Proteomics Identifies Substrates and a Novel Component in hSnd2-Dependent ER Protein Targeting
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. Depletion of Cells by siRNA Treatment
2.4. Label-Free Quantitative Proteomic Analysis
2.5. Co-Immunoprecipitation
2.6. Creation of Plasmids for the Live Cell Protein–Protein Interaction
2.7. Live cell Protein–Protein Interaction (PPI) Using the NanoBiT Assay
2.8. Cell-Free Protein Transport Experiments
2.9. Carbonate Extraction
2.10. Peptide Spot Assay
2.11. Statistical Analysis of MS Experiments
2.12. Graphical Representation and Statistical Analysis of Cell-Free Protein Transport
3. Results
3.1. Quantitative Proteomic Analysis of HeLa Cells after Depletion of SRα by siRNA Identifies Precursors with N-Terminal Targeting Signals as Predominant SRα Clients
3.2. Quantitative Proteomic Analysis of HeLa Cells after Depletion of Wrb by siRNA Identifies Various Types of Precursors as Wrb Clients
3.3. Quantitative Proteomic Analysis of HeLa Cells after Depletion of hSnd2 by siRNA Identifies Precursors of Membrane Proteins as Predominant hSnd2 Clients
3.4. Quantitative Proteomic Analysis of HeLa Cells after Simultaneous Depletion of hSnd2 and Wrb Identifies Precursors with More C-Terminal Targeting Signals as Predominant Clients of Both Components
3.5. Characterization of Putative hSnd2 and Wrb Clients
3.6. Validation of Putative Clients Confirms Conclusions from MS Experiments
3.7. The ER Membrane Protein TMEM109 Interacts with the Targeting Receptor hSnd2 and Components of the Sec61 Translocon
3.8. Depletion of TMEM109 Phenocopies the Cellular Alterations Found after Knockdown of hSnd2
4. Discussion
4.1. Depletion of hSnd2 and hSnd2 plus Wrb Identifies Multispannig Membrane Proteins and Precursors with C-Terminal Targeting Signals as Comparatively Predominant Clients of the Human SND Pathway
4.2. hSnd2 and TMEM109 form the Heterodimeric Receptor of the SND Pathway in the Human ER Membrane
4.3. A working Hypothesis for the Human SND Pathway
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
CAML | calcium modulating ligand |
C-terminal | carboxy terminal |
EMC | ER membrane complex |
ER | endoplasmic reticulum |
GET | guided entry of TA proteins |
GO | gene ontology |
GPI | glycosylphosphatidylinositol |
N-terminal | amino terminal |
PEX | peroxisome |
RNC | ribosome-nascnet chain |
SND | SRP independent |
SP | signal peptide |
SR | SRP receptor |
SRP | signal recognition particle |
TA | tail anchor |
TMEM | transmembrane protein |
TMH | transmembrane helix |
TRC | transmembrane recognition complex |
WRB | tryptophan rich basic protein |
References
- Borgese, N.; Coy-Vergara, J.; Colombo, S.F.; Schwappach, B. The ways of tails: The GET pathway and more. Proteins 2019, 38, 289–305. [Google Scholar] [CrossRef] [PubMed]
- Gemmer, M.; Förster, F. A clearer picture of the ER translocon complex. J. Cell Sci. 2020, 133, jcs231340. [Google Scholar] [CrossRef] [PubMed]
- O’Keefe, S.; Pool, M.R.; High, S. Membrane protein biogenesis at the ER: The highways and byways. FEBS J. 2021. early view. [Google Scholar] [CrossRef] [PubMed]
- Hegde, R.S.; Keenan, R.J. The mechanism of integral membrane protein biogenesis. Nat. Rev. Mol. Cell Biol. 2022, 23, 107–124. [Google Scholar] [CrossRef]
- Walter, P.; Blobel, G. Translocation of proteins across the endoplasmic reticulum. II. Signal recognition protein (SRP) mediates the selective binding to microsomal membranes of in-vitro-assembled polysomes synthesizing secretory protein. J. Cell Biol. 1981, 91, 551–556. [Google Scholar] [CrossRef]
- Halic, M.; Blau, M.; Becker, T.; Mielke, T.; Pool, M.R.; Wild, K.; Sinning, I.; Beckmann, R. Following the signal sequence from ribosomal tunnel exit to signal recognition particle. Nature 2006, 444, 507–511. [Google Scholar] [CrossRef]
- Jomaa, A.; Eitzinger, S.; Zhu, Z.; Chandrasekar, S.; Kobajashi, K.; Shan, S.-O.; Ban, N. Molecular mechanism of cargo recognition and handover by the mammalian signal recognition particle. Cell Rep. 2021, 36, 109350. [Google Scholar] [CrossRef]
- Voorhees, R.M.; Hegde, R.S. Structures of the scanning and engaged states of the mammalian SRP-ribosome complex. eLife 2015, 4, e07975. [Google Scholar] [CrossRef]
- Meyer, D.I.; Dobberstein, B. Identification and characterization of a membrane component essential for the translocation of nascent proteins across the membrane of the endoplasmic reticulum. J. Cell Biol. 1980, 87, 503–508. [Google Scholar] [CrossRef]
- Gilmore, R.; Walter, P.; Blobel, G. Protein translocation across the endoplasmic reticulum. II. Isolation and characterization of the signal recognition particle receptor. J. Cell Biol. 1982, 95, 470–477. [Google Scholar] [CrossRef]
- Tajima, S.; Lauffer, L.; Rath, V.L.; Walter, P. The signal recognition particle receptor is a complex that contains two distinct polypeptide chains. J. Cell Biol. 1986, 103, 1167–1178. [Google Scholar] [CrossRef]
- Schlenstedt, G.; Gudmundsson, G.H.; Boman, H.G.; Zimmermann, R. A large presecretory protein translocates both cotranslationally, using signal recognition particle and ribosome, and posttranslationally, without these ribonucleoparticles, when synthesized in the presence of mammalian microsomes. J. Biol. Chem. 1990, 265, 13960–13968. [Google Scholar] [CrossRef]
- Kutay, U.; Hartmann, E.; Rapoport, T.A. A class of membrane proteins with a C-terminal anchor. Trends Cell Biol. 1993, 3, 72–75. [Google Scholar] [CrossRef]
- Ast, T.; Cohen, G.; Schuldiner, M. A Network of Cytosolic Factors Targets SRP-Independent Proteins to the Endoplasmic Reticulum. Cell 2013, 152, 1134–1145. [Google Scholar] [CrossRef] [PubMed]
- Stefanovic, S.; Hegde, R.S. Identification of a targeting factor for posttranslational membrane protein insertion into the ER. Cell 2007, 128, 1147–1159. [Google Scholar] [CrossRef]
- Schuldiner, M.; Metz, J.; Schmid, V.; Denic, V.; Rakwalska, M.; Schmitt, H.D.; Schwappach, B.; Weissman, J.S. The GET complex mediates insertion of tail-anchored proteins into the ER membrane. Cell 2008, 134, 634–645. [Google Scholar] [CrossRef]
- Aviram, N.; Ast, T.; Costa, E.A.; Arakel, E.; Chuartzman, S.G.; Jan, C.H.; Haßdenteufel, S.; Dudek, J.; Jung, M.; Schorr, S.; et al. The SND proteins constitute an alternative targeting route to the endoplasmic reticulum. Nature 2016, 540, 134–138. [Google Scholar] [CrossRef]
- Hegde, R.S.; Bernstein, H. The surprising complexity of signal peptides Trends Biochem. Sci. 2006, 31, 563–571. [Google Scholar]
- Rabu, C.; Schmid, V.; Schwappach, B.; High, S. Biogenesis of tail-anchored proteins: The beginning for the end? J. Cell Sci. 2009, 122, 3605–3612. [Google Scholar] [CrossRef]
- Vilardi, F.; Lorenz, H.; Dobberstein, B. WRB is the receptor for TRC40/Asna1-mediated insertion of tail-anchored proteins into the ER membrane. J. Cell Sci. 2011, 124, 1301–1307. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Sakisaka, T. Molecular machinery for insertion of tail-anchored membrane proteins into the endoplasmic reticulum membrane in mammalian cells. Mol. Cell 2012, 48, 387–397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vilardi, F.; Stephan, M.; Clancy, A.; Janshoff, A.; Schwappach, B. WRB and CAML are necessary and sufficient to mediate tail-anchored protein targeting to the ER membrane. PLoS ONE 2014, 9, e85033. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Chan, C.; Weir, N.R.; Denic, V. The Get1/2 transmembrane complex is an endoplasmic-reticulum membrane protein insertase. Nature 2014, 512, 441–444. [Google Scholar] [CrossRef] [PubMed]
- Mariappan, M.; Li, X.; Stefanovic, S.; Sharma, A.; Mateja, A.; Keenan, R.J.; Hegde, R.S. A ribosome-associating factor chaperones tail-anchored membrane proteins. Nature 2010, 466, 1120–1124. [Google Scholar] [CrossRef]
- Leznicki, P.; Clancy, A.; Schwappach, B.; High, S. Bat3 promotes the membrane integration of tail-anchored proteins. J. Cell Sci. 2010, 123, 2170–2178. [Google Scholar] [CrossRef]
- Zhao, Y.; Hu, J.; Miao, G.; Qu, L.; Wang, Z.; Li, G.; Lv, P.; Ma, D.; Chen, Y. Transmembrane protein 208: A novel ER-localized protein that regulates autophagy and ER stress. PLoS ONE 2013, 8, e64228. [Google Scholar] [CrossRef]
- Casson, J.; McKenna, M.; Haßdenteufel, S.; Aviram, N.; Zimmermann, R.; High, S. Multiple pathways facilitate the biogenesis of mammalian tail-anchored proteins. J. Cell Sci. 2017, 130, 3851–3861. [Google Scholar] [CrossRef]
- Haßdenteufel, S.; Sicking, M.; Schorr, S.; Aviram, N.; Fecher-Trost, C.; Schuldiner, M.; Jung, M.; Zimmermann, R.; Lang, S. hSnd2 protein represents an alternative targeting factor to the endoplasmic reticulum in human cells. FEBS Lett. 2017, 591, 3211–3224. [Google Scholar] [CrossRef]
- Haßdenteufel, S.; Johnson, N.; Paton, A.W.; Paton, J.C.; High, S.; Zimmermann, R. Chaperone-mediated Sec61 channel gating during ER import of small precursor proteins overcomes Sec61 inhibitor-reinforced energy barrier. Cell Rep. 2018, 23, 1373–1386. [Google Scholar] [CrossRef]
- Hein, M.Y.; Hubner, N.C.; Poser, I.; Cox, J.; Nagaraj, N.; Toyoda, Y.; Gak, I.A.; Weisswange, I.; Mansfeld, J.; Buchholz, F.; et al. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. Cell 2015, 163, 712–723. [Google Scholar] [CrossRef]
- Schrul, B.; Kopito, R.R. Peroxin-dependent targeting of a lipid-droplet-destined membrane protein to ER subdomains. Nat. Cell Biol. 2016, 18, 740–751. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, Y.; Sakisaka, T. The peroxisome biogenesis factors posttranslationally target reticulon homology-domain containing proteins to the endoplasmic reticulum membrane. Sci. Rep. 2018, 8, 2322. [Google Scholar] [CrossRef] [PubMed]
- Haßdenteufel, S.; Nguyen, D.; Helms, V.; Lang, S.; Zimmermann, R. Components and mechanisms for ER import of small human presecretory proteins. FEBS Lett. 2019, 593, 2506–2524. [Google Scholar] [CrossRef]
- Nguyen, D.; Stutz, R.; Schorr, S.; Lang, S.; Pfeffer, S.; Freeze, H.F.; Förster, F.; Helms, V.; Dudek, J.; Zimmermann, R. Proteomics reveals signal peptide features determining the client specificity in human TRAP-dependent ER protein import. Nat. Commun. 2018, 9, 37639. [Google Scholar] [CrossRef] [PubMed]
- Schorr, S.; Nguyen, D.; Haßdenteufel, S.; Nagaraj, N.; Cavalié, A.; Greiner, M.; Weissgerber, P.; Loi, M.; Paton, A.W.; Paton, J.C.; et al. Proteomics identifies signal peptide features determining the substrate specificity in human Sec62/Sec63-dependent ER protein import. FEBS J. 2020, 287, 4612–4640. [Google Scholar] [CrossRef]
- Klein, M.-C.; Lerner, M.; Nguyen, D.; Pfeffer, S.; Dudek, J.; Förster, F.; Helms, V.; Lang, S.; Zimmermann, R. TRAM1 protein may support ER protein import by modulating the phospholipid bilayer near the lateral gate of the Sec61 channel. Channels 2020, 14, 28–44. [Google Scholar] [CrossRef]
- Bhadra, P.; Schorr, S.; Lerner, M.; Nguyen, D.; Dudek, J.; Förster, F.; Helms, V.; Lang, S.; Zimmermann, R. Quantitative proteomics and differential protein abundance analysis after depletion of putative mRNA receptors in the ER membrane of human cells identifies novel aspects of mRNA targeting to the ER. Molecules 2021, 26, 3591. [Google Scholar] [CrossRef]
- Zimmermann, R.; Lang, S.; Lerner, M.; Förster, F.; Nguyen, D.; Helms, V.; Schrul, B. Quantitative proteomics and differential protein abundance ananalysis after depletion of PEX3 from human cells identifies additional aspects of protein targeting to the ER. Int. J. Mol. Sci. 2021, 22, 13028. [Google Scholar] [CrossRef]
- Chartron, J.W.; Hunt, K.C.L.; Frydman, J. Cotranslational signal-independent SRP preloading during membrane targeting. Nature 2016, 536, 224–228. [Google Scholar] [CrossRef]
- Costa, E.A.; Subramanian, K.; Nunnari, J.; Weissman, J. Defining the physiological role of SRP in protein-targeting efficiency and specificity. Science 2018, 359, 689–692. [Google Scholar] [CrossRef]
- Coy-Vergara, J.; Rivera-Monroy, J.; Urlaub, H.; Lenz, C.; Schwappach, B. A trap mutant reveals the phsiological client spectrum of TRC40. J. Cell Sci. 2019, 132, jcs230094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- O’Keefe, S.; Zong, G.; Duah, K.B.; Andrews, L.E.; Shi, W.Q.; High, S. An alternative pathway for membrane protein biogenesis at the endoplasmic reticulum. Commun. Biol. 2021, 4, 828. [Google Scholar] [CrossRef] [PubMed]
- O’Keefe, S.; Roboti, P.; Duah, K.B.; Zong, G.; Schneider, H.; Shi, W.Q.; High, S. Ipomoeassin-F inhibits the in vitro biogenesis of the SARS-CoV-2 spike protein and its host cell membrane receptor. J. Cell Sci. 2021, 134, jcs257758. [Google Scholar] [CrossRef] [PubMed]
- Schäuble, N.; Lang, S.; Jung, M.; Cappel, S.; Schorr, S.; Ulucan, Ö.; Linxweiler, J.; Dudek, J.; Blum, R.; Helms, V.; et al. BiP-mediated closing of the Sec61 channel limits Ca2+ leakage from the ER. EMBO J. 2012, 31, 3282–3296. [Google Scholar] [CrossRef] [PubMed]
- Johnson, N.; Vilardi, F.; Lang, S.; Leznicki, P.; Zimmermann, R.; High, S. The signal sequence influences posttranslational ER translocation at distinct stages. PLoS ONE 2013, 8, e75394. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef]
- Cox, J.; Hein, M.Y.; Luber, C.A.; Paron, I.; Nagaraj, N.; Mann, M. Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol. Cell. Proteom. 2014, 13, 2513–2526. [Google Scholar] [CrossRef]
- Roboti, P.; Sato, K.; Lowe, M. The golgin GMAP-210 is required for efficient membrane trafficking in the early secretory pathway. J. Cell Sci. 2015, 128, 1595–1606. [Google Scholar] [CrossRef]
- Harsman, A.; Kopp, A.; Wagner, R.; Zimmermann, R.; Jung, M. Calmodulin regulation of the calcium-leak channel Sec61 is unique to vertebrates. Channels 2011, 5, 293–298. [Google Scholar] [CrossRef]
- Görlich, D.; Rapoport, T.A. Protein translocation into proteoliposomes reconstituted from purified components of the endoplasmic reticulum membrane. Cell 1993, 75, 615–630. [Google Scholar] [CrossRef]
- Tusher, V.G.; Tibshirani, R.; Chu, G. Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA 2001, 98, 5116–5121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eden, E.; Navon, R.; Steinfeld, I.; Lipson, D.; Yakhini, Z. Gorilla: A tool for discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics 2009, 10, 48. [Google Scholar] [CrossRef] [PubMed]
- Kyte, J.; Doolittle, R.F. A simple method for displaying the hydrophobic character of a protein. J. Mol. Biol. 1982, 157, 105–132. [Google Scholar] [CrossRef]
- Käll, L.; Krogh, A.; Sonnhammer, E.L.L. A Combined Transmembrane Topology and Signal Peptide Prediction Method. J. Mol. Biol. 2004, 338, 1027–1036. [Google Scholar] [CrossRef] [PubMed]
- Zimmerman, J.M.; Eliezer, N.; Simha, R. The characterization of amino acid sequences in proteins by statistical methods. J. Theoret. Biol. 1968, 21, 170–201. [Google Scholar] [CrossRef]
- Trösenmeier, J.-H.; Rudorf, S.; Loessner, H.; Hofner, B.; Reuter, A.; Schulenborg, T.; Kock, I.; Bekeredjian-Ding, I.; Lipowskz, R.; Kamp, C. Optimizing the dynamics of protein expression. Sci. Rep. 2019, 9, 7511. [Google Scholar] [CrossRef]
- Wilson, M.P.; Durin, Z.; Unal, Ö.; Ng, B.G.; Marrecau, T.; Keldermans, L.; Souche, E.; Rymen, D.; Gündüz, M.; Köse, G.; et al. CAMLG-CDG: A novel Congenital Disorder of Glycosylation linked to defective membrane trafficking. Hum. Mol. Genet. 2022, 31, 2571–2581. [Google Scholar] [CrossRef]
- Leznicki, P.; High, S. SGTA associates with nascent membrane protein precursors. EMBO Rep. 2020, 21, e48835. [Google Scholar] [CrossRef]
- Farkas, A.; Urlaub, H.; Bohnsack, K.E.; Schwappach, B. Regulated targeting of the monotopic hairpin membrane protein Erg1 requires the GET pathway. J. Cell Biol. 2022, 221, e202201036. [Google Scholar] [CrossRef]
- Colombo, S.F.; Cardani, S.; Maroli, A.; Vitiello, A.; Soffientini, P.; Crespi, A.; Bram, R.F.; Benfante, R.; Borgese, N. Tail-anchored protein biogenesis in mammals: Function and reciprocal interactions of the two subunits of the TRC40 receptor. J. Biol. Chem. 2016, 291, 15292–15306. [Google Scholar] [CrossRef]
- Juszkiewicz, S.; Hegde, R.S. Quality control of orphaned proteins. Mol. Cell 2018, 71, 443–457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Inglis, A.J.; Page, K.R.; Guna, A.; Voorhees, R.M. Differential modes of orphan subunit recognition for the WRB/CAML complex. Cell Rep. 2020, 30, 212–222. [Google Scholar] [CrossRef] [PubMed]
- Lang, S.; Benedix, J.; Fedeles, S.V.; Schorr, S.; Schirra, C.; Schäuble, N.; Jalal, C.; Greiner, M.; Haßdenteufel, S.; Tatzelt, J.; et al. Different effects of Sec61-, Sec62 and Sec63-depletion on transport of polypeptides into the endoplasmic reticulum of mammalian cells. J. Cell Sci. 2012, 125, 1958–1969. [Google Scholar] [CrossRef] [PubMed]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef]
- Tsirigos, K.D.; Peters, C.; Shu, N.; Käll, L.; Elofsson, A. The TOPCONS web server for consensus prediction of membrane protein topology and signal peptides. Nucleic Acids Res. 2015, 43, W401–W407. [Google Scholar] [CrossRef]
- Venturi, E.; Mio, K.; Nishi, M.; Ogura, T.; Moriya, T.; Pitt, S.J.; Okuda, K.; Kakizawa, S.; Sitsapesan, R.; Sato, C.; et al. Mitsugumin 23 forms a massive bowl-shaped assembly and cation conducting channel. Biochemistry 2011, 50, 2623–2632. [Google Scholar] [CrossRef]
- Yamashita, A.; Taniwaki, T.; Kaikoi, Y.; Yamazaki, T. Protective role of the endoplasmic reticulum protein mitsugumin23 against ultraviolet C-induced cell death. FEBS Lett. 2013, 587, 1299–1303. [Google Scholar] [CrossRef]
- Anghel, S.A.; McGilvray, P.T.; Hegde, R.S.; Keenan, R.J. Identification of Oxa1 homologs operating in the eukaryotic endoplasmic reticulum. Cell Rep. 2017, 21, 3708–3716. [Google Scholar] [CrossRef]
- Pleiner, T.; Tomaleri, G.P.; Januszyk, K.; Inglis, A.J.; Hazu, M.; Voorhees, R.M. Structural basis for membrane insertion by the human ER membrane protein complex. Science 2020, 369, 433–436. [Google Scholar] [CrossRef]
- Dixon, A.S.; Schwinn, M.K.; Hall, M.P.; Zimmerman, K.; Otto, P.; Lubben, T.H.; Butler, B.L.; Binkowski, B.F.; Machleidt, T.; Kirkland, T.A.; et al. NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells. ACS Chem. Biol. 2016, 11, 400–408. [Google Scholar] [CrossRef]
- Sicking, M.; Jung, M.; Lang, S. Lights, camera, interaction: Studying protein-protein interactions of the ER protein translocase in living cells. Int. J. Mol. Sci. 2021, 22, 10358. [Google Scholar] [CrossRef] [PubMed]
- Hall, M.P.; Unch, J.; Binkowski, B.F.; Valley, M.P.; Butler, B.L.; Wood, M.G.; Otto, P.; Zimmerman, K.; Vidugiris, G.; Machleidt, T.; et al. Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate. ACS Chem. Biol. 2012, 7, 1848–1857. [Google Scholar] [CrossRef] [PubMed]
- Pool, M. Targeing of proteins for translocation at the endoplasmic reticulum. Int. J. Mol. Sci. 2022, 23, 3773. [Google Scholar] [CrossRef] [PubMed]
- Tirincsi, A.; Sicking, M.; Hadzibeganovicz, D.; Haßdenteufel, S.; Lang, S. The molecular biodiversity of protein targeting and protein transport related to the mammalian endoplasmic reticulum. Int. J. Mol. Sci. 2022, 23, 143. [Google Scholar] [CrossRef]
- Jomaa, A.; Gamerdinger, M.; Hsieh, H.-H.; Wallisch, A.; Chandrasekaran, V.; Ulusoy, Z.; Scaiola, A.; Hegde, R.S.; Shan, S.-O.; Ban, N.; et al. Mechanism of signal sequence handover from NAC to SRP on ribosomes during ER-protein targeting. Science 2022, 375, 839–844. [Google Scholar] [CrossRef]
- Jadhav, B.; McKenna, M.; Johnson, N.; High, S.; Sinning, I.; Pool., M.R. Mammalian SRP receptor switches the Sec61 translocase from Sec62 to SRP-dependent translocation. Nat. Commun. 2015, 6, 10133. [Google Scholar] [CrossRef]
- Voorhees, R.M.; Fernández, I.S.; Scheres, S.H.W.; Hegde, R.S. Structure of the mammalian ribosome-Sec61 complex to 3.4 Å resolution. Cell 2014, 157, 1632–1643. [Google Scholar] [CrossRef]
- Pfeffer, S.; Dudek, J.; Gogala, M.; Schorr, S.; Linxweiler, J.; Lang, S.; Becker, T.; Beckmann, R.; Zimmermann, R.; Förster, F. Structure of the mammalian oligosaccharyltransferase in the native ER protein translocon. Nat. Commun. 2014, 5, 3072. [Google Scholar] [CrossRef]
- Voorhees R M, Hegde R S Structure of the Sec61 channel opened by a signal peptide. Science 2016, 351, 88–91. [CrossRef]
- Pfeffer, S.; Dudek, J.; Ng, B.; Schaffa, M.; Albert, S.; Plitzko, J.; Baumeister, W.; Zimmermann, R.; Freeze, H.F.; Engel, B.D.; et al. Dissecting the molecular organization of the translocon-associatecd protein complex. Nat. Commun. 2017, 8, 14516. [Google Scholar] [CrossRef]
- Becker, T.; Bhushan, S.; Jarasch, A.; Armache, J.P.; Funes, S.; Jossinet, F.; Gumbart, J.; Mielke, T.; Berninghausen, O.; Schulten, K.; et al. Structure of monomeric yeast and mammalian Sec61 complexes interacting with the translating ribosome. Science 2009, 326, 1369–1373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schlaitz, A.-L.; Thompson, J.; Wong, C.C.L.; Yates, J.R., 3rd; Heald, R. REEP3/4 ensure endoplasmic reticulum clearance from metaphase chromatin and proper nucelar envelope architecture. Dev. Cell 2013, 26, 315–323. [Google Scholar] [CrossRef]
- Talbot, B.E.; Vandorpe, D.H.; Stotter, B.R.; Alper, S.L.; Schlondorff, J. Transmembrane insertases and N-glycosylation crtically determine synthesis, trafficking, and activity of the nonselective cation channel TRPC6. J. Biol. Chem. 2019, 294, 12655–12669. [Google Scholar] [CrossRef]
- Yang, J.; Hirata, T.; Liu, Y.-S.; Guo, X.-Y.; Gao, X.-D.; Kinoshita, T.; Fujita, M. Human SND2 mediates ER targeting of GPI-anchored proteins with low hydrophobic GPI attachment signals. FEBS Lett. 2021, 595, 1542–1558. [Google Scholar] [CrossRef] [PubMed]
- Jansen, R.L.M.; van der Klei, I.J. The peroxisome biogenesis factors Pex3 and Pex19: Multitasking proteins with disputed functions. FEBS Lett. 2019, 593, 457–474. [Google Scholar] [CrossRef] [PubMed]
- Nishi, M.; Komazaki, S.; Iino, M.; Kangawa, K.; Takeshima, H. Mitsugumin 23, a novel transmembrane protein on endoplasmic reticulum and nuclear membranes. FEBS Lett. 1998, 432, 191–196. [Google Scholar] [CrossRef]
- Teufel, F.; Armenteros, J.J.A.; Johansen, A.R.; Gislason, M.K.; Pihl, S.I.; Tsiigos, K.D.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. Signal 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 2022, 40, 1023–1025. [Google Scholar] [CrossRef]
- Haßdenteufel, S.; Schäuble, N.; Cassella, P.; Leznicki, P.; Müller, A.; High, S.; Jung, M.; Zimmermann, R. Calcium-calmodulin inhibits tail-anchored protein insertion into the mammalian endoplasmic reticulum membrane. FEBS Lett. 2011, 585, 3485–3490. [Google Scholar] [CrossRef]
- Shao, S.; Hegde, R.S. A calmodulin-dependent translocation pathway for small secretory proteins. Cell 2011, 147, 1576–1588. [Google Scholar] [CrossRef]
- Zimmermann, R.; Sagstetter, M.; Lewis, M.J.; Pelham, H.R.B. Seventy-kilodalton heat shock proteins and an additional component from reticulocyte lysate stimulate inmport of M13 procoat protein into microsomes. EMBO J. 1988, 7, 2875–2880. [Google Scholar] [CrossRef]
- Wiedmann, B.; Sakai, H.; Davies, T.A.; Wiedmann, M. A protein complex required for signal-sequence-specific sorting and translocation. Nature 1994, 370, 434–440. [Google Scholar] [CrossRef] [PubMed]
- Knorr, A.G.; Schmidt, C.; Tesina, P.; Berninghausen, O.; Becker, T.; Beatrix, B.; Beckmann, R. Ribosome-NatA architecture reveals that rRNA expansion segments coordinate N-terminal acatylation. Nat. Struct. Mol. Biol. 2019, 26, 35–39. [Google Scholar] [CrossRef]
- Otto, H.; Conz, C.; Maier, P.; Wölfle, T.; Suzuki, C.K.; Jenö, P.; Rücknagel, P.; Stahl, J.; Rospert, S. The chaperones MPP11 and Hsp70L1 form the mammalian ribocome associated complex. Proc. Natl. Acad. Sci. USA 2005, 102, 10064–10069. [Google Scholar] [CrossRef] [PubMed]
- Leznicki, P.; High, S. SGTA antagonizes BAG6-mediated protein triage. Proc. Natl. Acad. Sci. USA 2012, 109, 19214–19219. [Google Scholar] [CrossRef] [PubMed]
- Itakura, E.; Zavodszky, E.; Shao, S.; Wohlever, M.L.; Keenan, R.J.; Hegde, R.S. Ubiquilins chaperone and triage mitochondrial membrane proteins for degradation. Mol. Cell 2016, 63, 21–33. [Google Scholar] [CrossRef]
- Zheng, T.; Yang, Y.; Castaneda, C.A. Structure, dynamics and functions of UBQLNs: At the crossraods of protein quality control machinery. Biochem. J. 2020, 477, 3471–3497. [Google Scholar] [CrossRef]
- Gamerdinger, M.; Kobayashi, K.; Wallisch, A.; Kreft, S.G.; Sailer, C.; Schlömer, R.; Sachs, N.; Jomaa, A.; Stengel, F.; Ban, N.; et al. Early scanning of nascent polypeptides inside the ribosomal tunnel by NAC. Mol. Cell 2019, 75, 996–1006. [Google Scholar] [CrossRef]
- Hsieh, H.-H.; Lee, J.H.; Chandrasekar, S.; Shan, S.o. A ribosome-associated chaperone enables substrate triage in a cotranslational protein targeting complex. Nat. Commun. 2020, 11, 5840. [Google Scholar] [CrossRef]
- Liaci, A.M.; Förster, F. Take me home, protein roads: Structural insigths into signal peptide interactions during ER translocation. Int. J. Mol. Sci. 2021, 22, 11871. [Google Scholar] [CrossRef]
- McGilvray, P.T.; Anghel, S.A.; Sundaram, A.; Zhong, F.; Trnka, M.J.; Fuller, J.R.; Hu, H.; Bulingame, A.L.; Keenan, R.J. An ER translocon for multi-pass membrane proteins. Elife 2020, 9, e56889. [Google Scholar] [CrossRef]
Name | Target Sequence | Source | Concentration (nM) | Time (h) |
---|---|---|---|---|
HSND2-UTR siRNA #2 | CTCTATAGGGTCGTTGAATAA | Qiagen | 20 | 96 |
HSND2 siRNA #3 | AAGGGCAAAGTGGGCACGAGA | Qiagen | 20 | 96 |
SRA-UTR siRNA #3 | CACCAGAGCTTTGCTAATAAT | Qiagen | 15 | 96 |
SRA-UTR siRNA #6 | CAGAGAAATAAGTAATTTATA | Qiagen | 15 | 96 |
TMEM109-UTR #1 | CAGGTTTGATGTGGAATCACA | Qiagen | 20 | 72 |
TMEM109-UTR #2 | CACCGCCAGTGTCATACCAAA | Qiagen | 20 | 72 |
WRB-UTR siRNA #3 | TGACACGTATGTACTAGTGAA | Qiagen | 20 | 96 |
WRB siRNA #4 | CACAGTCAACATGATGGACGA | Qiagen | 20 | 96 |
Construct | Fwd Primer (5′-3′) | Rev Primer (5′-3′) |
---|---|---|
hSnd2-CS | TAATACGACTCACTATAGG | TCCCGGTGCTCGAGTAtaaccgcttcatctg |
hSnd2-NS | GTGGCCCTCGAATTCGAGGAGATCTGCCG | AGGGCCACTCTAGAttataaccgcttcatc |
TMEM109-CL | TAATACGACTCACTATAGG | GAGGGCCACGAGCTCTctcctcctccacac |
TMEM109-CS | TAATACGACTCACTATAGG | GAGGGCCACGAGCTCTctcctcctccacac |
Sec61α-CS | AAGTGGCTAGCatggcaatcaaatttc | CCGTGAATTCGTgaagagcagggccc |
Sec61α-NL | AGCGCTCGAGGatggcaatcaaatttc | GCCGCTAGCTCAgaagagcagggccc |
TRAPα-CS | TAATACGACTCACTATAGG | GGGCCACGAGCTCCctcatcagatcccac |
Recombinant cDNA | Vector | Species | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | RNA Polymerase |
---|---|---|---|---|---|
BCMA-Y13T-OPG2 | pCMV3 | Human | CGCAAATGGGCGGTAGGCGTG | TAGAAGGCACAGTCGAGG | T7 |
Cytb5OPG2 | pcDNA3 | Human | CGCAAATGGGCGGTAGGCGTG | TAGAAGGCACAGTCGAGG | T7 |
GypCOPG2 | pGEM4 | Human | GTGGATAACCGTATTACCGCC | CTCTGACGGCAGTTTACGAG | T7 |
Syt1OPG2 | pcDNA3 | Rat | CGCAAATGGGCGGTAGGCGTG | TAGAAGGCACAGTCGAGG | T7 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tirincsi, A.; O’Keefe, S.; Nguyen, D.; Sicking, M.; Dudek, J.; Förster, F.; Jung, M.; Hadzibeganovic, D.; Helms, V.; High, S.; et al. Proteomics Identifies Substrates and a Novel Component in hSnd2-Dependent ER Protein Targeting. Cells 2022, 11, 2925. https://doi.org/10.3390/cells11182925
Tirincsi A, O’Keefe S, Nguyen D, Sicking M, Dudek J, Förster F, Jung M, Hadzibeganovic D, Helms V, High S, et al. Proteomics Identifies Substrates and a Novel Component in hSnd2-Dependent ER Protein Targeting. Cells. 2022; 11(18):2925. https://doi.org/10.3390/cells11182925
Chicago/Turabian StyleTirincsi, Andrea, Sarah O’Keefe, Duy Nguyen, Mark Sicking, Johanna Dudek, Friedrich Förster, Martin Jung, Drazena Hadzibeganovic, Volkhard Helms, Stephen High, and et al. 2022. "Proteomics Identifies Substrates and a Novel Component in hSnd2-Dependent ER Protein Targeting" Cells 11, no. 18: 2925. https://doi.org/10.3390/cells11182925