Overexpression of Renin-B Induces Warburg-like Effects That Are Associated with Increased AKT/mTOR Signaling
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Overexpression of Renin Transcripts
2.2. RT-qPCR
2.3. Transcriptome Analysis
2.4. Glucose Consumption and Lactate Accumulation
2.5. ROS Detection
2.6. Western Blotting
2.7. Statistical Analyses
3. Results
3.1. Renin-B Overexpression Affects the Expression of Genes and microRNAs Known to Be Involved in a Warburg-like Phenotype
3.2. Renin-B Overexpression Induces Metabolic Alterations Involved in a Warburg-like Phenotype
3.3. Renin-B Increases AKT/mTOR Signaling as Detected by Transcriptome Profiling
3.4. Key Regulator Kinase AKT Is Activated by Renin-B
3.5. Renin-B-Induced Warburg-like Effects Are Associated with Increased ROS Accumulation
4. Discussion
5. Summary and Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Patra, K.C.; Hay, N. The pentose phosphate pathway and cancer. Trends Biochem. Sci. 2014, 39, 347–354. [Google Scholar] [CrossRef] [PubMed]
- Azuma, K.; Ikeda, K.; Inoue, S. Functional Mechanisms of Mitochondrial Respiratory Chain Supercomplex Assembly Factors and Their Involvement in Muscle Quality. Int. J. Mol. Sci. 2020, 21, 3182. [Google Scholar] [CrossRef] [PubMed]
- Clausmeyer, S.; Reinecke, A.; Farrenkopf, R.; Unger, T.; Peters, J. Tissue-specific expression of a rat renin transcript lacking the coding sequence for the prefragment and its stimulation by myocardial infarction. Endocrinology 2000, 141, 2963–2970. [Google Scholar] [CrossRef] [PubMed]
- Wanka, H.; Staar, D.; Lutze, P.; Peters, B.; Hildebrandt, J.; Beck, T.; Baumgen, I.; Albers, A.; Krieg, T.; Zimmermann, K.; et al. Anti-necrotic and cardioprotective effects of a cytosolic renin isoform under ischemia-related conditions. J. Mol. Med. 2016, 94, 61–69. [Google Scholar] [CrossRef]
- Lutze, P.; Wanka, H.; Bäumgen, I.; Staar, D.; Grunow, B.; Peters, J. An alternative promoter in intron1 of the renin gene is regulated by glucose starvation via serum response factor. Cell. Physiol. Biochem. 2017, 42, 1447–1457. [Google Scholar] [CrossRef]
- Wanka, H.; Lutze, P.; Staar, D.; Bracke, K.; Golchert, J.; Peters, J. Angiotensin dependent and angiotensin independent protective effects of renin-b in H9c2 cells after anoxia. Sci. Rep. 2020, 10, 19689. [Google Scholar] [CrossRef]
- Peters, J.; Kranzlin, B.; Schaeffer, S.; Zimmer, J.; Resch, S.; Bachmann, S.; Gretz, N.; Hackenthal, E. Presence of renin within intramitochondrial dense bodies of the rat adrenal cortex. Am. J. Physiol. 1996, 271, E439–E450. [Google Scholar] [CrossRef]
- Clausmeyer, S.; Sturzebecher, R.; Peters, J. An alternative transcript of the rat renin gene can result in a truncated prorenin that is transported into adrenal mitochondria. Circ. Res. 1999, 84, 337–344. [Google Scholar] [CrossRef]
- Wanka, H.; Kessler, N.; Ellmer, J.; Endlich, N.; Peters, B.S.; Clausmeyer, S.; Peters, J. Cytosolic renin is targeted to mitochondria and induces apoptosis in H9c2 rat cardiomyoblasts. J. Cell Mol. Med. 2009, 13, 2926–2937. [Google Scholar] [CrossRef]
- Lee-Kirsch, M.A.; Gaudet, F.; Cardoso, M.C.; Lindpaintner, K. Distinct renin isoforms generated by tissue-specific transcription initiation and alternative splicing. Circ. Res. 1999, 84, 240–246. [Google Scholar] [CrossRef]
- Ishigami, T.; Kino, T.; Chen, L.; Minegishi, S.; Araki, N.; Umemura, M.; Abe, K.; Sasaki, R.; Yamana, H.; Umemura, S. Identification of bona fide alternative renin transcripts expressed along cortical tubules and potential roles in promoting insulin resistance in vivo without significant plasma renin activity elevation. Hypertension 2014, 64, 125–133. [Google Scholar] [CrossRef][Green Version]
- Sinn, P.L.; Sigmund, C.D. Identification of three human renin mRNA isoforms from alternative tissue-specific transcriptional initiation. Physiol. Genom. 2000, 3, 25–31. [Google Scholar] [CrossRef] [PubMed]
- Wanka, H.; Lutze, P.; Staar, D.; Albers, A.; Baumgen, I.; Grunow, B.; Peters, J. Non-secretory renin reduces oxidative stress and increases cardiomyoblast survival during glucose and oxygen deprivation. Sci. Rep. 2020, 10, 2329. [Google Scholar] [CrossRef] [PubMed]
- Wanka, H.; Lutze, P.; Albers, A.; Golchert, J.; Staar, D.; Peters, J. Overexpression of Transcripts Coding for Renin-b but Not for Renin-a Reduce Oxidative Stress and Increase Cardiomyoblast Survival under Starvation Conditions. Cells 2021, 10, 1204. [Google Scholar] [CrossRef]
- Wanka, H.; Lutze, P.; Staar, D.; Grunow, B.; Peters, B.S.; Peters, J. An alternative renin isoform is cardioprotective by modulating mitochondrial metabolism. J. Cell Mol. Med. 2018, 22, 5991–6001. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Wu, H.; Dai, C.; Pan, Q.; Ding, Z.; Hu, D.; Ji, B.; Luo, Y.; Hu, X. Beyond Warburg effect--dual metabolic nature of cancer cells. Sci. Rep. 2014, 4, 4927. [Google Scholar] [CrossRef] [PubMed]
- Lunt, S.Y.; Vander Heiden, M.G. Aerobic glycolysis: Meeting the metabolic requirements of cell proliferation. Annu. Rev. Cell Dev. Biol. 2011, 27, 441–464. [Google Scholar] [CrossRef] [PubMed]
- Pouysségur, J.; Dayan, F.; Mazure, N.M. Hypoxia signalling in cancer and approaches to enforce tumour regression. Nature 2006, 441, 437–443. [Google Scholar] [CrossRef]
- Herzig, S.; Shaw, R.J. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 2018, 19, 121–135. [Google Scholar] [CrossRef]
- Boussif, O.; Lezoualc’h, F.; Zanta, M.A.; Mergny, M.D.; Scherman, D.; Demeneix, B.; Behr, J.P. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. Proc. Natl. Acad. Sci. USA 1995, 92, 7297–7301. [Google Scholar] [CrossRef]
- Liberti, M.V.; Locasale, J.W. The Warburg Effect: How Does it Benefit Cancer Cells? Trends Biochem. Sci. 2016, 41, 211–218. [Google Scholar] [CrossRef] [PubMed]
- Capettini, L.S.; Montecucco, F.; Mach, F.; Stergiopulos, N.; Santos, R.A.; da Silva, R.F. Role of renin-angiotensin system in inflammation, immunity and aging. Curr. Pharm. Des. 2012, 18, 963–970. [Google Scholar] [CrossRef]
- Yu, J.S.; Cui, W. Proliferation, survival and metabolism: The role of PI3K/AKT/mTOR signalling in pluripotency and cell fate determination. Development 2016, 143, 3050–3060. [Google Scholar] [CrossRef] [PubMed]
- Heras-Sandoval, D.; Pérez-Rojas, J.M.; Hernández-Damián, J.; Pedraza-Chaverri, J. The role of PI3K/AKT/mTOR pathway in the modulation of autophagy and the clearance of protein aggregates in neurodegeneration. Cell Signal. 2014, 26, 2694–2701. [Google Scholar] [CrossRef] [PubMed]
- Bhaskar, P.T.; Hay, N. The two TORCs and Akt. Dev. Cell 2007, 12, 487–502. [Google Scholar] [CrossRef]
- Inoki, K.; Li, Y.; Zhu, T.; Wu, J.; Guan, K.L. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat. Cell Biol. 2002, 4, 648–657. [Google Scholar] [CrossRef]
- Barrio, E.; Vecino, R.; Sánchez-Morán, I.; Rodríguez, C.; Suárez-Pindado, A.; Bolaños, J.P.; Almeida, A.; Delgado-Esteban, M. Preconditioning-Activated AKT Controls Neuronal Tolerance to Ischemia through the MDM2-p53 Pathway. Int. J. Mol. Sci. 2021, 22, 7275. [Google Scholar] [CrossRef]
- Faissner, A.; Heck, N.; Dobbertin, A.; Garwood, J. DSD-1-Proteoglycan/Phosphacan and receptor protein tyrosine phosphatase-beta isoforms during development and regeneration of neural tissues. Adv. Exp. Med. Biol. 2006, 557, 25–53. [Google Scholar] [CrossRef]
- Lawlor, M.A.; Alessi, D.R. PKB/Akt: A key mediator of cell proliferation, survival and insulin responses? J. Cell Sci. 2001, 114, 2903–2910. [Google Scholar] [CrossRef]
- Tan, S.X.; Ng, Y.; Burchfield, J.G.; Ramm, G.; Lambright, D.G.; Stöckli, J.; James, D.E. The Rab GTPase-activating protein TBC1D4/AS160 contains an atypical phosphotyrosine-binding domain that interacts with plasma membrane phospholipids to facilitate GLUT4 trafficking in adipocytes. Mol. Cell Biol. 2012, 32, 4946–4959. [Google Scholar] [CrossRef]
- Matsui, T.; Li, L.; Wu, J.C.; Cook, S.A.; Nagoshi, T.; Picard, M.H.; Liao, R.; Rosenzweig, A. Phenotypic spectrum caused by transgenic overexpression of activated Akt in the heart. J. Biol. Chem. 2002, 277, 22896–22901. [Google Scholar] [CrossRef]
- Kunuthur, S.P.; Mocanu, M.M.; Hemmings, B.A.; Hausenloy, D.J.; Yellon, D.M. The Akt1 isoform is an essential mediator of ischaemic preconditioning. J. Cell Mol. Med. 2012, 16, 1739–1749. [Google Scholar] [CrossRef]
- Peters, J.; Wanka, H.; Peters, B.; Hoffmann, S. A renin transcript lacking exon 1 encodes for a non-secretory intracellular renin that increases aldosterone production in transgenic rats. J. Cell Mol. Med. 2008, 12, 1229–1237. [Google Scholar] [CrossRef][Green Version]
- Fuglesteg, B.N.; Tiron, C.; Jonassen, A.K.; Mjøs, O.D.; Ytrehus, K. Pretreatment with insulin before ischaemia reduces infarct size in Langendorff-perfused rat hearts. Acta Physiol. 2009, 195, 273–282. [Google Scholar] [CrossRef]
- Jonassen, A.K.; Sack, M.N.; Mjøs, O.D.; Yellon, D.M. Myocardial protection by insulin at reperfusion requires early administration and is mediated via Akt and p70s6 kinase cell-survival signaling. Circ. Res. 2001, 89, 1191–1198. [Google Scholar] [CrossRef]
- Cho, H.; Mu, J.; Kim, J.K.; Thorvaldsen, J.L.; Chu, Q.; Crenshaw, E.B., 3rd; Kaestner, K.H.; Bartolomei, M.S.; Shulman, G.I.; Birnbaum, M.J. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 2001, 292, 1728–1731. [Google Scholar] [CrossRef]
- Takenaka, N.; Araki, N.; Satoh, T. Involvement of the protein kinase Akt2 in insulin-stimulated Rac1 activation leading to glucose uptake in mouse skeletal muscle. PLoS ONE 2019, 14, e0212219. [Google Scholar] [CrossRef]
- Wieman, H.L.; Wofford, J.A.; Rathmell, J.C. Cytokine stimulation promotes glucose uptake via phosphatidylinositol-3 kinase/Akt regulation of Glut1 activity and trafficking. Mol. Biol. Cell 2007, 18, 1437–1446. [Google Scholar] [CrossRef]
- Kanda, A.; Noda, K.; Yuki, K.; Ozawa, Y.; Furukawa, T.; Ichihara, A.; Ishida, S. Atp6ap2/(pro)renin receptor interacts with Par3 as a cell polarity determinant required for laminar formation during retinal development in mice. J. Neurosci. 2013, 33, 19341–19351. [Google Scholar] [CrossRef]
- Thorens, B.; Mueckler, M. Glucose transporters in the 21st Century. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E141–E145. [Google Scholar] [CrossRef]
- Holman, G.D. Structure, function and regulation of mammalian glucose transporters of the SLC2 family. Pflug. Arch. 2020, 472, 1155–1175. [Google Scholar] [CrossRef]
- Fajardo, V.M.; Feng, I.; Chen, B.Y.; Perez-Ramirez, C.A.; Shi, B.; Clark, P.; Tian, R.; Lien, C.L.; Pellegrini, M.; Christofk, H.; et al. GLUT1 overexpression enhances glucose metabolism and promotes neonatal heart regeneration. Sci. Rep. 2021, 11, 8669. [Google Scholar] [CrossRef]
- Fandos, C.; Sánchez-Feutrie, M.; Santalucía, T.; Viñals, F.; Cadefau, J.; Gumà, A.; Cussó, R.; Kaliman, P.; Canicio, J.; Palacín, M.; et al. GLUT1 glucose transporter gene transcription is repressed by Sp3. Evidence for a regulatory role of Sp3 during myogenesis. J. Mol. Biol. 1999, 294, 103–119. [Google Scholar] [CrossRef]
- Gottlob, K.; Majewski, N.; Kennedy, S.; Kandel, E.; Robey, R.B.; Hay, N. Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev. 2001, 15, 1406–1418. [Google Scholar] [CrossRef]
- Deprez, J.; Vertommen, D.; Alessi, D.R.; Hue, L.; Rider, M.H. Phosphorylation and activation of heart 6-phosphofructo-2-kinase by protein kinase B and other protein kinases of the insulin signaling cascades. J. Biol. Chem. 1997, 272, 17269–17275. [Google Scholar] [CrossRef]
- Manerba, M.; Di Ianni, L.; Govoni, M.; Comparone, A.; Di Stefano, G. The activation of lactate dehydrogenase induced by mTOR drives neoplastic change in breast epithelial cells. PLoS ONE 2018, 13, e0202588. [Google Scholar] [CrossRef]
- Yu, C.; Xue, J.; Zhu, W.; Jiao, Y.; Zhang, S.; Cao, J. Warburg meets non-coding RNAs: The emerging role of ncRNA in regulating the glucose metabolism of cancer cells. Tumour Biol. 2015, 36, 81–94. [Google Scholar] [CrossRef]
- Dubinsky, A.N.; Dastidar, S.G.; Hsu, C.L.; Zahra, R.; Djakovic, S.N.; Duarte, S.; Esau, C.C.; Spencer, B.; Ashe, T.D.; Fischer, K.M.; et al. Let-7 coordinately suppresses components of the amino acid sensing pathway to repress mTORC1 and induce autophagy. Cell Metab. 2014, 20, 626–638. [Google Scholar] [CrossRef]
- Yamasaki, T.; Seki, N.; Yoshino, H.; Itesako, T.; Yamada, Y.; Tatarano, S.; Hidaka, H.; Yonezawa, T.; Nakagawa, M.; Enokida, H. Tumor-suppressive microRNA-1291 directly regulates glucose transporter 1 in renal cell carcinoma. Cancer Sci. 2013, 104, 1411–1419. [Google Scholar] [CrossRef]
- Garofalo, M.; Di Leva, G.; Romano, G.; Nuovo, G.; Suh, S.S.; Ngankeu, A.; Taccioli, C.; Pichiorri, F.; Alder, H.; Secchiero, P.; et al. miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer Cell 2009, 16, 498–509. [Google Scholar] [CrossRef]
- Zhang, Y.; Yuan, F.; Liu, L.; Chen, Z.; Ma, X.; Lin, Z.; Zou, J. The Role of the miR-21/SPRY2 Axis in Modulating Proangiogenic Factors, Epithelial Phenotypes, and Wound Healing in Corneal Epithelial Cells. Investig. Ophthalmol. Vis. Sci. 2019, 60, 3854–3862. [Google Scholar] [CrossRef]
- Lu, H.; Forbes, R.A.; Verma, A. Hypoxia-inducible factor 1 activation by aerobic glycolysis implicates the Warburg effect in carcinogenesis. J. Biol. Chem. 2002, 277, 23111–23115. [Google Scholar] [CrossRef]
- Yang, M.; Soga, T.; Pollard, P.J.; Adam, J. The emerging role of fumarate as an oncometabolite. Front. Oncol. 2012, 2, 85. [Google Scholar] [CrossRef]
- McFate, T.; Mohyeldin, A.; Lu, H.; Thakar, J.; Henriques, J.; Halim, N.D.; Wu, H.; Schell, M.J.; Tsang, T.M.; Teahan, O.; et al. Pyruvate dehydrogenase complex activity controls metabolic and malignant phenotype in cancer cells. J. Biol. Chem. 2008, 283, 22700–22708. [Google Scholar] [CrossRef]
- Levine, A.J.; Puzio-Kuter, A.M. The control of the metabolic switch in cancers by oncogenes and tumor suppressor genes. Science 2010, 330, 1340–1344. [Google Scholar] [CrossRef]
- Peng, X.H.; Karna, P.; Cao, Z.; Jiang, B.H.; Zhou, M.; Yang, L. Cross-talk between epidermal growth factor receptor and hypoxia-inducible factor-1alpha signal pathways increases resista.ance to apoptosis by up-regulating survivin gene expression. J. Biol. Chem. 2006, 281, 25903–25914. [Google Scholar] [CrossRef]
- Hudson, C.C.; Liu, M.; Chiang, G.G.; Otterness, D.M.; Loomis, D.C.; Kaper, F.; Giaccia, A.J.; Abraham, R.T. Regulation of hypoxia-inducible factor 1alpha expression and function by the mammalian target of rapamycin. Mol. Cell Biol. 2002, 22, 7004–7014. [Google Scholar] [CrossRef]
- Movafagh, S.; Crook, S.; Vo, K. Regulation of hypoxia-inducible factor-1a by reactive oxygen species: New developments in an old debate. J. Cell. Biochem. 2015, 116, 696–703. [Google Scholar] [CrossRef]
- Quinlan, C.L.; Goncalves, R.L.; Hey-Mogensen, M.; Yadava, N.; Bunik, V.I.; Brand, M.D. The 2-oxoacid dehydrogenase complexes in mitochondria can produce superoxide/hydrogen peroxide at much higher rates than complex I. J. Biol. Chem. 2014, 289, 8312–8325. [Google Scholar] [CrossRef]
- Fisher-Wellman, K.H.; Gilliam, L.A.A.; Lin, C.T.; Cathey, B.L.; Lark, D.S.; Darrell Neufer, P. Mitochondrial glutathione depletion reveals a novel role for the pyruvate dehydrogenase complex as a key H2O2-emitting source under conditions of nutrient overload. Free Radic Biol. Med. 2013, 65, 1201–1208. [Google Scholar] [CrossRef]
- Chouchani, E.T.; Pell, V.R.; Gaude, E.; Aksentijević, D.; Sundier, S.Y.; Robb, E.L.; Logan, A.; Nadtochiy, S.M.; Ord, E.N.J.; Smith, A.C.; et al. Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS. Nature 2014, 515, 431–435. [Google Scholar] [CrossRef]
- Xiao, W.; Sarsour, E.H.; Wagner, B.A.; Doskey, C.M.; Buettner, G.R.; Domann, F.E.; Goswami, P.C. Succinate dehydrogenase activity regulates PCB3-quinone-induced metabolic oxidative stress and toxicity in HaCaT human keratinocytes. Arch. Toxicol. 2016, 90, 319–332. [Google Scholar] [CrossRef] [PubMed]
- Nakanishi, A.; Wada, Y.; Kitagishi, Y.; Matsuda, S. Link between PI3K/AKT/PTEN Pathway and NOX Proteinin Diseases. Aging Dis. 2014, 5, 203–211. [Google Scholar] [CrossRef] [PubMed]
- El-Benna, J.; Dang, P.M.; Gougerot-Pocidalo, M.A.; Marie, J.C.; Braut-Boucher, F. p47phox, the phagocyte NADPH oxidase/NOX2 organizer: Structure, phosphorylation and implication in diseases. Exp. Mol. Med. 2009, 41, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Leslie, N.R.; Bennett, D.; Lindsay, Y.E.; Stewart, H.; Gray, A.; Downes, C.P. Redox regulation of PI 3-kinase signalling via inactivation of PTEN. EMBO J. 2003, 22, 5501–5510. [Google Scholar] [CrossRef]
Transcript | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|
exon(1a–9) | exon 1a: TGAATTTCCCCAGTCAGTGAT | exon 2: GAATTCACCCCATTCAGCAC |
exon(2–9) | exon 6: GCTCCTGGCAGATCACCAT | exon 8: CCTGGCTACAGTTCACAACGTA |
Ywhaz | exon 2–3: CATCTGCAACGACGTACTGTCTCT | exon 3–4: GACTGGTCCACAATTCCTTTCTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Golchert, J.; Staar, D.; Bennewitz, J.; Hartmann, M.; Hoffmann, N.; Ameling, S.; Völker, U.; Peters, J.; Wanka, H. Overexpression of Renin-B Induces Warburg-like Effects That Are Associated with Increased AKT/mTOR Signaling. Cells 2022, 11, 1459. https://doi.org/10.3390/cells11091459
Golchert J, Staar D, Bennewitz J, Hartmann M, Hoffmann N, Ameling S, Völker U, Peters J, Wanka H. Overexpression of Renin-B Induces Warburg-like Effects That Are Associated with Increased AKT/mTOR Signaling. Cells. 2022; 11(9):1459. https://doi.org/10.3390/cells11091459
Chicago/Turabian StyleGolchert, Janine, Doreen Staar, Jonathan Bennewitz, Miriam Hartmann, Nadin Hoffmann, Sabine Ameling, Uwe Völker, Jörg Peters, and Heike Wanka. 2022. "Overexpression of Renin-B Induces Warburg-like Effects That Are Associated with Increased AKT/mTOR Signaling" Cells 11, no. 9: 1459. https://doi.org/10.3390/cells11091459
APA StyleGolchert, J., Staar, D., Bennewitz, J., Hartmann, M., Hoffmann, N., Ameling, S., Völker, U., Peters, J., & Wanka, H. (2022). Overexpression of Renin-B Induces Warburg-like Effects That Are Associated with Increased AKT/mTOR Signaling. Cells, 11(9), 1459. https://doi.org/10.3390/cells11091459