EA.hy926 Cells and HUVECs Share Similar Senescence Phenotypes but Respond Differently to the Senolytic Drug ABT-263
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. Cell Treatments
2.4. Protein Extraction and Western Blotting
2.5. Senescence-Associated β-galactosidase (SA-β-gal) Assay
2.6. Cell Cycle Analysis
2.7. RNA Extraction and Real-Time PCR
2.8. Assessment of Senescence-Associated Secretory Phenotype (SASP) Factors in Cell Culture Media
2.9. Cell Viability Assay
2.10. Statistical Analysis
3. Results
3.1. Doxorubicin Induced the Expression of Senescence Markers in EA.hy926 Cells and HUVECs
3.2. Both EA.hy926 Cells and HUVECs Demonstrated Increased SA-β-gal Activity and Cell Cycle Arrest
3.3. Doxorubicin Induced the Expression of Senescence-Associated Secretory Phenotype (SASP) Factors in EA.hy926 Cells and HUVECs in a Similar Manner
3.4. ABT-263 Demonstrated Differential Senolytic Activity in EA.hy926 Cells and HUVECs
3.5. EA.hy926 Cells and HUVECs Demonstrated Differential Expression of the BCL-2 Family following DOX Treatment
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer statistics, 2022. CA Cancer J. Clin. 2022, 72, 7–33. [Google Scholar] [CrossRef] [PubMed]
- Abdelgawad, I.Y.; Sadak, K.T.; Lone, D.W.; Dabour, M.S.; Niedernhofer, L.J.; Zordoky, B.N. Molecular mechanisms and cardiovascular implications of cancer therapy-induced senescence. Pharm. Ther. 2020, 221, 107751. [Google Scholar] [CrossRef] [PubMed]
- Armenian, S.H.; Gibson, C.J.; Rockne, R.C.; Ness, K.K. Premature Aging in Young Cancer Survivors. J. Natl. Cancer Inst. 2019, 111, 226–232. [Google Scholar] [CrossRef] [PubMed]
- Okwuosa, T.M.; Anzevino, S.; Rao, R. Cardiovascular disease in cancer survivors. Postgrad. Med. J. 2017, 93, 82–90. [Google Scholar] [CrossRef] [Green Version]
- Herranz, N.; Gil, J. Mechanisms and functions of cellular senescence. J. Clin. Investig. 2018, 128, 1238–1246. [Google Scholar] [CrossRef]
- Campisi, J.; Robert, L. Cell Senescence: Role in Aging and Age-Related Diseases. Nat. Med. 2015, 21, 1424–1435. [Google Scholar]
- He, H.; Wang, L.; Qiao, Y.; Zhou, Q.; Li, H.; Chen, S.; Yin, D.; Huang, Q.; He, M. Doxorubicin Induces Endotheliotoxicity and Mitochondrial Dysfunction via ROS/eNOS/NO Pathway. Front. Pharm. 2019, 10, 1531. [Google Scholar] [CrossRef] [Green Version]
- Carlson, B.W.; Craft, M.A.; Carlson, J.R.; Razaq, W.; Deardeuff, K.K.; Benbrook, D.M. Accelerated vascular aging and persistent cognitive impairment in older female breast cancer survivors. Geroscience 2018, 40, 325–336. [Google Scholar] [CrossRef]
- Jang, W.J.; Choi, D.Y.; Jeon, I.S. Vascular endothelial dysfunction after anthracyclines treatment in children with acute lymphoblastic leukemia. Korean J. Pediatr. 2013, 56, 130–134. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.H.; Zhang, H.; Son, J.K.; Kim, J.R. Inhibitory effects of quercetagetin 3,4’-dimethyl ether purified from Inula japonica on cellular senescence in human umbilical vein endothelial cells. Arch. Pharm. Res. 2015, 38, 1857–1864. [Google Scholar] [CrossRef]
- Matacchione, G.; Gurau, F.; Silvestrini, A.; Tiboni, M.; Mancini, L.; Valli, D.; Rippo, M.R.; Recchioni, R.; Marcheselli, F.; Carnevali, O.; et al. Anti-SASP and anti-inflammatory activity of resveratrol, curcumin and beta-caryophyllene association on human endothelial and monocytic cells. Biogerontology 2021, 22, 297–313. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Holder, R.; Porter, C.; Shah, Z. Vitamin D3 attenuates doxorubicin-induced senescence of human aortic endothelial cells by upregulation of IL-10 via the pAMPKalpha/Sirt1/Foxo3a signaling pathway. PLoS ONE 2021, 16, e0252816. [Google Scholar] [CrossRef]
- Misuth, S.; Uhrinova, M.; Klimas, J.; Vavrincova-Yaghi, D.; Vavrinec, P. Vildagliptin improves vascular smooth muscle relaxation and decreases cellular senescence in the aorta of doxorubicin-treated rats. Vasc. Pharm. 2021, 138, 106855. [Google Scholar] [CrossRef] [PubMed]
- Abdelgawad, I.Y.; Agostinucci, K.; Zordoky, B.N. Cardiovascular ramifications of therapy-induced endothelial cell senescence in cancer survivors. Biochim. Biophys. Acta Mol. Basis Dis. 2022, 1868, 166352. [Google Scholar] [CrossRef]
- Zhu, Y.; Tchkonia, T.; Pirtskhalava, T.; Gower, A.C.; Ding, H.; Giorgadze, N.; Palmer, A.K.; Ikeno, Y.; Hubbard, G.B.; Lenburg, M.; et al. The Achilles’ heel of senescent cells: From transcriptome to senolytic drugs. Aging Cell 2015, 14, 644–658. [Google Scholar] [CrossRef]
- Zhu, Y.; Doornebal, E.J.; Pirtskhalava, T.; Giorgadze, N.; Wentworth, M.; Fuhrmann-Stroissnigg, H.; Niedernhofer, L.J.; Robbins, P.D.; Tchkonia, T.; Kirkland, J.L. New agents that target senescent cells: The flavone, fisetin, and the BCL-XL inhibitors, A1331852 and A1155463. Aging 2017, 9, 955–963. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.; Tchkonia, T.; Fuhrmann-Stroissnigg, H.; Dai, H.M.; Ling, Y.Y.; Stout, M.B.; Pirtskhalava, T.; Giorgadze, N.; Johnson, K.O.; Giles, C.B.; et al. Identification of a novel senolytic agent, navitoclax, targeting the Bcl-2 family of anti-apoptotic factors. Aging Cell 2016, 15, 428–435. [Google Scholar] [CrossRef]
- Edgell, C.J.; McDonald, C.C.; Graham, J.B. Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc. Natl. Acad. Sci. USA 1983, 80, 3734–3737. [Google Scholar] [CrossRef] [Green Version]
- Bouïs, D.; Hospers, G.A.P.; Meijer, C.; Molema, G.; Mulder, N.H. Endothelium in vitro: A review of human vascular endothelial cell lines for blood vessel-related research. Angiogenesis 2001, 4, 91–102. [Google Scholar] [CrossRef]
- Wang, D.; Chen, Z.; Wai Kan Yeung, A.; Atanasov, A.G. Differences between common endothelial cell models (primary human aortic endothelial cells and EA.hy926 cells) revealed through transcriptomics, bioinformatics, and functional analysis. Curr. Res. Biotechnol. 2021, 3, 135–145. [Google Scholar] [CrossRef]
- Noren Hooten, N.; Evans, M.K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. 2017, 123, e55533. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Zhao, L.; Feng, J.; You, G.; Sun, Q.; Li, P.; Han, D.; Zhou, H. Validation of reliable reference genes for real-time PCR in human umbilical vein endothelial cells on substrates with different stiffness. PLoS ONE 2013, 8, e67360. [Google Scholar] [CrossRef] [PubMed]
- Machado-Oliveira, G.; Ramos, C.; Marques, A.R.A.; Vieira, O.V. Cell Senescence, Multiple Organelle Dysfunction and Atherosclerosis. Cells 2020, 9, 2146. [Google Scholar] [CrossRef] [PubMed]
- Lien, W.H.; Chen, C.K.; Lai, L.Y.; Chen, Y.H.; Wu, M.P.; Wu, L.W. Participation of cyclin D1 deregulation in TNP-470-mediated cytostatic effect: Involvement of senescence. Biochem. Pharmacol. 2004, 68, 729–738. [Google Scholar] [CrossRef]
- Van Deursen, J.M. The role of senescent cells in ageing. Nature 2014, 509, 439–446. [Google Scholar] [CrossRef] [Green Version]
- Tripathi, U.; Misra, A.; Tchkonia, T.; Kirkland, J.L. Impact of Senescent Cell Subtypes on Tissue Dysfunction and Repair: Importance and Research Questions. Mech. Ageing Dev. 2021, 198, 111548. [Google Scholar] [CrossRef]
- Yousefzadeh, M.J.; Zhu, Y.; McGowan, S.J.; Angelini, L.; Fuhrmann-Stroissnigg, H.; Xu, M.; Ling, Y.Y.; Melos, K.I.; Pirtskhalava, T.; Inman, C.L.; et al. Fisetin is a senotherapeutic that extends health and lifespan. EBioMedicine 2018, 36, 18–28. [Google Scholar] [CrossRef] [Green Version]
- Tse, C.; Shoemaker, A.R.; Adickes, J.; Anderson, M.G.; Chen, J.; Jin, S.; Johnson, E.F.; Marsh, K.C.; Mitten, M.J.; Nimmer, P.; et al. ABT-263: A potent and orally bioavailable Bcl-2 family inhibitor. Cancer Res. 2008, 68, 3421–3428. [Google Scholar] [CrossRef] [Green Version]
- Demaria, M.; O’Leary, M.N.; Chang, J.; Shao, L.; Liu, S.; Alimirah, F.; Koenig, K.; Le, C.; Mitin, N.; Deal, A.M.; et al. Cellular Senescence Promotes Adverse Effects of Chemotherapy and Cancer Relapse. Cancer Discov. 2017, 7, 165–176. [Google Scholar] [CrossRef] [Green Version]
- Schafer, M.J.; Zhang, X.; Kumar, A.; Atkinson, E.J.; Zhu, Y.; Jachim, S.; Mazula, D.L.; Brown, A.K.; Berning, M.; Aversa, Z.; et al. The senescence-associated secretome as an indicator of age and medical risk. JCI Insight 2020, 5, e133668. [Google Scholar] [CrossRef]
- Bent, E.H.; Gilbert, L.A.; Hemann, M.T. A senescence secretory switch mediated by PI3K/AKT/mTOR activation controls chemoprotective endothelial secretory responses. Genes Dev. 2016, 30, 1811–1821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Graziani, S.; Scorrano, L.; Pontarin, G. Transient Exposure of Endothelial Cells to Doxorubicin Leads to Long-Lasting Vascular Endothelial Growth Factor Receptor 2 Downregulation. Cells 2022, 11, 210. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, A.K.; Rai, R.; Park, K.E.; Eren, M.; Miyata, T.; Wilsbacher, L.D.; Vaughan, D.E. A small molecule inhibitor of PAI-1 protects against doxorubicin-induced cellular senescence. Oncotarget 2016, 7, 72443–72457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Le Duff, M.; Gouju, J.; Jonchere, B.; Guillon, J.; Toutain, B.; Boissard, A.; Henry, C.; Guette, C.; Lelievre, E.; Coqueret, O. Regulation of senescence escape by the cdk4-EZH2-AP2M.M1 pathway in response to chemotherapy. Cell Death Dis. 2018, 9, 199. [Google Scholar] [CrossRef]
- Was, H.; Czarnecka, J.; Kominek, A.; Barszcz, K.; Bernas, T.; Piwocka, K.; Kaminska, B. Some chemotherapeutics-treated colon cancer cells display a specific phenotype being a combination of stem-like and senescent cell features. Cancer Biol. 2018, 19, 63–75. [Google Scholar] [CrossRef] [Green Version]
- Spallarossa, P.; Altieri, P.; Barisione, C.; Passalacqua, M.; Aloi, C.; Fugazza, G.; Frassoni, F.; Podesta, M.; Canepa, M.; Ghigliotti, G.; et al. p38 MAPK and JNK antagonistically control senescence and cytoplasmic p16INK4A expression in doxorubicin-treated endothelial progenitor cells. PLoS ONE 2010, 5, e15583. [Google Scholar] [CrossRef] [Green Version]
- Bielak-Zmijewska, A.; Wnuk, M.; Przybylska, D.; Grabowska, W.; Lewinska, A.; Alster, O.; Korwek, Z.; Cmoch, A.; Myszka, A.; Pikula, S.; et al. A comparison of replicative senescence and doxorubicin-induced premature senescence of vascular smooth muscle cells isolated from human aorta. Biogerontology 2014, 15, 47–64. [Google Scholar] [CrossRef] [Green Version]
- Coppe, J.P.; Patil, C.K.; Rodier, F.; Sun, Y.; Munoz, D.P.; Goldstein, J.; Nelson, P.S.; Desprez, P.Y.; Campisi, J. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 2008, 6, 2853–2868. [Google Scholar] [CrossRef]
- Park, H.S.; Kim, S.Y. Endothelial cell senescence: A systematic review and machine learning-based meta-analysis of transcriptomic studies. Ageing Res. Rev. 2020, 65, 101213. [Google Scholar] [CrossRef]
- Boccardi, V.; Mecocci, P. The Importance of Cellular Senescence in Frailty and Cardiovascular Diseases. Adv. Exp. Med. Biol. 2020, 1216, 79–86. [Google Scholar] [CrossRef]
- Ohta, M.; Kihara, T.; Toriuchi, K.; Aoki, H.; Iwaki, S.; Kakita, H.; Yamada, Y.; Aoyama, M. IL-6 promotes cell adhesion in human endothelial cells via microRNA-126-3p suppression. Exp. Cell Res. 2020, 393, 112094. [Google Scholar] [CrossRef] [PubMed]
- Gerszten, R.E.; Garcia-Zepeda, E.A.; Lim, Y.C.; Yoshida, M.; Ding, H.A.; Gimbrone, M.A., Jr.; Luster, A.D.; Luscinskas, F.W.; Rosenzweig, A. MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature 1999, 398, 718–723. [Google Scholar] [CrossRef] [PubMed]
- Hwang, H.J.; Lee, Y.R.; Kang, D.; Lee, H.C.; Seo, H.R.; Ryu, J.K.; Kim, Y.N.; Ko, Y.G.; Park, H.J.; Lee, J.S. Endothelial cells under therapy-induced senescence secrete CXCL11, which increases aggressiveness of breast cancer cells. Cancer Lett. 2020, 490, 100–110. [Google Scholar] [CrossRef] [PubMed]
- Robbins, P.D.; Jurk, D.; Khosla, S.; Kirkland, J.L.; LeBrasseur, N.K.; Miller, J.D.; Passos, J.F.; Pignolo, R.J.; Tchkonia, T.; Niedernhofer, L.J. Senolytic Drugs: Reducing Senescent Cell Viability to Extend Health Span. Annu. Rev. Pharm. Toxicol. 2021, 61, 779–803. [Google Scholar] [CrossRef]
- Yosef, R.; Pilpel, N.; Tokarsky-Amiel, R.; Biran, A.; Ovadya, Y.; Cohen, S.; Vadai, E.; Dassa, L.; Shahar, E.; Condiotti, R.; et al. Directed elimination of senescent cells by inhibition of BCL-W and BCL-XL. Nat. Commun. 2016, 7, 11190. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.; Olson, I.; Mansour, M.; Carlstrom, L.P.; Sutiwisesak, R.; Saber, R.; Rajani, K.; Warrington, A.E.; Howard, A.; Schroeder, M.; et al. Selective Vulnerability of Senescent Glioblastoma Cells to Bcl-XL Inhibition. Mol. Cancer Res. 2022, 20, 938–948. [Google Scholar] [CrossRef]
- Bojes, H.K.; Suresh, P.K.; Mills, E.M.; Spitz, D.R.; Sim, J.E.; Kehrer, J.P. Bcl-2 and Bcl-xL in peroxide-resistant A549 and U87MG cells. Toxicol. Sci. 1998, 42, 109–116. [Google Scholar] [CrossRef] [Green Version]
- Shi, Y.L.; Feng, S.; Chen, W.; Hua, Z.C.; Bian, J.J.; Yin, W. Mitochondrial inhibitor sensitizes non-small-cell lung carcinoma cells to TRAIL-induced apoptosis by reactive oxygen species and Bcl-X(L)/p53-mediated amplification mechanisms. Cell Death Dis. 2014, 5, e1579. [Google Scholar] [CrossRef] [Green Version]
- Moretti, L.; Li, B.; Kim, K.W.; Chen, H.; Lu, B. AT-101, a pan-Bcl-2 inhibitor, leads to radiosensitization of non-small cell lung cancer. J. Thorac. Oncol. 2010, 5, 680–687. [Google Scholar] [CrossRef]
- Saleh, T.; Carpenter, V.J.; Tyutyunyk-Massey, L.; Murray, G.; Leverson, J.D.; Souers, A.J.; Alotaibi, M.R.; Faber, A.C.; Reed, J.; Harada, H.; et al. Clearance of therapy-induced senescent tumor cells by the senolytic ABT-263 via interference with BCL-XL -BAX interaction. Mol. Oncol. 2020, 14, 2504–2519. [Google Scholar] [CrossRef]
- Heo, J.I.; Kim, W.; Choi, K.J.; Bae, S.; Jeong, J.H.; Kim, K.S. XIAP-associating factor 1, a transcriptional target of BRD7, contributes to endothelial cell senescence. Oncotarget 2016, 7, 5118–5130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, H.; Kim, C.H.; Jeong, J.H.; Park, M.; Kim, K.S. GDF15 contributes to radiation-induced senescence through the ROS-mediated p16 pathway in human endothelial cells. Oncotarget 2016, 7, 9634–9644. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Casella, G.; Munk, R.; Kim, K.M.; Piao, Y.; De, S.; Abdelmohsen, K.; Gorospe, M. Transcriptome signature of cellular senescence. Nucleic Acids Res. 2019, 47, 7294–7305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, T.; Ghosh, A.K.; Eren, M.; Miyata, T.; Vaughan, D.E. PAI-1 contributes to homocysteine-induced cellular senescence. Cell. Signal. 2019, 64, 109394. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′–3′) | Reverse Primer (3′–5′) | Ref |
---|---|---|---|
IL-6 | CCGGGAACGAAAGAGAAGCT | GCGCTTGTGGAGAAGGAGTT | [21] |
CXCL1 | GAAAGCTTGCCTCAATCCTG | CACCAGTGAGCTTCCTCCTC | [21] |
CXCL8 | CTTTCCACCCCAAATTTATCAAAG | CAGCAGAGCTCTCTTCCATCAGA | [21] |
B2M | CACCCCCACTGAAAAAGATGAG | CCTCCATGATGCTGCTTACATG | [22] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelgawad, I.Y.; Agostinucci, K.; Ismail, S.G.; Grant, M.K.O.; Zordoky, B.N. EA.hy926 Cells and HUVECs Share Similar Senescence Phenotypes but Respond Differently to the Senolytic Drug ABT-263. Cells 2022, 11, 1992. https://doi.org/10.3390/cells11131992
Abdelgawad IY, Agostinucci K, Ismail SG, Grant MKO, Zordoky BN. EA.hy926 Cells and HUVECs Share Similar Senescence Phenotypes but Respond Differently to the Senolytic Drug ABT-263. Cells. 2022; 11(13):1992. https://doi.org/10.3390/cells11131992
Chicago/Turabian StyleAbdelgawad, Ibrahim Y., Kevin Agostinucci, Somia G. Ismail, Marianne K. O. Grant, and Beshay N. Zordoky. 2022. "EA.hy926 Cells and HUVECs Share Similar Senescence Phenotypes but Respond Differently to the Senolytic Drug ABT-263" Cells 11, no. 13: 1992. https://doi.org/10.3390/cells11131992
APA StyleAbdelgawad, I. Y., Agostinucci, K., Ismail, S. G., Grant, M. K. O., & Zordoky, B. N. (2022). EA.hy926 Cells and HUVECs Share Similar Senescence Phenotypes but Respond Differently to the Senolytic Drug ABT-263. Cells, 11(13), 1992. https://doi.org/10.3390/cells11131992