Generation of a NES-mScarlet Red Fluorescent Reporter Human iPSC Line for Live Cell Imaging and Flow Cytometric Analysis and Sorting Using CRISPR-Cas9-Mediated Gene Editing
Abstract
:1. Introduction
2. Materials and Methods
2.1. hiPSC Cell Culture for Gene Targeting
2.2. Targeting of the Human NESTIN Locus
2.3. PCR Genotyping
2.4. Karyotype Analysis
2.5. Off-Target Site Prediction and Analysis
2.6. Directed Differentiation of hiPSCs into mDA Neurons
2.7. Reverse Transcription and Quantitative Polymerase Chain Reaction (RT-qPCR)
2.8. Immunocytochemistry (ICC)
2.9. Cell Counting
2.10. Enzyme-Linked Immunosorbent Assay (ELISA) for Catecholamines
2.11. Western Blot (WB)
2.12. Live Cell and Ca2+ Imaging
2.13. Flow Cytometry and Fluorescence-Activated Cell Sorting
2.14. Statistical Analysis
3. Results
3.1. Generation of NES-mScarlet Reporter hiPSCs
3.2. NES-mScarlet hiPSCs Retain Expression of Pluripotency Marker Genes
3.3. NES-mScarlet hiPSCs Differentiate into Ventral Midbrain Human Neural Stem and Progenitor Cells
3.4. NES-mScarlet hiPSCs Differentiate into Mature Midbrain Dopaminergic Neurons
3.5. NES-mScarlet hiPSCs Are Accurate Reporter Cells of Human Neural Stem/Progenitor Cells
3.6. NES-mScarlet hiPSCs Are Suitable for Live Cell Imaging and Flow Cytometric Analysis and Cell Sorting
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A. NES-mScarlet Vector Sequence (6151 bp)
Appendix B
Medium Name | Added Factors | Ingredients | Final Concentration |
---|---|---|---|
hiPSC-medium | StemMACS™ iPS-Brew medium | 1x | |
N2 medium | DMEM:F12 and Neurobasal | 1:1 mixture | |
N-2 supplement | 1% vol/vol | ||
GlutaMAX | 1% vol/vol (2 mM) | ||
Penicillin/streptomycin | 0.2% vol/vol | ||
+d0–d9: | SB431542 (TGFβ inhibitor) | 10 µM | |
+d0–d10: | Recombinant human Noggin (BMP inhibitor) | 100 ng/mL | |
Recombinant human SHH-C24II | 375 ng/mL | ||
+d2–d10: | Recombinant human FGF8b | 100 ng/mL | |
+d3–d10: | CHIR99021 (GSK3β inhibitor) | 0.6 µM | |
Freezing medium | DMEM:F12 and Neurobasal | 1:1 mixture | |
N-2 supplement | 1% vol/vol | ||
B-27 supplement without vitamin A | 4% vol/vol | ||
GlutaMAX | 1% vol/vol (2 mM) | ||
DMSO | 10% vol/vol | ||
B27 medium | Neurobasal | ||
B-27 supplement without vitamin A | 2% vol/vol | ||
GlutaMAX | 1% vol/vol (2 mM) | ||
Penicillin/streptomycin | 0.2% vol/vol | ||
+d10–d16: | Recombinant human FGF8b | 100 ng/mL | |
CHIR99021 (GSK3β inhibitor) | 0.6 µM | ||
+d10–remaining culture time | Recombinant human BDNF | 20 ng/mL | |
L-Ascorbic acid | 0.2 mM | ||
+d16–remaining culture time | Recombinant human GDNF | 10 ng/mL | |
Dibutyryl-cyclic AMP (db-cAMP) | 500 µM | ||
N-[(3,5-difluorophenyl)acetyl]-l-alanyl-2-phenyl]glycine-1, 1-dimethylethyl ester (DAPT) | 1 µM |
References
- Kelava, I.; Lancaster, M.A. Stem Cell Models of Human Brain Development. Cell Stem Cell 2016, 18, 736–748. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.; Koo, B.-K.; Knoblich, J.A. Human organoids: Model systems for human biology and medicine. Nat. Rev. Mol. Cell Biol. 2020, 21, 571–584. [Google Scholar] [CrossRef]
- Rowe, R.G.; Daley, G.Q. Induced pluripotent stem cells in disease modelling and drug discovery. Nat. Rev. Genet. 2019, 20, 377–388. [Google Scholar] [CrossRef]
- Sterneckert, J.L.; Reinhardt, P.; Scholer, H.R. Investigating human disease using stem cell models. Nat. Rev. Genet. 2014, 15, 625–639. [Google Scholar] [CrossRef]
- Goldman, S.A. Stem and Progenitor Cell-Based Therapy of the Central Nervous System: Hopes, Hype, and Wishful Thinking. Cell Stem Cell 2016, 18, 174–188. [Google Scholar] [CrossRef] [Green Version]
- Parmar, M.; Grealish, S.; Henchcliffe, C. The future of stem cell therapies for Parkinson disease. Nat. Rev. Neurosci. 2020, 21, 103–115. [Google Scholar] [CrossRef]
- Balestrino, R.; Schapira, A.H.V. Parkinson disease. Eur. J. Neurol. 2020, 27, 27–42. [Google Scholar] [CrossRef]
- Kim, T.W.; Koo, S.Y.; Studer, L. Pluripotent Stem Cell Therapies for Parkinson Disease: Present Challenges and Future Opportunities. Front. Cell Dev. Biol. 2020, 8, 729. [Google Scholar] [CrossRef]
- Parmar, M. Towards stem cell based therapies for Parkinson’s disease. Development 2018, 145, dev156117. [Google Scholar] [CrossRef] [Green Version]
- Poulin, J.-F.; Gaertner, Z.; Moreno-Ramos, O.A.; Awatramani, R. Classification of Midbrain Dopamine Neurons Using Single-Cell Gene Expression Profiling Approaches. Trends Neurosci. 2020, 43, 155–169. [Google Scholar] [CrossRef]
- Blaess, S.; Ang, S.-L. Genetic control of midbrain dopaminergic neuron development. Wiley Interdiscip. Rev. Dev. Biol. 2015, 4, 113–134. [Google Scholar] [CrossRef]
- La Manno, G.; Gyllborg, D.; Codeluppi, S.; Nishimura, K.; Salto, C.; Zeisel, A.; Borm, L.E.; Stott, S.R.W.; Toledo, E.M.; Villaescusa, J.C.; et al. Molecular Diversity of Midbrain Development in Mouse, Human, and Stem Cells. Cell 2016, 167, 566–580. [Google Scholar] [CrossRef] [Green Version]
- Nolbrant, S.; Heuer, A.; Parmar, M.; Kirkeby, A. Generation of high-purity human ventral midbrain dopaminergic progenitors for in vitro maturation and intracerebral transplantation. Nat. Protoc. 2017, 12, 1962–1979. [Google Scholar] [CrossRef]
- Bernal, A.; Arranz, L. Nestin-expressing progenitor cells: Function, identity and therapeutic implications. Cell. Mol. Life Sci. 2018, 75, 2177–2195. [Google Scholar] [CrossRef] [Green Version]
- Kim, K.; Higashi, M.; Fumino, S.; Tajiri, T. Derivation of neural stem cells from human teratomas. Stem Cell Res. 2019, 41, 101633. [Google Scholar] [CrossRef]
- Eze, U.C.; Bhaduri, A.; Haeussler, M.; Nowakowski, T.J.; Kriegstein, A.R. Single-cell atlas of early human brain development highlights heterogeneity of human neuroepithelial cells and early radial glia. Nat. Neurosci. 2021, 24, 584–594. [Google Scholar] [CrossRef]
- Lee, Y.; Choi, H.Y.; Kwon, A.; Park, H.; Park, M.; Kim, Y.-O.; Kwak, S.; Koo, S.K. Generation of a NESTIN-EGFP reporter human induced pluripotent stem cell line, KSCBi005-A-1, using CRISPR/Cas9 nuclease. Stem Cell Res. 2019, 40, 101554. [Google Scholar] [CrossRef]
- Noisa, P.; Urrutikoetxea-Uriguen, A.; Li, M.; Cui, W. Generation of human embryonic stem cell reporter lines expressing GFP specifically in neural progenitors. Stem Cell Rev. Rep. 2010, 6, 438–449. [Google Scholar] [CrossRef]
- Wang, X.; Sterr, M.; Burtscher, I.; Chen, S.; Hieronimus, A.; Machicao, F.; Staiger, H.; Häring, H.-U.; Lederer, G.; Meitinger, T.; et al. Genome-wide analysis of PDX1 target genes in human pancreatic progenitors. Mol. Metab. 2018, 9, 57–68. [Google Scholar] [CrossRef]
- Yumlu, S.; Bashir, S.; Stumm, J.; Kühn, R. Efficient Gene Editing of Human Induced Pluripotent Stem Cells Using CRISPR/Cas9. Methods Mol. Biol. 2019, 1961, 137–151. [Google Scholar] [CrossRef]
- Li, X.-L.; Li, G.-H.; Fu, J.; Fu, Y.-W.; Zhang, L.; Chen, W.; Arakaki, C.; Zhang, J.-P.; Wen, W.; Zhao, M.; et al. Highly efficient genome editing via CRISPR-Cas9 in human pluripotent stem cells is achieved by transient BCL-XL overexpression. Nucleic Acids Res. 2018, 46, 10195–10215. [Google Scholar] [CrossRef]
- Fang, J.; Qian, J.-J.; Yi, S.; Harding, T.C.; Tu, G.H.; VanRoey, M.; Jooss, K. Stable antibody expression at therapeutic levels using the 2A peptide. Nat. Biotechnol. 2005, 23, 584–590. [Google Scholar] [CrossRef]
- Bindels, D.S.; Haarbosch, L.; van Weeren, L.; Postma, M.; Wiese, K.E.; Mastop, M.; Aumonier, S.; Gotthard, G.; Royant, A.; Hink, M.A.; et al. mScarlet: A bright monomeric red fluorescent protein for cellular imaging. Nat. Methods 2017, 14, 53–56. [Google Scholar] [CrossRef] [PubMed]
- Haeussler, M.; Schönig, K.; Eckert, H.; Eschstruth, A.; Mianné, J.; Renaud, J.-B.; Schneider-Maunoury, S.; Shkumatava, A.; Teboul, L.; Kent, J.; et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 2016, 17, 148. [Google Scholar] [CrossRef]
- de Rus Jacquet, A. Preparation and Co-Culture of iPSC-Derived Dopaminergic Neurons and Astrocytes. Curr. Protoc. Cell Biol. 2019, 85, e98. [Google Scholar] [CrossRef] [Green Version]
- Kriks, S.; Shim, J.W.; Piao, J.; Ganat, Y.M.; Wakeman, D.R.; Xie, Z.; Carrillo-Reid, L.; Auyeung, G.; Antonacci, C.; Buch, A.; et al. Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson’s disease. Nature 2011, 480, 547–551. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Anderson, N.C.; Chen, P.-F.; Meganathan, K.; Afshar Saber, W.; Petersen, A.J.; Bhattacharyya, A.; Kroll, K.L.; Sahin, M. Balancing serendipity and reproducibility: Pluripotent stem cells as experimental systems for intellectual and developmental disorders. Stem Cell Rep. 2021, 16, 1446–1457. [Google Scholar] [CrossRef]
- Kim, T.W.; Piao, J.; Koo, S.Y.; Kriks, S.; Chung, S.Y.; Betel, D.; Socci, N.D.; Choi, S.J.; Zabierowski, S.; Dubose, B.N.; et al. Biphasic Activation of WNT Signaling Facilitates the Derivation of Midbrain Dopamine Neurons from hESCs for Translational Use. Cell Stem Cell 2021, 28, 343–355. [Google Scholar] [CrossRef]
- Fischer, T.; Faus-Kessler, T.; Welzl, G.; Simeone, A.; Wurst, W.; Prakash, N. Fgf15-mediated control of neurogenic and proneural gene expression regulates dorsal midbrain neurogenesis. Dev. Biol. 2011, 350, 496–510. [Google Scholar] [CrossRef] [Green Version]
- Carola, G.; Malagarriga, D.; Calatayud, C.; Pons-Espinal, M.; Blasco-Agell, L.; Richaud-Patin, Y.; Fernandez-Carasa, I.; Baruffi, V.; Beltramone, S.; Molina, E.; et al. Parkinson’s disease patient-specific neuronal networks carrying the LRRK2 G2019S mutation unveil early functional alterations that predate neurodegeneration. NPJ Parkinsons Dis. 2021, 7, 55. [Google Scholar] [CrossRef]
- Rienecker, K.D.A.; Poston, R.G.; Saha, R.N. Merits and Limitations of Studying Neuronal Depolarization-Dependent Processes Using Elevated External Potassium. ASN Neuro 2020, 12, 1–17. [Google Scholar] [CrossRef]
- Heidenreich, M.; Zhang, F. Applications of CRISPR-Cas systems in neuroscience. Nat. Rev. Neurosci. 2016, 17, 36–44. [Google Scholar] [CrossRef] [Green Version]
- Lothian, C.; Prakash, N.; Lendahl, U.; Wahlström, G.M. Identification of both general and region-specific embryonic CNS enhancer elements in the nestin promoter. Exp. Cell Res. 1999, 248, 509–519. [Google Scholar] [CrossRef]
- Li, W.; Chen, S.; Li, J.-Y. Human induced pluripotent stem cells in Parkinson’s disease: A novel cell source of cell therapy and disease modeling. Prog. Neurobiol. 2015, 134, 161–177. [Google Scholar] [CrossRef] [Green Version]
- Oosterveen, T.; Garção, P.; Moles-Garcia, E.; Soleilhavoup, C.; Travaglio, M.; Sheraz, S.; Peltrini, R.; Patrick, K.; Labas, V.; Combes-Soia, L.; et al. Pluripotent stem cell derived dopaminergic subpopulations model the selective neuron degeneration in Parkinson’s disease. Stem Cell Rep. 2021, 16, 2718–2735. [Google Scholar] [CrossRef]
- Nouri, P.; Götz, S.; Rauser, B.; Irmler, M.; Peng, C.; Trümbach, D.; Kempny, C.; Lechermeier, C.G.; Bryniok, A.; Dlugos, A.; et al. Dose-Dependent and Subset-Specific Regulation of Midbrain Dopaminergic Neuron Differentiation by LEF1-Mediated WNT1/b-Catenin Signaling. Front. Cell Dev. Biol. 2020, 8, 587778. [Google Scholar] [CrossRef]
- Zimmerman, L.; Lendahl, U.; Cunningham, M.; McKay, R.; Parr, B.; Gavin, B.; Mann, J.; Vassileva, G.; McMahon, A. Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors. Neuron 1994, 12, 11–24. [Google Scholar] [CrossRef]
Name | Sequence (5′–3′) |
---|---|
P1 | GTGGGATGGAGGATGCAGGC |
P2 | GCTCCTTTGCCACACCCCTT |
P3 | GAGTTCATGCGGTTCAAGGTGC |
P4 | CCAGCCCATTGTCTTCTTCTGC |
P5 | CAGGCCATCTGACCAGGGAAGA |
P6 | GCACCTTGAACCGCATGAACTC |
P7 | GGGATTGACTCCAAACTGGAGC |
P8 | GCAGAAGAAGACAATGGGCTGG |
Marker Gene (Stage/Region/Type) | Forward Primer (5′–3′) Reverse Primer (5′–3′) | Tm (°C) | Product Size (bp) |
---|---|---|---|
ACTB (housekeeping gene) | GCACAGAGCCTCGCCTT | 59.68 | 112 |
CCTTGCACATGCCGGAG | 58.38 | ||
ALDH1A1 (SNc DA neurons) | ATCAAAGAAGCTGCCGGGAA | 59.96 | 101 |
GCATTGTCCAAGTCGGCATC | 59.90 | ||
BARHL1 (forebrain) | GTACCAGAACCGCAGGACTAAA | 60.03 | 113 |
AGAAATAAGGCGACGGGAACAT | 60.09 | ||
CALB1 (VTA DA neurons) | ACGCTGAGCTTTTGCTCACT | 60.53 | 101 |
GCAGGTGGGATTCTGCCATT | 60.69 | ||
CCK (VTA DA neurons) | AAGTGACCGGGACTACATGG | 59.10 | 119 |
TGGGTTGGGAGGTTGCTTC | 59.85 | ||
DDC (mDA neurons) | GACACCATGAACGCAAGTGAAT | 59.77 | 93 |
GACCTGGCGTCCCTCAATG | 60.45 | ||
DRD2 (SNc DA neurons) | GCGAGCATCCTGAACTTGTG | 59.55 | 90 |
CTTGGAGCTGTAGCGCGTAT | 60.25 | ||
EN1 (VM/mDA NPCs) | CGTGGCTTACTCCCCATTTA | 57.30 | 117 |
TCTCGCTGTCTCTCCCTCTC | 60.11 | ||
FOXA2 (VM/mDA NPCs) | CCGTTCTCCATCAACAACCT | 57.81 | 114 |
GGGGTAGTGCATCACCTGTT | 59.67 | ||
FOXG1 (forebrain) | TGGCCCATGTCGCCCTTCCT | 66.25 | 77 |
GCCGACGTGGTGCCGTTGTA | 65.70 | ||
HOXA2 (hindbrain) | CGTCGCTCGCTGAGTGCCTG | 66.07 | 92 |
TGTCGAGTGTGAAAGCGTCGAGG | 65.02 | ||
LMX1A (mDA NPCs) | CGCATCGTTTCTTCTCCTCT | 57.71 | 150 |
CAGACAGACTTGGGGCTCAC | 60.32 | ||
NANOG (pluripotency) | TGAACCTCAGCTACAAACAG | 55.32 | 138 |
TGGTGGTAGGAAGAGTAAAG | 53.69 | ||
NES (NSCs) | GCGTTGGAACAGAGGTTGGA | 60.53 | 327 |
TGGGAGCAAAGATCCAAGAC | 57.50 | ||
NES-mScarlet (bicistronic mRNA) | GTTCCTGAAGTTCACTCAGAGGG | 60.56 | 72 |
CTCGCCCTCGATCTCGAACT | 60.44 | ||
OTX2 (VM/mDA NPCs) | ACAAGTGGCCAATTCACTCC | 58.38 | 62 |
GAGGTGGACAAGGGATCTGA | 58.43 | ||
PAX6 (forebrain, neural rosettes) | TAAGGATGTTGAACGGGCAG | 58.67 | 126 |
TGGTATTCTCTCCCCCTCCT | 57.89 | ||
PITX3 (mDA neurons) | AGAGGACGGTTCGCTGAAAAA | 60.20 | 93 |
TTCCTCTGGAAGGTCGCCTC | 61.26 | ||
POU5F1 (pluripotency) | AGCGAACCAGTATCGAGAAC | 57.44 | 118 |
TTACAGAACCACACTCGGAC | 57.19 | ||
mScarlet (reporter) | GACATCACCTCCCACAACGA | 59.68 | 95 |
TTGTACAGCTCGTCCATGCC | 60.39 | ||
SLC6A3 (DAT) (mDA neurons) | CAAATGCTCCGTGGGACTCA | 60.32 | 109 |
CACTCCGTTCTGCTCCTTGA | 59.68 | ||
SOX2 (pluripotency + NSCs) | ATGGGTTCGGTGGTCAAGTC | 59.96 | 426 |
GTGGATGGGATTGGTGTTCTC | 58.63 | ||
TH (mDA neurons) | GGACCTCCACACTGAGCCAT | 61.56 | 107 |
ATGATGGCCTCTGCCTGCTT | 61.93 | ||
TUBB3 (neurons) | TTCTCACAAGTACGTGCCTCG | 60.34 | 91 |
GAAGAGATGTCCAAAGGCCCC | 60.68 |
Antibody | Species | Dilution | Catalogue Nr. | Manufacturer |
---|---|---|---|---|
β-Actin | Mouse | 1:5000 | 60008 | proteintech 1 |
CALB1 | Rabbit | 1:2000 | CB38 | Swant |
EN1 | Mouse | 1:100 | 4GII | DSHB 2 |
LMX1 | Rabbit | 1:1000 | AB10533 | Merck Millipore |
NANOG | Rabbit | 1:500 | ab21624 | abcam |
NESTIN | Rabbit | 1:500 | ABD69 | Merck Millipore |
OTX2 | Goat | 1:2000 | AF1979 | R&D Systems |
OCT4 (POU5F1) | Rabbit | 2 µg/mL | ab19857 | abcam |
RFP | Mouse | 1:500 | 409 011 | Synaptic Systems |
RFP | Mouse | 1:1000 | 6g6 | Chromotek 1 |
SOX2 | Rabbit | 1:250 | ab97959 | abcam |
TRA-1-60 | Mouse | 1:500 | ab16288 | abcam |
TH | Mouse | 1:1000 | MAB318 | Merck Millipore |
TH | Rabbit | 1:1000 | AB152 | Merck Millipore |
TUBB3 | Mouse | 1:1000 | 801213 | BioLegend |
Antibody | Dilution | Cat. Nr. |
---|---|---|
Donkey anti-Mouse IgG Alexa Fluor Plus 488 | 1:1500 | A32766 1 |
Donkey anti-Mouse IgG Alexa Fluor Plus 555 | 1:1500 | A32773 1 |
Donkey anti-Rabbit IgG Alexa Fluor Plus 488 | 1:1500 | A32790 1 |
Donkey anti-Rabbit IgG Alexa Fluor Plus 555 | 1:1500 | A327941 |
Donkey anti-Goat IgG Alexa Fluor Plus 555 | 1:1500 | A32816 1 |
Goat anti-Mouse IgG HRPO | 1:4000: | SBA-1031-05 2 |
Goat anti-Rabbit IgG HRPO | 1:10000 | ab6721 3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nouri, P.; Zimmer, A.; Brüggemann, S.; Friedrich, R.; Kühn, R.; Prakash, N. Generation of a NES-mScarlet Red Fluorescent Reporter Human iPSC Line for Live Cell Imaging and Flow Cytometric Analysis and Sorting Using CRISPR-Cas9-Mediated Gene Editing. Cells 2022, 11, 268. https://doi.org/10.3390/cells11020268
Nouri P, Zimmer A, Brüggemann S, Friedrich R, Kühn R, Prakash N. Generation of a NES-mScarlet Red Fluorescent Reporter Human iPSC Line for Live Cell Imaging and Flow Cytometric Analysis and Sorting Using CRISPR-Cas9-Mediated Gene Editing. Cells. 2022; 11(2):268. https://doi.org/10.3390/cells11020268
Chicago/Turabian StyleNouri, Parivash, Anja Zimmer, Stefanie Brüggemann, Robin Friedrich, Ralf Kühn, and Nilima Prakash. 2022. "Generation of a NES-mScarlet Red Fluorescent Reporter Human iPSC Line for Live Cell Imaging and Flow Cytometric Analysis and Sorting Using CRISPR-Cas9-Mediated Gene Editing" Cells 11, no. 2: 268. https://doi.org/10.3390/cells11020268