IMF is an essential index for the tenderness and juiciness of pork. Studies have shown that the growth and development of skeletal muscle and adipocytes take an important role in meat quality [44]. Meanwhile, the co-culture results of C2C12 and 3T3-L1 cells show that the interaction between these two cells regulated the expression of calprotease, caspase, and heat shock protein in meat [45]. Considering the complexity and particularity of the IMF microenvironment in vivo, the function of miR-34a and LEF1 in myoblasts and adipocytes is of significance to explore the mechanisms of IMF deposition. Therefore, this study constructed a co-culture model of C2C12 and 3T3-L1 cells to explore the function of miR-34a and Lef1 in intercellular communication between adipocytes and myoblasts during IMF accumulation. Meanwhile, C2C12 cells were cultured in conditioned medium collected during 3T3-L1 cell differentiation to study the miR-34a and Lef1 effects of adipocyte secretion on lipid deposition in myoblasts.
First, miR-34a mediated Lef1 to regulate lipid droplet deposition in 3T3-L1 cells. Lef1 is the factor at the end of the Wnt signaling pathway. The dimer of Lef1 and β-catenin regulate the expression of downstream transcription factors after the Wnt signaling pathway is activated, playing an important part in myogenesis and adipogenesis [46]. In this study, miR-34a inhibited the expression of Lef1 and β-catenin and upregulated the levels of Pparg, Cebpa, Fabp4, and Plin1 (adipogenic markers) during preadipocyte differentiation. In addition, the rescue test showed that the overexpression of miR-34a could reverse the inhibition of Lef1 on adipogenic markers in 3T3-L1 cells. These results suggest that miR-34a regulated IMF deposition by targeting Lef1 (Figure 11). This was consistent with previous studies on Lef1/β-catenin (Wnt signaling pathway) regulating fat deposition in obesity [47].
miR-34a mediated Lef1 to regulate lipid droplet deposition in C2C12 cells. The lipid droplets’ accumulation in myoblasts is an important aspect to enhance the IMF content. Evidence shows that BMP11 could negatively regulate lipid metabolism in C2C12 cells, inhibit myogenesis, and promote fatty acid accumulation and lipid droplet formation [48]. VEGF could upregulate the expression of fatty acid transporters FATP1 and FATP4 and promote fatty acid oxidation and TG decomposition in C2C12 cells, thereby inhibiting lipid accumulation in C2C12 cells [49]. Studies showed that oleate could induce lipid deposition in skeletal muscle cells [28]. Therefore, oleate was used to induce lipid droplet deposition in myoblasts. The results demonstrate that miR-34a promoted the levels of adipogenic markers in C2C12 cells by inhibiting Lef1 expression.
miR-34a regulated lipid droplet deposition in the co-culture of C2C12 and 3T3-L1 cells by mediating Lef1. Evidence shows that the co-culture of C2C12 and 3T3-L1 cells could be used to simulate the construction of muscle and fat formation [50]. The co-culture of 3T3-L1 and RAW264.7 cells was used to investigate the inflammatory regulation of obesity and macrophage infiltration [51]. This study showed that miR-34a overexpression decreased MyOD expression, while the inhibition of miR-34a significantly increased the MyHC level. These results suggest that miR-34a could reduce myogenic marker expression to inhibit C2C12 cell differentiation. Similar to this result, 3T3-L1 cells inhibit the differentiation of C2C12 cells by promoting the expression of myostatin in the co-culture system [52]. Meanwhile, this study found that miR-34a overexpression significantly promoted adipogenic markers expression and increased lipid droplet accumulation in the co-culture of C2C12 and 3T3-L1 cells. However, after miR-34a was inhibited, Lef1 expression was significantly increased, while the levels of adipogenic markers and lipid droplet deposition were decreased. These results suggest that miR-34a inhibited myoblast differentiation and promoted lipid deposition in the co-culture of C2C12 and 3T3-L1 cells by targeting Lef1.
miR-34a mediated Lef1 to indirectly regulate lipid deposition in myoblasts through influencing the adipocytes secretion. According to the miR-34a regulation on lipid deposition in the co-culture cells, it was speculated that miR-34a could regulate lipid droplet accumulation in myoblasts through secretions during preadipocyte differentiation. Therefore, miR-34a mimics were transfected into 3T3-L1 cells. During preadipocyte differentiation, the supernatant was collected and prepared as a conditioned medium for C2C12 culture after filtration. In this study, Lef1 expression was significantly inhibited and the expression of adipogenic markers and lipid droplet deposition in C2C12 cells was promoted in the conditioned medium. These results suggest that miR-34a mediated Lef1 to regulate lipid deposition in myoblasts by influencing secretions during preadipocyte differentiation.
In this study, based on the results of the co-culture and conditioned medium treatments, the hypothesis that the secretion of adipocytes may play an important role in IMF accumulation can be established. Previous studies used the supernatant from adipocytes of different degrees of hyperplastic obesity for culture, which was absorbed and filtered to prepare a conditioned medium for preadipocytes culture, and this conditioned medium promoted preadipocyte differentiation [53]. Exosomes are actively exfoliated endontic vesicles, approximately 40 to 100 nm in diameter, which contain and transport functional mRNAs, miRNAs, and proteins between different cells [54,55]. Exosomes derived from adipocytes can induce obesity by enhancing lipid deposition in macrophages and increasing pro-inflammatory cytokines, thereby leading to insulin resistance [56]. Meanwhile, miRNAs in exosomes derived from adipocytes mediate TGF-β and Wnt signaling pathways to regulate adipogenesis [57]. miR-199a-5p in exosomes derived from muscle fibroblasts promote the fibrosis of skeletal muscle [58]. Therefore, the reasons for miR-34a regulation of lipid deposition in the co-culture and conditioned medium treatment were as follows: miR-34a may be secreted by adipocytes to regulate lipid droplet deposition in myoblasts, and miR-34a targets Lef1 to regulate the secretion factors of adipocytes during preadipocyte differentiation and then induces lipid droplet deposition in C2C12 cells. However, how miR-34a and Lef1 regulate lipid accumulation by changing secretions during preadipocyte differentiation remains to be further explored.

5. Conclusions

In conclusion, due to the particularity and complexity of the microenvironment of IMF in vivo, fat deposition in adipocytes and myoblasts, signal exchange between myoblasts and preadipocytes, and the regulation of the secretion of adipocytes in IMF deposition were discussed in this study. We found that miR-34a promoted fat deposition in adipocytes and myoblasts by targeting Lef1 through the Wnt (Lef1/β-catenin) signaling pathway. Meanwhile, miR-34a targeting Lef1 could promote IMF deposition by regulating signal exchange between myoblasts and adipocytes. In addition, miR-34a mediated Lef1 to regulate lipid droplet deposition in myoblasts through secretions collected from preadipocyte differentiation. Therefore, this study confirmed that miR-34a can regulate IMF deposition by targeting Lef1. However, the mechanism of how miR-34a indirectly regulates lipid droplet accumulation in myoblasts through adipocyte secretions remains unclear. In addition, more research should be conducted with a pig model to verify the conclusion of our study, which is also a limitation of our study.

Author Contributions

L.W., Y.X., W.C. and Y.Z. (Yu Zhang) contributed to this paper with sample collection; L.W. drafted the manuscript; L.W. and Y.X. reviewed and edited the manuscript; Y.Z. (Yongqing Zeng) contributed to this paper by drafting and editing the manuscript and supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported financially by National Key R&D Program of China (No. 2021YFD1301200), the Agricultural Animal Breeding Project of Shandong Province (No. 2020LZGC012), the Shandong Province Pig Industry Technology System Project (No. SDAIT-08-02), Shandong Provincial Natural Science Foundation (No. ZR2019MC053).

Institutional Review Board Statement

The study was conducted according to guidelines of the Declaration of Shandong Province and was approved by the Animal Care and Ethics Committee of Shandong Agricultural University (approval number: SDAUA-2021-140).

Informed Consent Statement

Not applicable.

Data Availability Statement

Raw RNA sequencing data have been submitted to the NCBI Sequence Read Archive under accession number PRJNA769962.

Acknowledgments

We would like to thank Weiren Yang and Shuhong Sun from Shandong Agricultural University for their excellent technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Fernandez, X.; Monin, G.; Talmant, A.; Mourot, J.; Lebret, B. Influence of intramuscular fat content on the quality of pig meat—1. Composition of the lipid fraction and sensory characteristics of m. longissimus lumborum. Meat Sci. 1999, 53, 59–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Park, S.J.; Beak, S.; Da Jin Sol Jung, S.Y.; Kim, I.H.J.; Piao, M.Y.; Kang, H.J.; Fassah, D.M.; Na, S.W.; Yoo, S.P.; Baik, M. Genetic, management, and nutritional factors affecting intramuscular fat deposition in beef cattle—A review. Asian-Australas. J. Anim. Sci. 2018, 31, 1043. [Google Scholar] [CrossRef] [Scilit]
  3. Poklukar, K.; Čandek-Potokar, M.; Batorek Lukač, N.; Tomažin, U.; Škrlep, M. Lipid deposition and metabolism in local and modern pig breeds: A review. Animals 2020, 10, 424. [Google Scholar] [CrossRef] [Scilit]
  4. Wang, L.; Shan, T. Factors inducing transdifferentiation of myoblasts into adipocytes. J. Cell. Physiol. 2021, 236, 2276–2289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Zhou, C.; Li, P.; Han, M.; Gao, X. Daidzein stimulates fatty acid-induced fat deposition in C2C12 myoblast cells via the G protein-coupled receptor 30 pathway. Anim. Biotechnol. 2020, 33, 851–863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Liu, Y.; Wang, J.; Zhou, X.; Cao, H.; Zhang, X.; Huang, K.; Li, X.; Yang, G. miR-324-5p Inhibits C2C12 cell Differentiation and Promotes Intramuscular Lipid Deposition through lncDUM and PM20D1. Mol. Ther. Nucleic Acids 2020, 22, 722–732. [Google Scholar] [CrossRef] [Scilit]
  7. Herms, A.; Bosch, M.; Ariotti, N.; Reddy, B.J.; Fajardo, A.; Fernández-Vidal, A.; Alvarez-Guaita, A.; Fernández-Rojo, M.A.; Rentero, C.; Tebar, F. Cell-to-cell heterogeneity in lipid droplets suggests a mechanism to reduce lipotoxicity. Curr. Biol. 2013, 23, 1489–1496. [Google Scholar] [CrossRef] [Scilit]
  8. Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [Scilit]
  9. Lim, L.P.; Lau, N.C.; Weinstein, E.G.; Abdelhakim, A.; Yekta, S.; Rhoades, M.W.; Burge, C.B.; Bartel, D.P. The microRNAs of Caenorhabditis elegans. Gene. Dev. 2003, 17, 991–1008. [Google Scholar] [CrossRef] [Scilit]
  10. Baek, D.; Villén, J.; Shin, C.; Camargo, F.D.; Gygi, S.P.; Bartel, D.P. The impact of microRNAs on protein output. Nature 2008, 455, 64–71. [Google Scholar] [CrossRef] [Scilit]
  11. Zhang, X.; Zuo, X.; Yang, B.; Li, Z.; Xue, Y.; Zhou, Y.; Huang, J.; Zhao, X.; Zhou, J.; Yan, Y. MicroRNA directly enhances mitochondrial translation during muscle differentiation. Cell 2014, 158, 607–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Ni, W.; Leng, X. Dynamic miRNA–mRNA paradigms: New faces of miRNAs. Biochem. Biophy. Rep. 2015, 4, 337–341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Vasudevan, S.; Tong, Y.; Steitz, J.A. Switching from repression to activation: microRNAs can up-regulate translation. Science 2007, 318, 1931–1934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Ling, H.Y.; Wen, G.B.; Feng, S.D.; Tuo, Q.H.; Ou, H.S.; Yao, C.H.; Zhu, B.Y.; Gao, Z.P.; Zhang, L.; Liao, D.F. MicroRNA-375 promotes 3T3-L1 adipocyte differentiation through modulation of extracellular signal-regulated kinase signalling. Clin. Exp. Pharmacol. Physiol. 2011, 38, 239–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Liu, S.; Sun, G.; Yuan, B.; Zhang, L.; Gao, Y.; Jiang, H.; Dai, L.; Zhang, J. miR-375 negatively regulates porcine preadipocyte differentiation by targeting BMPR 2. FEBS Lett. 2016, 590, 1417–1427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Xu, J.; Zhang, L.; Shu, G.; Wang, B. microRNA-16–5p promotes 3T3-L1 adipocyte differentiation through regulating EPT1. Biochem. Biophys. Res. Commun. 2019, 514, 1251–1256. [Google Scholar] [CrossRef] [Scilit]
  17. Liu, K.; Zhang, X.; Wei, W.; Liu, X.; Tian, Y.; Han, H.; Zhang, L.; Wu, W.; Chen, J. Myostatin/SMAD4 signaling-mediated regulation of miR-124-3p represses glucocorticoid receptor expression and inhibits adipocyte differentiation. Am. J. Physiol. Endoc. M. 2019, 316, E635–E645. [Google Scholar] [CrossRef] [Scilit]
  18. Giese, K.; Kingsley, C.; Kirshner, J.R.; Grosschedl, R. Assembly and function of a TCR alpha enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Gene. Dev. 1995, 9, 995–1008. [Google Scholar] [CrossRef] [Scilit]
  19. De Winter, T.J.; Nusse, R. Running Against the Wnt: How Wnt/β-Catenin Suppresses Adipogenesis. Front. Cell Dev. Biol. 2021, 9, 140. [Google Scholar] [CrossRef] [Scilit]
  20. Li, L.; Yuan, L.; Luo, J.; Gao, J.; Guo, J.; Xie, X. MiR-34a inhibits proliferation and migration of breast cancer through down-regulation of Bcl-2 and SIRT1. Clin. Exp. Med. 2013, 13, 109–117. [Google Scholar] [CrossRef] [Scilit]
  21. Ding, J.; Li, M.; Wan, X.; Jin, X.; Chen, S.; Yu, C.; Li, Y. Effect of miR-34a in regulating steatosis by targeting PPARα expression in nonalcoholic fatty liver disease. Sci. Rep. 2015, 5, 13729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Huang, Y.; Zhou, L.; Zhang, J.; Liu, X.; Huang, L. A large-scale comparison of meat quality and intramuscular fatty acid composition among three Chinese indigenous pig breeds. Meat Sci. 2020, 168, 108182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Wang, L.; Xie, Y.; Chen, W.; Zhang, Y.; Zeng, Y. Identification and functional prediction of long noncoding RNAs related to intramuscular fat content in Laiwu pigs. Anim. Biosci. 2021, 35, 115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. goseq: Gene Ontology testing for RNA-seq datasets. R Bioconductor 2012, 8, 1–25. [Google Scholar]
  26. Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2007, 36, D480–D484. [Google Scholar] [CrossRef] [Scilit]
  27. Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef] [Scilit]
  28. Xiang, A.; Chu, G.; Zhu, Y.; Ma, G.; Yang, G.; Sun, S. IGFBP5 suppresses oleate-induced intramyocellular lipids deposition and enhances insulin signaling. J. Cell. Physiol. 2019, 234, 15288–15298. [Google Scholar] [CrossRef] [Scilit]
  29. Buxadé, M.; Huerga Encabo, H.; Riera-Borrull, M.; Quintana-Gallardo, L.; López-Cotarelo, P.; Tellechea, M.; Martínez-Martínez, S.; Redondo, J.M.; Martín-Caballero, J.; Flores, J.M. Macrophage-specific MHCII expression is regulated by a remote Ciita enhancer controlled by NFAT5. J. Exp. Med. 2018, 215, 2901–2918. [Google Scholar] [CrossRef] [Scilit]
  30. Man, X.; Tan, S.; Tang, H.; Guo, Y.; Tang, C.; Tang, J.; Zhou, C.; Zhou, H. MiR-503 inhibits adipogenesis by targeting bone morphogenetic protein receptor 1a. Am. J. Transl. Res. 2016, 8, 2727. [Google Scholar]
  31. Singh, R.; Artaza, J.N.; Taylor, W.E.; Braga, M.; Yuan, X.; Gonzalez-Cadavid, N.F.; Bhasin, S. Testosterone inhibits adipogenic differentiation in 3T3-L1 cells: Nuclear translocation of androgen receptor complex with β-catenin and T-cell factor 4 may bypass canonical Wnt signaling to down-regulate adipogenic transcription factors. Endocrinology 2006, 147, 141–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Li, X.; Fu, X.; Yang, G.; Du, M. Enhancing intramuscular fat development via targeting fibro-adipogenic progenitor cells in meat animals. Animal 2020, 14, 312–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Chen, W.; Fang, G.; Wang, S.; Wang, H.; Zeng, Y. Longissimus lumborum muscle transcriptome analysis of Laiwu and Yorkshire pigs differing in intramuscular fat content. Genes Genom. 2017, 39, 759–766. [Google Scholar] [CrossRef] [Scilit]
  34. Bommer, G.T.; Gerin, I.; Feng, Y.; Kaczorowski, A.J.; Kuick, R.; Love, R.E.; Zhai, Y.; Giordano, T.J.; Qin, Z.S.; Moore, B.B. p53-mediated activation of miRNA34 candidate tumor-suppressor genes. Curr. Biol. 2007, 17, 1298–1307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Zhao, E.; Keller, M.P.; Rabaglia, M.E.; Oler, A.T.; Stapleton, D.S.; Schueler, K.L.; Neto, E.C.; Moon, J.Y.; Wang, P.; Wang, I. Obesity and genetics regulate microRNAs in islets, liver, and adipose of diabetic mice. Mamm. Genome 2009, 20, 476–485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Ortega, F.J.; Moreno-Navarrete, J.M.; Pardo, G.; Sabater, M.; Hummel, M.; Ferrer, A.; Rodriguez-Hermosa, J.I.; Ruiz, B.; Ricart, W.; Peral, B. MiRNA expression profile of human subcutaneous adipose and during adipocyte differentiation. PLoS ONE 2010, 5, e9022. [Google Scholar] [CrossRef] [Scilit]
  37. Fu, T.; Seok, S.; Choi, S.; Huang, Z.; Suino-Powell, K.; Xu, H.E.; Kemper, B.; Kemper, J.K. MicroRNA 34a inhibits beige and brown fat formation in obesity in part by suppressing adipocyte fibroblast growth factor 21 signaling and SIRT1 function. Mol. Cell. Biol. 2014, 34, 4130–4142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Sun, Y.; Qin, J.; Liu, S.; Cai, R.; Chen, X.; Wang, X.; Pang, W. PDGFRα regulated by miR-34a and FoxO1 promotes adipogenesis in porcine intramuscular preadipocytes through Erk signaling pathway. Int. J. Mole. Sci. 2017, 18, 2424. [Google Scholar] [CrossRef] [Scilit]
  39. Park, C.W.; Zeng, Y.; Zhang, X.; Subramanian, S.; Steer, C.J. Mature microRNAs identified in highly purified nuclei from HCT116 colon cancer cells. RNA Biol. 2010, 7, 606–614. [Google Scholar] [CrossRef] [Scilit]
  40. Bian, Z.; Li, L.; Tang, R.; Hou, D.; Chen, X.; Zhang, C.; Zen, K. Identification of mouse liver mitochondria-associated miRNAs and their potential biological functions. Cell Res. 2010, 20, 1076–1078. [Google Scholar] [CrossRef] [Scilit]
  41. Long, L.; Zhang, X.; Bai, J.; Li, Y.; Wang, X.; Zhou, Y. Tissue-specific and exosomal miRNAs in lung cancer radiotherapy: From regulatory mechanisms to clinical implications. Cancer Manag. Res. 2019, 11, 4413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Asally, M.; Yoneda, Y. β-catenin can act as a nuclear import receptor for its partner transcription factor, lymphocyte enhancer factor-1 (lef-1). Exp. Cell Res. 2005, 308, 357–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Buchan, J.R.; Parker, R. The two faces of miRNA. Science 2007, 318, 1877–1878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Greenwood, P.L.; Walmsley, B.J.; Oddy, V.H. Regulation of growth and development of skeletal muscle and adipocytes and its impact on efficiency and meat quality. In Energy and Protein Metabolism and Nutrition; EAAP Publication No. 138; Chizzotti, M., Ed.; Wageningen Academic Publishers: Wageningen, The Netherlands, 2019; pp. 53–71. [Google Scholar]
  45. Pandurangan, M.; Jeong, D.; Amna, T.; Van Ba, H.; Hwang, I. Co-culture of C2C12 and 3T3-L1 preadipocyte cells alters the gene expression of calpains, caspases and heat shock proteins. Vitr. Cell. Dev.-An. 2012, 48, 577–582. [Google Scholar] [CrossRef] [Scilit]
  46. Shang, Y.C.; Zhang, C.; Wang, S.H.; Xiong, F.; Zhao, C.P.; Peng, F.N.; Feng, S.W.; Yu, M.J.; Li, M.S.; Zhang, Y.N. Activated β-catenin induces myogenesis and inhibits adipogenesis in BM-derived mesenchymal stromal cells. Cytotherapy 2007, 9, 667–681. [Google Scholar] [CrossRef] [Scilit]
  47. Chen, N.; Wang, J. Wnt/β-catenin signaling and obesity. Front. Physiol. 2018, 9, 792. [Google Scholar] [CrossRef] [Scilit]
  48. Pham, H.G.; Park, J.P.; Yun, J.W. BMP11 Negatively Regulates Lipid Metabolism in C2C12 Muscle Cells. Biotechnol. Bioproc. Eng. 2020, 25, 670–680. [Google Scholar] [CrossRef] [Scilit]
  49. Li, L.; Ma, J.; Li, S.; Chen, X.; Zhang, J. Vascular endothelial growth factor B inhibits lipid accumulation in C2C12 myotubes incubated with fatty acids. Growth Factors 2019, 37, 76–84. [Google Scholar] [CrossRef] [Scilit]
  50. Pandurangan, M.; Hwang, I. Application of cell co-culture system to study fat and muscle cells. Appl. Microbiol. Biot. 2014, 98, 7359–7364. [Google Scholar] [CrossRef] [Scilit]
  51. Yao, F.; Yu, Y.; Feng, L.; Li, J.; Zhang, M.; Lan, X.; Yan, X.; Liu, Y.; Guan, F.; Zhang, M. Adipogenic miR-27a in adipose tissue upregulates macrophage activation via inhibiting PPARγ of insulin resistance induced by high-fat diet-associated obesity. Exp. Cell Res. 2017, 355, 105–112. [Google Scholar] [CrossRef] [Scilit]
  52. Seo, K.; Suzuki, T.; Kobayashi, K.; Nishimura, T. Adipocytes suppress differentiation of muscle cells in a co-culture system. Anim. Sci. J. 2019, 90, 423–434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Marques, B.G.; Hausman, D.B.; Martin, R.J. Association of fat cell size and paracrine growth factors in development of hyperplastic obesity. Am. J. Physiol. Regul. Integr. Comp. Physiol. 1998, 275, R1898–R1908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Camussi, G.; Deregibus, M.; Bruno, S.; Grange, C.; Fonsato, V.; Tetta, C. Exosome/microvesicle-mediated epigenetic reprogramming of cells. Am. J. Cancer Res. 2011, 1, 98. [Google Scholar]
  55. Zernecke, A.; Bidzhekov, K.; Noels, H.; Shagdarsuren, E.; Gan, L.; Denecke, B.; Hristov, M.; Köppel, T.; Jahantigh, M.N.; Lutgens, E. Delivery of microRNA-126 by apoptotic bodies induces CXCL12-dependent vascular protection. Sci. Signal. 2009, 2, a81. [Google Scholar] [CrossRef] [Scilit]
  56. Deng, Z.; Poliakov, A.; Hardy, R.W.; Clements, R.; Liu, C.; Liu, Y.; Wang, J.; Xiang, X.; Zhang, S.; Zhuang, X. Adipose tissue exosome-like vesicles mediate activation of macrophage-induced insulin resistance. Diabetes 2009, 58, 2498–2505. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Ferrante, S.C.; Nadler, E.P.; Pillai, D.K.; Hubal, M.J.; Wang, Z.; Wang, J.M.; Gordish-Dressman, H.; Koeck, E.; Sevilla, S.; Wiles, A.A. Adipocyte-derived exosomal miRNAs: A novel mechanism for obesity-related disease. Pediatr. Res. 2015, 77, 447–454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Zanotti, S.; Gibertini, S.; Blasevich, F.; Bragato, C.; Ruggieri, A.; Saredi, S.; Fabbri, M.; Bernasconi, P.; Maggi, L.; Mantegazza, R. Exosomes and exosomal miRNAs from muscle-derived fibroblasts promote skeletal muscle fibrosis. Matrix Biol. 2018, 74, 77–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Cell culture and treatments. (A) 3T3-L1 cells were treated with miR-34a mimics or inhibitor (siRNA) and then were induced by adipocyte differentiation medium. (B) C2C12 cells were pre-treated by miR-34a mimics or inhibitor (siRNA) and treated with oleate or conditioned medium from the differentiation progress of 3T3-L1-derived adipocyte medium. The expression of adipogenic markers (i.e., Pparg, Cebpa, Fabp4, and Plin1) and the lipid droplet deposition in C2C12 cells were detected. (C) 3T3-L1 and C2C12 cells were co-cultured and treated with miR-34a mimics or inhibitor (siRNA) to detect the expression of adipogenic markers and lipid droplet deposition.
Figure 1. Cell culture and treatments. (A) 3T3-L1 cells were treated with miR-34a mimics or inhibitor (siRNA) and then were induced by adipocyte differentiation medium. (B) C2C12 cells were pre-treated by miR-34a mimics or inhibitor (siRNA) and treated with oleate or conditioned medium from the differentiation progress of 3T3-L1-derived adipocyte medium. The expression of adipogenic markers (i.e., Pparg, Cebpa, Fabp4, and Plin1) and the lipid droplet deposition in C2C12 cells were detected. (C) 3T3-L1 and C2C12 cells were co-cultured and treated with miR-34a mimics or inhibitor (siRNA) to detect the expression of adipogenic markers and lipid droplet deposition.
Cells 12 00167 g001
Figure 2. DE miRNAs significantly enriched in lipid storage and fatty acid metabolism signaling pathways. Volcano plot (A) demonstrated 8 upregulated miRNAs and 16 downregulated miRNAs (B) between high and low IMF-content muscles. GO (C) and KEGG (D) analysis indicated the enrichment of lipid storage and metabolism signaling pathways.
Figure 2. DE miRNAs significantly enriched in lipid storage and fatty acid metabolism signaling pathways. Volcano plot (A) demonstrated 8 upregulated miRNAs and 16 downregulated miRNAs (B) between high and low IMF-content muscles. GO (C) and KEGG (D) analysis indicated the enrichment of lipid storage and metabolism signaling pathways.
Cells 12 00167 g002
Figure 3. Functional enrichment analysis of co-expressed miRNAmRNA network. GO (A) and KEGG (B) analysis indicated the involvement of miR-34a/Lef1 in fat deposition.
Figure 3. Functional enrichment analysis of co-expressed miRNAmRNA network. GO (A) and KEGG (B) analysis indicated the involvement of miR-34a/Lef1 in fat deposition.
Cells 12 00167 g003
Figure 4. The expression pattern of miR-34a and Lef1 in different tissues and the differential process of 3T3-L1-derived adipocytes. miR-34a are highly expressed in liver, backfat, and muscle (A), and Lef1 was highly expressed in spleen, backfat and muscle (B). qPCR indicated miR-34a expression was higher in high IMF-content muscle (C), while Lef1 protein was lower in high IMF-content muscle detected using Western blot (D). The expression of miR-34a was gradually increased with the differentiation of 3T3-L1-derived adipocytes, while Lef1 was decreased (n = 4) (E). The expression of PpargG (n = 4) and lipid droplet accumulation were gradually increased during the differentiation of 3T3-L1 cells (F,G). The expression of genes or proteins were normalized to the corresponding housekeeping gene or protein (β-actin and U6 for qPCR and GAPDH for Western blot). * p < 0.05, *** p < 0.001 versus Control.
Figure 4. The expression pattern of miR-34a and Lef1 in different tissues and the differential process of 3T3-L1-derived adipocytes. miR-34a are highly expressed in liver, backfat, and muscle (A), and Lef1 was highly expressed in spleen, backfat and muscle (B). qPCR indicated miR-34a expression was higher in high IMF-content muscle (C), while Lef1 protein was lower in high IMF-content muscle detected using Western blot (D). The expression of miR-34a was gradually increased with the differentiation of 3T3-L1-derived adipocytes, while Lef1 was decreased (n = 4) (E). The expression of PpargG (n = 4) and lipid droplet accumulation were gradually increased during the differentiation of 3T3-L1 cells (F,G). The expression of genes or proteins were normalized to the corresponding housekeeping gene or protein (β-actin and U6 for qPCR and GAPDH for Western blot). * p < 0.05, *** p < 0.001 versus Control.
Cells 12 00167 g004
Figure 5. The targeting relationship and cellular location of miR-34a and Lef1. (A) The targeting relationship predicted with TargetScan and Starbase websites. (B) Luciferase reporter assay was performed to detect luciferase activity in HEK293 cells co-transfected with pmirGLO-Lef1-WT or pmirGLO-Lef1-MUT reporter and miR-34a mimics or NC. RNA FISH (C) indicated that miRA-34a was located in cytoplasm. Lef1 was transferred into the nucleus with the differentiation of 3T3-L1-derived adipocytes (0 d–6 d). *** p < 0.001 versus NC (n = 3).
Figure 5. The targeting relationship and cellular location of miR-34a and Lef1. (A) The targeting relationship predicted with TargetScan and Starbase websites. (B) Luciferase reporter assay was performed to detect luciferase activity in HEK293 cells co-transfected with pmirGLO-Lef1-WT or pmirGLO-Lef1-MUT reporter and miR-34a mimics or NC. RNA FISH (C) indicated that miRA-34a was located in cytoplasm. Lef1 was transferred into the nucleus with the differentiation of 3T3-L1-derived adipocytes (0 d–6 d). *** p < 0.001 versus NC (n = 3).
Cells 12 00167 g005
Figure 6. miR-34a overexpression promoted adipogenesis. (A) qPCR confirmed that 3T3-L1 cells stably overexpressed miR-34a after mimics treatments (n = 6). The expression of Pparg (B), Cebpa (C), Fabp4 (D), Plin1 (E), and Lef1 (F) on day 0 and day 8 during 3T3-L1-derived preadipocyte differentiation after miR-34a mimics (n = 6). The protein expression level of Pparγ (G), C/ebpα (H), β-catenin (I), and Lef1 (J) in NC and miR-34a mimics groups along with differentiation via Western blot (n = 3) (K). Lipid droplet accumulation in 3T3-L1 cells on day 0 and 8 of differentiation detected using BODIPY staining (L) and Oil Red O staining (M) in NC and miR-34a mimics groups. * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Figure 6. miR-34a overexpression promoted adipogenesis. (A) qPCR confirmed that 3T3-L1 cells stably overexpressed miR-34a after mimics treatments (n = 6). The expression of Pparg (B), Cebpa (C), Fabp4 (D), Plin1 (E), and Lef1 (F) on day 0 and day 8 during 3T3-L1-derived preadipocyte differentiation after miR-34a mimics (n = 6). The protein expression level of Pparγ (G), C/ebpα (H), β-catenin (I), and Lef1 (J) in NC and miR-34a mimics groups along with differentiation via Western blot (n = 3) (K). Lipid droplet accumulation in 3T3-L1 cells on day 0 and 8 of differentiation detected using BODIPY staining (L) and Oil Red O staining (M) in NC and miR-34a mimics groups. * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Cells 12 00167 g006
Figure 7. Silencing miR-34a suppresses adipogenesis. miR-34a inhibitor (siRNA) could efficiently decrease the expression of miR-34a in 3T3-L1 (n = 6) (A). The expression of Pparg (B), Cebpa (C), Fabp4 (D), Plin1 (E), and LEF1 (F) on day 0 and day 8 during 3T3-L1-derived preadipocyte differentiation after miR-34a silencing (n = 6). The protein expression level of Pparγ (G), C/ebpα (H), β-catenin (I), and Lef1 (J) in NC and miR-34a inhibitor groups along with differentiation via Western blot (n = 3) (K). Lipid droplet accumulation in 3T3-L1 cells on day 0 and 8 of differentiation detected using BODIPY staining (L) and Oil Red O staining (M) in NC and miR-34a inhibitor groups. * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Figure 7. Silencing miR-34a suppresses adipogenesis. miR-34a inhibitor (siRNA) could efficiently decrease the expression of miR-34a in 3T3-L1 (n = 6) (A). The expression of Pparg (B), Cebpa (C), Fabp4 (D), Plin1 (E), and LEF1 (F) on day 0 and day 8 during 3T3-L1-derived preadipocyte differentiation after miR-34a silencing (n = 6). The protein expression level of Pparγ (G), C/ebpα (H), β-catenin (I), and Lef1 (J) in NC and miR-34a inhibitor groups along with differentiation via Western blot (n = 3) (K). Lipid droplet accumulation in 3T3-L1 cells on day 0 and 8 of differentiation detected using BODIPY staining (L) and Oil Red O staining (M) in NC and miR-34a inhibitor groups. * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Cells 12 00167 g007
Figure 8. miR-34a abolished the suppressive function of overexpressed Lef1 on fat deposition during 3T3-L1 differentiation. The expression of Lef1 (A), Pparg (B), Cebpa (C), Fabp4 (D), and perilipin1 (E) after cells transfected with pcDNA3.1-Lef1, siLef1 and their corresponding control during cell differentiation (n = 6). The expression of Lef1 (F), Pparg (H), Cebpa (I), Fabp4 (J), and perilipin1 (K) after cells transfected with miR-34a mimics NC + pcDNA3.1 or mimics + pcDNA3.1-Lef1 or with miR-34a inhibitor NC + siNC or inhibitor + siLef1 during cell differentiation (n = 3). The protein expression of Lef1 during cell differentiation in the rescue experiment (n = 3) (G). * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Figure 8. miR-34a abolished the suppressive function of overexpressed Lef1 on fat deposition during 3T3-L1 differentiation. The expression of Lef1 (A), Pparg (B), Cebpa (C), Fabp4 (D), and perilipin1 (E) after cells transfected with pcDNA3.1-Lef1, siLef1 and their corresponding control during cell differentiation (n = 6). The expression of Lef1 (F), Pparg (H), Cebpa (I), Fabp4 (J), and perilipin1 (K) after cells transfected with miR-34a mimics NC + pcDNA3.1 or mimics + pcDNA3.1-Lef1 or with miR-34a inhibitor NC + siNC or inhibitor + siLef1 during cell differentiation (n = 3). The protein expression of Lef1 during cell differentiation in the rescue experiment (n = 3) (G). * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Cells 12 00167 g008
Figure 9. miR-34a positively regulates the expression of adipogenic genes in C2C12 cells. The expression of Myhc (A), Myod (B), Pparg (C), Cebpa (D), and Fabp4 (E), as well as immunofluorescence (F) and Oil Red O staining (G) assays when C2C12 induced by oleate for 24 h. The expression of Lef1 (H), Pparg (I), Cebpa (J), Fabp4 (K), and Plin1 (L), as well as immunofluorescence (M) and Oil Red O staining (N, n = 3), when C2C12 cells were transfected with the miR-34a mimics, inhibitor, or their corresponding controls. The scale bar of immunofluorescence was 25 μm and the magnification was 4×. The qPCR data showed the means of six independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Figure 9. miR-34a positively regulates the expression of adipogenic genes in C2C12 cells. The expression of Myhc (A), Myod (B), Pparg (C), Cebpa (D), and Fabp4 (E), as well as immunofluorescence (F) and Oil Red O staining (G) assays when C2C12 induced by oleate for 24 h. The expression of Lef1 (H), Pparg (I), Cebpa (J), Fabp4 (K), and Plin1 (L), as well as immunofluorescence (M) and Oil Red O staining (N, n = 3), when C2C12 cells were transfected with the miR-34a mimics, inhibitor, or their corresponding controls. The scale bar of immunofluorescence was 25 μm and the magnification was 4×. The qPCR data showed the means of six independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Cells 12 00167 g009
Figure 10. miR-34a/Lef1 regulated intramyocellular lipid deposition in co-culture system and C2C12 cells cultured with conditioned medium. The expression of MyHC (A), MyOD (B), Pparg (C), Cebpa (D), Fabp4 (E), and Lef1 (F), as well as Oil Red O staining [28] (G) in the co-culture of C2C12 and 3T3-L1 cells transfected with miR-34a mimics or inhibitor. The levels of Lef1 (H), Pparg (I), Cebpa (J), Fabp4 (K), as well as Oil Red O staining (L) in the C2C12 cells incubated in conditioned medium with different times of adipocyte differentiation. The magnification was 4×. The qPCR data showed the means of six independent experiments and the data of OD value (510 nm) showed the means of three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Figure 10. miR-34a/Lef1 regulated intramyocellular lipid deposition in co-culture system and C2C12 cells cultured with conditioned medium. The expression of MyHC (A), MyOD (B), Pparg (C), Cebpa (D), Fabp4 (E), and Lef1 (F), as well as Oil Red O staining [28] (G) in the co-culture of C2C12 and 3T3-L1 cells transfected with miR-34a mimics or inhibitor. The levels of Lef1 (H), Pparg (I), Cebpa (J), Fabp4 (K), as well as Oil Red O staining (L) in the C2C12 cells incubated in conditioned medium with different times of adipocyte differentiation. The magnification was 4×. The qPCR data showed the means of six independent experiments and the data of OD value (510 nm) showed the means of three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001 versus NC.
Cells 12 00167 g010
Figure 11. The process of miR-34a/Lef1 regulating adipogenesis. Lef1 transferred to nucleus and combined with β-catenin to suppress the transcription of adipogenic markers, such as Pparg, Cebpa, Fabp4, and Plin1, while the suppressive function of Lef1 can be inhibited by miR-34a.
Figure 11. The process of miR-34a/Lef1 regulating adipogenesis. Lef1 transferred to nucleus and combined with β-catenin to suppress the transcription of adipogenic markers, such as Pparg, Cebpa, Fabp4, and Plin1, while the suppressive function of Lef1 can be inhibited by miR-34a.
Cells 12 00167 g011
Table 1. Primers for qPCR analysis and the sequence of miR-34a mimics/inhibitor and si-Lef1 and their negative controls.
Table 1. Primers for qPCR analysis and the sequence of miR-34a mimics/inhibitor and si-Lef1 and their negative controls.
GeneAccession NumberSpeciesSequence (5′-3′)
MyhcAH002050 mouseF: GGAGCAGACGGAGAGGAGCAG
R: TTGGTGTTGATGAGGCTGGTGTTC
MyodM84918 mouseF: TCCAACTGCTCTGATGGCATGATG
R: ACTGTAGTAGGCGGTGTCGTAGC
Plin1NM_175640mouseF: GCACAACCTGGCAGCCTCTC
R: CTTCCTCCTCCTCGTCGTCTGTC
Fabp4CT010390mouseF: AAATCACCGCAGACGACAGGAAG
R: CATTCCACCACCAGCTTGTCACC
CebpaNM_001287523mouseF: GAGGGGAGGGACTTAGGTGTTGG
R: CCTGGCCTGTTGTAAGCTGAGTG
Lef1NM_010703mouseF: CAACTAGAAAGCCAGCGACCAGAG
R: GGAAAATGAAGACAGGAGCGAGAGG
LEF1NM_001129967sus scrofaF: GGGTCGGGCTGTGTGTGTTTC
R: CTCAGGGAGTCGGCAGTGGAG
PpargCT010340mouseF: GTTCGCCAAGGTGCTCCAGAAG
R: GTGAAGGCTCATGTCTGTCTCTGTC
PPARGNM_214379sus scrofaF: TCTGTGGACCTGTCGGTGATGG
R: TCAGCTCTCGGGAATGGGATGTC
β-actinAY618569mouseF: CAGATGTGGATCAGCAAGCAGGAG
R: CAGTAACAGTCCGCCTAGAAGCAC
β-ACTINAJ312193sus scrofaF: AATCCTGCGGCATCCACGAAAC
R: CAGCACCGTGTTGGCGTAGAG
miR-34aNR_029751mouse/sus scrofaF: CTGGCAGTGTCTTAGCTGGTTGTT
U6NM_015816mouse/sus scrofaF: ACGATACCCGCAAGGATGACA
miR-34a mimics mouseF: UGGCAGUGUCUUAGCUGGUUGU
R: AACCAGCUAAGACACUGCCAUU
mimicsNC mouseF: UUCUCCGAACGUGUCACGUTT
R: ACGUGACACGUUCGGAGAATT
miR-34ainhibitor mouseF: ACAACCAGCUAAGACACUGCCA
inhibitor NC mouseF: CAGUACUUUUGUGUAGUACAA
siLef1 mouseF: CGUCAGAUGUCAACUCCAATT
R: UUGGAGUUGACAUCUGACGTT
siNC mouseF: UUCUCCGAACGUGUCACGUTT
R: ACGUGACACGUUCGGAGAATT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, L.; Xie, Y.; Chen, W.; Zhang, Y.; Zeng, Y. miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1. Cells 2023, 12, 167. https://doi.org/10.3390/cells12010167

AMA Style

Wang L, Xie Y, Chen W, Zhang Y, Zeng Y. miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1. Cells. 2023; 12(1):167. https://doi.org/10.3390/cells12010167

Chicago/Turabian Style

Wang, Lixue, Yuhuai Xie, Wei Chen, Yu Zhang, and Yongqing Zeng. 2023. "miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1" Cells 12, no. 1: 167. https://doi.org/10.3390/cells12010167

APA Style

Wang, L., Xie, Y., Chen, W., Zhang, Y., & Zeng, Y. (2023). miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1. Cells, 12(1), 167. https://doi.org/10.3390/cells12010167

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop