Estrogen-Inducible LncRNA BNAT1 Functions as a Modulator for Estrogen Receptor Signaling in Endocrine-Resistant Breast Cancer Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Reagents
2.2. qRT-PCR
2.3. RNA-Sequencing
2.4. Clinical Tissue Samples and Patient Data
2.5. ISH
2.6. siRNA Transfection
2.7. DNA Assay
2.8. Cell Cycle Analysis
2.9. Annexin V and PI Staining
2.10. In Vivo Tumor Formation and siRNA Treatment
2.11. Microarray and Pathway Analysis
2.12. Immunoblot Analysis
2.13. RNA Immunoprecipitation (RIP) Assay
2.14. Luciferase Assay
2.15. Statistical Analysis
3. Results
3.1. Identification of the Estrogen-Inducible LncRNA BNAT1
3.2. Correlation between BNAT1 Expression Levels and Clinicopathologic Characters in ER-Positive Breast Cancers
3.3. BNAT1 Silencing Represses Cell Proliferation whereas It Promotes Apoptosis in Estrogen-Sensitive and Endocrine-Resistant Breast Cancer Cells
3.4. BNAT1 Silencing Represses Estrogen Signaling and BNAT1 Preferentially Binds to ERα
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Yersal, O.; Barutca, S. Biological subtypes of breast cancer: Prognostic and therapeutic implications. World J. Clin. Oncol. 2014, 5, 412–424. [Google Scholar] [CrossRef]
- Mangelsdorf, D.J.; Thummel, C.; Beato, M.; Herrlich, P.; Schütz, G.; Umesono, K.; Blumberg, B.; Kastner, P.; Mark, M.; Chambon, P.; et al. The nuclear receptor superfamily: The second decade. Cell 1995, 83, 835–839. [Google Scholar]
- Jordan, V.C.; O’Malley, B.W. Selective estrogen-receptor modulators and antihormonal resistance in breast cancer. J. Clin. Oncol. 2007, 25, 5815–5824. [Google Scholar]
- Takayama, K.; Horie-Inoue, K.; Katayama, S.; Suzuki, T.; Tsutsumi, S.; Ikeda, K.; Urano, T.; Fujimura, T.; Takagi, K.; Takahashi, S.; et al. Androgen-responsive long noncoding RNA CTBP1-AS promotes prostate cancer. EMBO J. 2013, 32, 1665–1680. [Google Scholar] [CrossRef]
- Hah, N.; Murakami, S.; Nagari, A.; Danko, C.G.; Kraus, W.L. Enhancer transcripts mark active estrogen receptor binding sites. Genome Res. 2013, 23, 1210–1223. [Google Scholar]
- Li, W.; Notani, D.; Ma, Q.; Tanasa, B.; Nunez, E.; Chen, A.Y.; Merkurjev, D.; Zhang, J.; Ohgi, K.; Song, X.; et al. Functional roles of enhancer RNAs for oestrogen-dependent transcriptional activation. Nature 2013, 498, 516–520. [Google Scholar] [CrossRef]
- Li, W.; Hu, Y.; Oh, S.; Ma, Q.; Merkurjev, D.; Song, X.; Zhou, X.; Liu, Z.; Tanasa, B.; He, X.; et al. Condensin I and II Complexes License Full Estrogen Receptor α-Dependent Enhancer Activation. Mol. Cell 2015, 59, 188–202. [Google Scholar] [PubMed]
- Wang, X.; Arai, S.; Song, X.; Reichart, D.; Du, K.; Pascual, G.; Tempst, P.; Rosenfeld, M.G.; Glass, C.K.; Kurokawa, R. Induced ncRNAs allosterically modify RNA-binding proteins in cis to inhibit transcription. Nature 2008, 454, 126–130. [Google Scholar] [CrossRef]
- Ujihira, T.; Ikeda, K.; Suzuki, T.; Yamaga, R.; Sato, W.; Horie-Inoue, K.; Shigekawa, T.; Osaki, A.; Saeki, T.; Okamoto, K.; et al. MicroRNA-574-3p, identified by microRNA library-based functional screening, modulates tamoxifen response in breast cancer. Sci. Rep. 2015, 5, 7641. [Google Scholar] [CrossRef]
- Mitobe, Y.; Ikeda, K.; Suzuki, T.; Takagi, K.; Kawabata, H.; Horie-Inoue, K.; Inoue, S. ESR1-stabilizing long noncoding RNA TMPO-AS1 promotes hormone-refractory breast cancer progression. Mol. Cell Biol. 2019, 39, e00261-19. [Google Scholar] [CrossRef] [PubMed]
- Kinjo, S.; Monma, N.; Misu, S.; Kitamura, N.; Imoto, J.; Yoshitake, K.; Gojobori, T.; Ikeo, K. Maser: One-stop platform for NGS big data from analysis to visualization. Database 2018, 2018, bay027. [Google Scholar]
- Carlson, R.W.; McCormick, B. Update: NCCN breast cancer Clinical Practice Guidelines. J. Natl. Compr. Cancer Netw. 2005, 3 (Suppl. S1), S7–S11. [Google Scholar] [PubMed]
- Sobin, L.H.; Gospodarowicsz, M.K.; Wittekind, C. TNM Classification of Malignant Tumors, 7th ed.; John Wiley & Sons: New York, NY, USA, 2009. [Google Scholar]
- Suzuki, Y.; Kitahara, S.; Suematsu, T.; Oshima, M.; Sato, Y. Requisite role of vasohibin-2 in spontaneous gastric cancer formation and accumulation of cancer-associated fibroblasts. Cancer Sci. 2017, 108, 2342–2351. [Google Scholar] [CrossRef] [PubMed]
- Mitobe, Y.; Iino, K.; Takayama, K.; Ikeda, K.; Suzuki, T.; Aogi, K.; Kawabata, H.; Suzuki, Y.; Horie-Inoue, K.; Inoue, S. PSF Promotes ER-Positive Breast Cancer Progression via Posttranscriptional Regulation of ESR1 and SCFD2. Cancer Res. 2020, 80, 2230–2242. [Google Scholar] [CrossRef]
- Takeiwa, T.; Ikeda, K.; Suzuki, T.; Sato, W.; Iino, K.; Mitobe, Y.; Kawabata, H.; Horie, K.; Inoue, S. PSPC1 is a potential prognostic marker for hormone-dependent breast cancer patients and modulates RNA processing of ESR1 and SCFD2. Sci. Rep. 2022, 12, 9495. [Google Scholar] [CrossRef]
- Ross-Innes, C.S.; Stark, R.; Teschendorff, A.E.; Holmes, K.A.; Ali, H.R.; Dunning, M.J.; Brown, G.D.; Gojis, O.; Ellis, I.O.; Green, A.R.; et al. Differential oestrogen receptor binding is associated with clinical outcome in breast cancer. Nature 2012, 481, 389–393. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Li, W.; Zhang, Y.; Yuan, X.; Xu, K.; Yu, J.; Chen, Z.; Beroukhim, R.; Wang, H.; Lupien, M.; et al. Androgen receptor regulates a distinct transcription program in androgen-independent prostate cancer. Cell 2009, 138, 245–256. [Google Scholar] [CrossRef]
- Xu, Y.; Huangyang, P.; Wang, Y.; Xue, L.; Devericks, E.; Nguyen, H.G.; Yu, X.; Oses-Prieto, J.A.; Burlingame, A.L.; Miglani, S.; et al. ERα is an RNA-binding protein sustaining tumor cell survival and drug resistance. Cell 2021, 184, 5215–5229. [Google Scholar]
- Yamaga, R.; Ikeda, K.; Horie-Inoue, K.; Ouchi, Y.; Suzuki, Y.; Inoue, S. RNA sequencing of MCF-7 breast cancer cells identifies novel estrogen-responsive genes with functional estrogen receptor-binding sites in the vicinity of their transcription start sites. Horm. Cancer 2013, 4, 222–232. [Google Scholar]
- Cancer Genome Atlas Network. Comprehensive molecular portraits of human breast tumours. Nature 2012, 490, 61–70. [Google Scholar] [CrossRef] [PubMed]
- Roy, P.G.; Pratt, N.; Purdie, C.A.; Baker, L.; Ashfield, A.; Quinlan, P.; Thompson, A.M. High CCND1 amplification identifies a group of poor prognosis women with estrogen receptor positive breast cancer. Int. J. Cancer 2010, 127, 355–360. [Google Scholar] [CrossRef] [PubMed]
- Hanker, A.B.; Sudhan, D.R.; Arteaga, C.L. Overcoming Endocrine Resistance in Breast Cancer. Cancer Cell 2020, 37, 496–513. [Google Scholar] [CrossRef]
- Mitobe, Y.; Ikeda, K.; Sato, W.; Kodama, Y.; Naito, M.; Gotoh, N.; Miyata, K.; Kataoka, K.; Sasaki, H.; Horie-Inoue, K.; et al. Proliferation-associated long noncoding RNA, TMPO-AS1, is a potential therapeutic target for triple-negative breast cancer. Cancer Sci. 2020, 111, 2440–2450. [Google Scholar] [CrossRef] [PubMed]
- Tomita, S.; Abdalla, M.O.A.; Fujiwara, S.; Matsumori, H.; Maehara, K.; Ohkawa, Y.; Iwase, H.; Saitoh, N.; Nakao, M. A cluster of noncoding RNAs activates the ESR1 locus during breast cancer adaptation. Nat. Commun. 2015, 6, 6966. [Google Scholar] [CrossRef]
- Abdalla, M.O.A.; Yamamoto, T.; Maehara, K.; Nogami, J.; Ohkawa, Y.; Miura, H.; Poonperm, R.; Hiratani, I.; Nakayama, H.; Nakao, M.; et al. The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis. Nat. Commun. 2019, 10, 3778. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer |
---|---|---|
BNAT1 | GCCAGGGCTCATCTCCTATG | GGAGATCAGGGAGACTGGAGACT |
RPLP0 | CCACGCTGCTGAACATGCT | GATGCTGCCATTGTCGAACA |
ESR1 | AGACGGACCAAAGCCACTTG | CCCCGTGATGTAATACTTTTG |
CCND1 | TGCCCTCTGTGCCACAGAT | CCGCTGCCACCATGGA |
siRNA | Sense | Antisense |
---|---|---|
siBNAT1 #A | GCACUGUGAGGAAGGAAAUTT | AUUUCCUUCCUCACAGUGCTT |
siBNAT1 #B | GGACCAAACAGCGUAGUCUCC | AGACUACGCUGUUUGGUCCAG |
siESR1 | GCCUAGCUUGCCGUAAUGAUU | UCAUUACGGCAAGCUAGGCAA |
Parameter | BNAT1 Status | p-Value | |
---|---|---|---|
+ (n = 49) | – (n = 66) | ||
Age 1 (years) | 52.7 ± 1.7 | 53.3 ± 1.4 | 0.78 |
Stage | |||
I | 19 | 40 | |
II | 26 | 24 | |
III | 4 | 2 | 0.054 |
Pathological T factor (pT) | |||
pT1 | 24 | 18 | |
pT2–4 | 25 | 48 | 0.017 |
Pathological N factor (pN) | |||
pN0–1 | 34 | 54 | |
pN2–3 | 15 | 12 | 0.12 |
Histological grade | |||
1–2 | 43 | 57 | |
3 | 6 | 9 | 0.83 |
HER2 status | |||
Positive | 7 | 6 | |
Negative | 42 | 60 | 0.38 |
Variable | Univariate p-Value | Multivariate p-Value 2 | Relative Risk (95% CI) |
---|---|---|---|
pN | 0.0019 1 | 0.015 | 3.53 (1.28–9.72) |
(pN0–1 vs. pN2–3) | |||
pT | 0.0071 1 | 0.072 | 2.73 (0.92–8.19) |
(pT1 vs. pT2–4) | |||
BNAT1 status | 0.011 1 | 0.046 | 3.23 (1.02–10.22) |
(negative vs. positive) | |||
HER2 status | 0.45 | ||
(negative vs. positive) | |||
Histological grade | 0.50 | ||
(1,2 vs. 3) | |||
Age | 0.70 | ||
(<50 vs. 50) |
GO ID | Term | p-Value |
---|---|---|
GO:0051301 | cell division | 2.1E-44 |
GO:0000070 | mitotic sister chromatid segregation | 1.5E-19 |
GO:0007059 | chromosome segregation | 2.1E-18 |
GO:0006334 | nucleosome assembly | 2.5E-17 |
GO:0007049 | cell cycle | 1.0E-15 |
GO ID. | Term | p-Value |
---|---|---|
GO:0098742 | cell-cell adhesion via plasma–membrane adhesion molecules | 5.50E-04 |
GO:0042060 | wound healing | 8.50E-04 |
GO:0007275 | multicellular organism development | 2.00E-03 |
GO:0034332 | adherens junction organization | 5.50E-03 |
GO:0007043 | cell-cell junction assembly | 1.10E-02 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Horie, K.; Takagi, K.; Takeiwa, T.; Mitobe, Y.; Kawabata, H.; Suzuki, T.; Ikeda, K.; Inoue, S. Estrogen-Inducible LncRNA BNAT1 Functions as a Modulator for Estrogen Receptor Signaling in Endocrine-Resistant Breast Cancer Cells. Cells 2022, 11, 3610. https://doi.org/10.3390/cells11223610
Horie K, Takagi K, Takeiwa T, Mitobe Y, Kawabata H, Suzuki T, Ikeda K, Inoue S. Estrogen-Inducible LncRNA BNAT1 Functions as a Modulator for Estrogen Receptor Signaling in Endocrine-Resistant Breast Cancer Cells. Cells. 2022; 11(22):3610. https://doi.org/10.3390/cells11223610
Chicago/Turabian StyleHorie, Kuniko, Kiyoshi Takagi, Toshihiko Takeiwa, Yuichi Mitobe, Hidetaka Kawabata, Takashi Suzuki, Kazuhiro Ikeda, and Satoshi Inoue. 2022. "Estrogen-Inducible LncRNA BNAT1 Functions as a Modulator for Estrogen Receptor Signaling in Endocrine-Resistant Breast Cancer Cells" Cells 11, no. 22: 3610. https://doi.org/10.3390/cells11223610
APA StyleHorie, K., Takagi, K., Takeiwa, T., Mitobe, Y., Kawabata, H., Suzuki, T., Ikeda, K., & Inoue, S. (2022). Estrogen-Inducible LncRNA BNAT1 Functions as a Modulator for Estrogen Receptor Signaling in Endocrine-Resistant Breast Cancer Cells. Cells, 11(22), 3610. https://doi.org/10.3390/cells11223610