LSD1 Facilitates Pro-Inflammatory Polarization of Macrophages by Repressing Catalase
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Monocyte Isolation, Differentiation to Macrophages, and Stimulation with TLR Ligands
2.3. Gene Silencing
2.4. Evaluation of CAT and M1 Markers Expression
2.5. Chromatin Immunoprecipitation
2.6. Co-Immunoprecipitation
2.7. Statistical Analysis
3. Results
3.1. TLR Ligands Reduce CAT Total mRNA Levels in Human Macrophages
3.2. Repression of CAT Transcription in Response to TLR4 Activation Is Associated with the Formation of RNA Polymerase Pausing Complex
3.3. LSD1 Co-Operates with HDAC1 to Repress CAT in Macrophages Activated with LPS
3.4. HDAC Alone Maintains CAT Repression in M1-Polarized Macrophages
3.5. LSD1 Inhibition Interferes with the HDAC1 Recruitment to the CAT Promoter and Protects the Gene from LPS-Triggered Repression
3.6. The Maintenance of Catalase Level in Polarizing Macrophages Lessens Expression of Some Pro-Inflammatory Markers
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gunawardena, D.; Raju, R.; Münch, G. Hydrogen peroxide mediates pro-inflammatory cell-to-cell signaling: A new therapeutic target for inflammation? Neural Regen Res. 2019, 14, 1430–1437. [Google Scholar]
- Regdon, Z.; Robaszkiewicz, A.; Kovács, K.; Rygielska, Ż.; Hegedűs, C.; Bodoor, K.; Szabó, É.; Virág, L. LPS protects macrophages from AIF-independent parthanatos by downregulation of PARP1 expression, induction of SOD2 expression, and a metabolic shift to aerobic glycolysis. Free Radic. Biol. Med. 2019, 131, 184–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karwaciak, I.; Gorzkiewicz, M.; Bartosz, G.; Pulaski, L. TLR2 activation induces antioxidant defence in human monocytemacrophage cell line models. Oncotarget 2017, 8, 54243–54264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y.; Mu, R.; Wang, Z.; Xing, P.; Zhang, J.; Dong, L.; Wang, C. A toll-like receptor agonist mimicking microbial signal to generate tumor-suppressive macrophages. Nat. Commun. 2019, 10, 2272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horuluoglu, B.; Bayik, D.; Kayraklioglu, N.; Goguet, E.; Kaplan, M.J.; Klinman, D.M. PAM3 supports the generation of M2-like macrophages from lupus patient monocytes and improves disease outcome in murine lupus. J. Autoimmun. 2019, 99, 24–32. [Google Scholar] [CrossRef] [Scilit]
- Hodara, R.; Weiss, D.; Joseph, G.; Velasquez-Castano, J.C.; Landázuri, N.; Han, J.W.; Yoon, Y.-S.; Taylor, W.R. Overexpression of catalase in myeloid cells causes impaired postischemic neovascularization. Arterioscler. Thromb. Vasc. Biol. 2011, 31, 2203–2209. [Google Scholar] [CrossRef] [Scilit]
- Tokarz, P.; Płoszaj, T.; Regdon, Z.; Virág, L.; Robaszkiewicz, A. PARP1-LSD1 functional interplay controls transcription of SOD2 that protects human pro-inflammatory macrophages from death under an oxidative condition. Free Radic. Biol. Med. 2019, 131, 218–224. [Google Scholar] [CrossRef] [Scilit]
- Liu, G.; Fiala, M.; Mizwicki, M.T.; Sayre, J.; Magpantay, L.; Siani, A.; Mahanian, M.; Chattopadhyay, M.; La Cava, A.; Wiedau-Pazos, M. Neuronal phagocytosis by inflammatory macrophages in ALS spinal cord: Inhibition of inflammation by resolvin D1. Am. J. Neurodegener. Dis. 2012, 1, 60–74. [Google Scholar]
- Ponzoni, M.; Pastorino, F.; Di Paolo, D.; Perri, P.; Brignole, C. Targeting macrophages as a potential therapeutic intervention: Impact on inflammatory diseases and cancer. Int. J. Mol. Sci. 2018, 19, 1953. [Google Scholar] [CrossRef] [Scilit]
- Chu, F.; Shi, M.; Zheng, C.; Shen, D.; Zhu, J.; Zheng, X.; Cui, L. The roles of macrophages and microglia in multiple sclerosis and experimental autoimmune encephalomyelitis. J. Neuroimmunol. 2018, 318, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Glorieux, C.; Sandoval, J.M.; Dejeans, N.; Nonckreman, S.; Bahloula, K.; Poirel, H.A.; Calderon, P.B. Evaluation of potential mechanisms controlling the catalase expression in breast cancer cells. Oxid. Med. Cell Longev. 2018, 2018, 5351967. [Google Scholar] [CrossRef] [Scilit]
- Sobczak, M.; Pitt, A.R.; Spickett, C.M.; Robaszkiewicz, A. PARP1 Co-regulates EP300–BRG1-dependent transcription of genes involved in breast cancer cell proliferation and DNA repair. Cancers 2019, 11, 1539. [Google Scholar] [CrossRef] [Scilit]
- Wiśnik, E.; Płoszaj, T.; Robaszkiewicz, A. Downregulation of PARP1 transcription by promoter-associated E2F4-RBL2-HDAC1-BRM complex contributes to repression of pluripotency stem cell factors in human monocytes. Sci. Rep. 2017, 7, 9483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orecchioni, M.; Ghosheh, Y.; Pramod, A.B.; Ley, K. Macrophage polarization: Different gene signatures in M1(LPS+) vs. classically and M2(LPS-) vs. alternatively activated macrophages. Front. Immunol. 2019, 10, 1084. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haque, R.; Chun, E.; Howell, J.C.; Sengupta, T.; Chen, D.; Kim, H. MicroRNA-30b-mediated regulation of catalase expression in human ARPE-19 cells. PLoS ONE 2012, 7, e42542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takeuchi, T.; Nakamura, S.; Kayasuga, A.; Isa, S.; Sato, K. Multiple elements for negative regulation of the rat catalase gene expression in dedifferentiated hepatoma cells. J. Biochem. 2000, 128, 1025–1031. [Google Scholar] [CrossRef] [Scilit]
- Chiu, A.C.; Suzuki, H.I.; Wu, X.; Mahat, D.B.; Kriz, A.J.; Sharp, P.A. Transcriptional pause sites delineate stable nucleosome-associated premature polyadenylation suppressed by U1 snRNP. Mol. Cell. 2018, 69, 648–663.e7. [Google Scholar] [CrossRef] [Scilit]
- Gates, L.A.; Shi, J.; Rohira, A.D.; Feng, Q.; Zhu, B.; Bedford, M.T.; Sagum, C.A.; Jung, S.Y.; Qin, J.; Tsai, M.J.; et al. Acetylation on histone H3 lysine 9 mediates a switch from transcription initiation to elongation. J. Biol. Chem. 2017, 292, 14456–14472. [Google Scholar] [CrossRef] [Scilit]
- Price, D.H. Transient pausing by RNA polymerase II. Proc. Natl. Acad. Sci. USA 2018, 115, 4810–4812. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.A.; Zhu, J.; Yennawar, N.; Eek, P.; Tan, S. Crystal structure of the LSD1/CoREST histone demethylase bound to its nucleosome substrate. Mol. Cell. 2020, 78, 903–914.e4. [Google Scholar] [CrossRef] [Scilit]
- Baell, J.; Walters, M.A. Chemistry: Chemical con artists foil drug discovery. Nature 2014, 513, 481–483. [Google Scholar] [CrossRef] [Scilit]
- GSK-LSD1 | SGC. Available online: https://www.thesgc.org/chemical-probes/GSK-LSD1 (accessed on 8 March 2021).
- Yang, Y.; Huang, W.; Qiu, R.; Liu, R.; Zeng, Y.; Gao, J.; Zheng, Y.; Hou, Y.; Wang, S.; Yu, W.; et al. LSD1 coordinates with the SIN3A/HDAC complex and maintains sensitivity to chemotherapy in breast cancer. J. Mol. Cell Biol. 2018, 10, 285–301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.; Nam, H.J.; Lee, W.; Yim, H.Y.; Ahn, J.Y.; Park, S.W.; Shin, H.-J.R.; Yu, R.; Won, K.-J.; Bae, J.S.; et al. PKCα-LSD1-NF-κB-signaling cascade is crucial for epigenetic control of the inflammatory response. Mol. Cell 2018, 69, 398–411.e6. [Google Scholar] [CrossRef] [Scilit]
- Fang, Y.; Liao, G.; Yu, B. LSD1/KDM1A inhibitors in clinical trials: Advances and prospects. J. Hematol. Oncol. 2019, 12, 129. [Google Scholar] [CrossRef] [Scilit]
- Duquette, M.L.; Kim, J.; Shi, L.Z.; Berns, M.W. LSD1 mediated changes in the local redox environment during the DNA damage response. PLoS ONE 2018, 13, e0201907. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forrester, S.J.; Kikuchi, D.S.; Hernandes, M.S.; Xu, Q.; Griendling, K.K. Reactive oxygen species in metabolic and inflammatory signaling. Circ. Res. 2018, 122, 877–902. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Saijo, K.; Skola, D.; Jin, C.; Ma, Q.; Merkurjev, D.; Glass, C.K.; Rosenfeld, M.G. Histone demethylase LSD1 regulates hematopoietic stem cells homeostasis and protects from death by endotoxic shock. Proc. Natl. Acad. Sci. USA 2018, 115, E244–E252. [Google Scholar] [CrossRef] [Scilit]
- Yang, R.; Zhao, G.; Liang, S.; Chen, H.; Liu, D. Lysine-specific demethylase 1 represses THP-1 monocyte-to-macrophage differentiation. Chin. Med. Sci. J. 2013, 28, 82–87. [Google Scholar] [CrossRef] [Scilit]
- Mačinković, I.; Theofel, I.; Hundertmark, T.; Kovač, K.; Awe, S.; Lenz, J.; Forné, I.; Lamp, B.; Nist, A.; Imhof, A.; et al. Distinct CoREST complexes act in a cell-type-specific manner. Nucleic Acids Res. 2019, 47, 11649–11666. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Yang, Y.; Wang, F.; Wan, K.; Yamane, K.; Zhang, Y.; Lei, M. Crystal structure of human histone lysine-specific demethlase 1 (LSD1). Proc. Natl. Acad. Sci. USA 2006, 103, 13956–13961. [Google Scholar] [CrossRef] [Scilit]
- Ravasio, R.; Ceccacci, E.; Nicosia, L.; Hosseini, A.; Rossi, P.L.; Barozzi, I.; Fornasari, L.; Zuffo, R.D.; Valente, S.; Fioravanti, R.; et al. Targeting the scaffolding role of LSD1 (KDM1A) poises acute myeloid leukemia cells for retinoic acid-induced differentiation. Sci. Adv. 2020, 6, eaax2746. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Genes | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| CAT | ACTTTGAGGTCACACATGACATT | CTGAACCCGATTCTCCAGCA |
| ACTB | TGGCACCCAGCACAATGAA | CTAAGTCATAGTCCGCCTAGAAGCA |
| GAPDH | GGAGTCAACGGATTTGGTCGTA | GGCAACAATATCCACTTTACCA |
| B2M | GACTTGTCTTTCAGCAAGGA | ACAAAGTCACATGGTTCACA |
| TNFα | GGAGAAGGGTGACCGACTCA | GAAACGGCTCAGACCCGT |
| COX2 | GAATCATTCACCAGGCAAATTG | TCATGTCTTTCATAGTGTCCGAAGGT |
| IL12A | CTCCTGGACCACCTCAGTTTG | TTACAAGGGTACGGAAGTGG |
| MIP2A | CGCCCAAACCGAAGTCAT | TTTCTACGACTTTTTACCGTTTAG |
| IL1β | ACGAATCTCCGACCACCACT | CAGTCAACAACACCGGTACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sobczak, M.; Strachowska, M.; Gronkowska, K.; Karwaciak, I.; Pułaski, Ł.; Robaszkiewicz, A. LSD1 Facilitates Pro-Inflammatory Polarization of Macrophages by Repressing Catalase. Cells 2021, 10, 2465. https://doi.org/10.3390/cells10092465
Sobczak M, Strachowska M, Gronkowska K, Karwaciak I, Pułaski Ł, Robaszkiewicz A. LSD1 Facilitates Pro-Inflammatory Polarization of Macrophages by Repressing Catalase. Cells. 2021; 10(9):2465. https://doi.org/10.3390/cells10092465
Chicago/Turabian StyleSobczak, Maciej, Magdalena Strachowska, Karolina Gronkowska, Iwona Karwaciak, Łukasz Pułaski, and Agnieszka Robaszkiewicz. 2021. "LSD1 Facilitates Pro-Inflammatory Polarization of Macrophages by Repressing Catalase" Cells 10, no. 9: 2465. https://doi.org/10.3390/cells10092465
APA StyleSobczak, M., Strachowska, M., Gronkowska, K., Karwaciak, I., Pułaski, Ł., & Robaszkiewicz, A. (2021). LSD1 Facilitates Pro-Inflammatory Polarization of Macrophages by Repressing Catalase. Cells, 10(9), 2465. https://doi.org/10.3390/cells10092465

