High Glucose and Advanced Glycation End Products Induce CD147-Mediated MMP Activity in Human Adipocytes
Abstract
1. Introduction
2. Materials and Methods
2.1. Culture of Primary Subcutaneous Adipocytes
2.2. Adipocyte Treatments
2.3. CD147 and MGACT5 Gene Silencing
2.4. Real-Time PCR
2.5. Western Blotting
2.6. ELISA Assays
2.7. Immunoprecipitation and Glycoprotein Staining
2.8. MMP2/9 Activity Assay
2.9. Statistical Analysis
3. Results
3.1. Effects of AGEs and HG on CD147 Expression and Glycosylation in Adipocytes
3.2. Effects of AGEs and HG on MMP Expression and Activity in Differentiated Adipocytes
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Leon, B.M.; Maddox, T.M. Diabetes and cardiovascular disease: Epidemiology, biological mechanisms, treatment recommendations and future research. World J. Diabetes 2015, 6, 1246–1258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Papazafiropoulou, A.; Tentolouris, N. Matrix metalloproteinases and cardiovascular diseases. Hippokratia 2009, 13, 76–82. [Google Scholar] [PubMed]
- Newby, A.C. Metalloproteinases and vulnerable atherosclerotic plaques. Trends Cardiovasc. Med. 2007, 17, 253–258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grass, G.D.; Toole, B.P. How, with whom and when: An overview of CD147-mediated regulatory networks influencing matrix metalloproteinase activity. Biosci. Rep. 2015, 36, e00283. [Google Scholar] [CrossRef] [Scilit]
- Bai, Y.; Huang, W.; Ma, L.T.; Jiang, J.L.; Chen, Z.N. Importance of N-glycosylation on CD147 for its biological functions. Int. J. Mol. Sci. 2014, 15, 6356–6377. [Google Scholar] [CrossRef] [Scilit]
- Xin, X.; Zeng, X.; Gu, H.; Li, M.; Tan, H.; Jin, Z.; Hua, T.; Shi, R.; Wang, H. CD147/EMMPRIN overexpression and prognosis in cancer: A systematic review and meta-analysis. Sci. Rep. 2016, 6, 32804. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Jin, R.; Zhu, X.; Yan, J.; Li, G. Function of CD147 in atherosclerosis and atherothrombosis. J. Cardiovasc. Transl. Res. 2015, 8, 59–66. [Google Scholar] [CrossRef] [Scilit]
- Shi, W.P.; Ju, D.; Li, H.; Yuan, L.; Cui, J.; Luo, D.; Chen, Z.N.; Bian, H. CD147 Promotes CXCL1 Expression and Modulates Liver Fibrogenesis. Int. J. Mol. Sci. 2018, 19, 1145. [Google Scholar] [CrossRef] [Scilit]
- Schmidt, R.; Bultmann, A.; Ungerer, M.; Joghetaei, N.; Bulbul, O.; Thieme, S.; Chavakis, T.; Toole, B.P.; Gawaz, M.; Schomig, A.; et al. Extracellular matrix metalloproteinase inducer regulates matrix metalloproteinase activity in cardiovascular cells: Implications in acute myocardial infarction. Circulation 2006, 113, 834–841. [Google Scholar] [CrossRef] [Scilit]
- Yoon, Y.W.; Kwon, H.M.; Hwang, K.C.; Choi, E.Y.; Hong, B.K.; Kim, D.; Kim, H.S.; Cho, S.H.; Song, K.S.; Sangiorgi, G. Upstream regulation of matrix metalloproteinase by EMMPRIN; extracellular matrix metalloproteinase inducer in advanced atherosclerotic plaque. Atherosclerosis 2005, 180, 37–44. [Google Scholar] [CrossRef] [Scilit]
- Bao, W.; Min, D.; Twigg, S.M.; Shackel, N.A.; Warner, F.J.; Yue, D.K.; McLennan, S.V. Monocyte CD147 is induced by advanced glycation end products and high glucose concentration: Possible role in diabetic complications. Am. J. Physiol. Cell Physiol. 2010, 299, C1212–C1219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vlassara, H.; Uribarri, J. Advanced glycation end products (AGE) and diabetes: Cause, effect, or both? Curr. Diab. Rep. 2014, 14, 453. [Google Scholar] [CrossRef] [Scilit]
- Ramasamy, R.; Yan, S.F.; Herold, K.; Clynes, R.; Schmidt, A.M. Receptor for advanced glycation end products: Fundamental roles in the inflammatory response: Winding the way to the pathogenesis of endothelial dysfunction and atherosclerosis. Ann. N. Y. Acad. Sci. 2008, 1126, 7–13. [Google Scholar] [CrossRef] [Scilit]
- Ramasamy, R.; Vannucci, S.J.; Yan, S.S.; Herold, K.; Yan, S.F.; Schmidt, A.M. Advanced glycation end products and RAGE: A common thread in aging, diabetes, neurodegeneration, and inflammation. Glycobiology 2005, 15, 16R–28R. [Google Scholar] [CrossRef] [Scilit]
- Mahmoud, A.M.; Somal, V.S.; Solomon, T.P.; Kasumov, T.; Fealy, C.E.; Malin, S.K.; Kirwan, J.P.; Haus, J.M. RAGE Expression in Human Skeletal Muscle Is Normalized Following Aerobic Exercise Training. In Proceedings of the DIABETES; American Diabetes Assoc.: Alexandria, VA, USA, 2013. [Google Scholar]
- Chang, C.T.; Wu, M.S.; Tian, Y.C.; Chen, K.H.; Yu, C.C.; Liao, C.H.; Hung, C.C.; Yang, C.W. Enhancement of epithelial sodium channel expression in renal cortical collecting ducts cells by advanced glycation end products. Nephrol. Dial. Transpl. 2007, 22, 722–731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Knutti, N.; Kuepper, M.; Friedrich, K. Soluble extracellular matrix metalloproteinase inducer (EMMPRIN, EMN) regulates cancer-related cellular functions by homotypic interactions with surface CD147. FEBS J. 2015, 282, 4187–4200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belton, R.J., Jr.; Chen, L.; Mesquita, F.S.; Nowak, R.A. Basigin-2 is a cell surface receptor for soluble basigin ligand. J. Biol. Chem. 2008, 283, 17805–17814. [Google Scholar] [CrossRef] [Scilit]
- Cui, J.; Huang, W.; Wu, B.; Jin, J.; Jing, L.; Shi, W.P.; Liu, Z.Y.; Yuan, L.; Luo, D.; Li, L.; et al. N-glycosylation by N-acetylglucosaminyltransferase V enhances the interaction of CD147/basigin with integrin beta1 and promotes HCC metastasis. J. Pathol. 2018, 245, 41–52. [Google Scholar] [CrossRef] [Scilit]
- Galis, Z.S.; Khatri, J.J. Matrix metalloproteinases in vascular remodeling and atherogenesis: The good, the bad, and the ugly. Circ. Res. 2002, 90, 251–262. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.; Hemler, M.E. Regulation of MMP-1 and MMP-2 production through CD147/extracellular matrix metalloproteinase inducer interactions. Cancer Res. 2001, 61, 2276–2281. [Google Scholar]
- Bouloumie, A.; Sengenes, C.; Portolan, G.; Galitzky, J.; Lafontan, M. Adipocyte produces matrix metalloproteinases 2 and 9: Involvement in adipose differentiation. Diabetes 2001, 50, 2080–2086. [Google Scholar] [CrossRef] [Scilit]
- Peppa, M.; Uribarri, J.; Vlassara, H. Glucose, Advanced Glycation End Products, and Diabetes Complications: What Is New and What Works. Clin. Diabetes 2003, 21, 186–187. [Google Scholar] [CrossRef] [Scilit]
- Nahalkova, J. The protein-interaction network with functional roles in tumorigenesis, neurodegeneration, and aging. Mol. Cell Biochem. 2016, 423, 187–196. [Google Scholar] [CrossRef] [Scilit]
- Sluijter, J.P.; Pulskens, W.P.; Schoneveld, A.H.; Velema, E.; Strijder, C.F.; Moll, F.; de Vries, J.P.; Verheijen, J.; Hanemaaijer, R.; de Kleijn, D.P.; et al. Matrix metalloproteinase 2 is associated with stable and matrix metalloproteinases 8 and 9 with vulnerable carotid atherosclerotic lesions: A study in human endarterectomy specimen pointing to a role for different extracellular matrix metalloproteinase inducer glycosylation forms. Stroke 2006, 37, 235–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Varki, A.; Cummings, R.D.; Esko, J.D.; Stanley, P.; Hart, G.W.; Aebi, M.; Darvill, A.G.; Kinoshita, T.; Packer, N.H. Essentials of Glycobiology, 3rd ed.; Cold Spring Harbor: New York, NY, USA, 2015. [Google Scholar]
- Hoffmann, B.R.; Widlansky, M.E.; Greene, A.S. Hyperglycemia-induced Glycosylation: A Driving Force for Vascular Dysfunction in Diabetes? FASEB J. 2016, 30, 1213–1282. [Google Scholar] [CrossRef] [Scilit]
- Wittenbecher, C.; Stambuk, T.; Kuxhaus, O.; Rudman, N.; Vuckovic, F.; Stambuk, J.; Schiborn, C.; Rahelic, D.; Dietrich, S.; Gornik, O.; et al. Plasma N-Glycans as Emerging Biomarkers of Cardiometabolic Risk: A Prospective Investigation in the EPIC-Potsdam Cohort Study. Diabetes Care 2020, 43, 661–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keser, T.; Gornik, I.; Vuckovic, F.; Selak, N.; Pavic, T.; Lukic, E.; Gudelj, I.; Gasparovic, H.; Biocina, B.; Tilin, T.; et al. Increased plasma N-glycome complexity is associated with higher risk of type 2 diabetes. Diabetologia 2017, 60, 2352–2360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tobon-Velasco, J.C.; Cuevas, E.; Torres-Ramos, M.A. Receptor for AGEs (RAGE) as mediator of NF-kB pathway activation in neuroinflammation and oxidative stress. CNS Neurol. Disord. Drug. Targets 2014, 13, 1615–1626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, I.K.; Oh, D.H.; Park, S.J.; Kang, J.H.; Kim, S.; Lee, M.S.; Kim, M.J.; Hwang, Y.C.; Ahn, K.J.; Chung, H.Y.; et al. Inhibition of NF-kappaB prevents high glucose-induced proliferation and plasminogen activator inhibitor-1 expression in vascular smooth muscle cells. Exp. Mol. Med. 2011, 43, 684–692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ha, H.; Yu, M.R.; Choi, Y.J.; Kitamura, M.; Lee, H.B. Role of high glucose-induced nuclear factor-kappaB activation in monocyte chemoattractant protein-1 expression by mesangial cells. J. Am. Soc. Nephrol 2002, 13, 894–902. [Google Scholar] [CrossRef] [Scilit]
- Hattori, Y.; Hattori, S.; Sato, N.; Kasai, K. High-glucose-induced nuclear factor kappaB activation in vascular smooth muscle cells. Cardiovasc. Res. 2000, 46, 188–197. [Google Scholar] [CrossRef] [Scilit]
- Ott, C.; Jacobs, K.; Haucke, E.; Navarrete Santos, A.; Grune, T.; Simm, A. Role of advanced glycation end products in cellular signaling. Redox Biol. 2014, 2, 411–429. [Google Scholar] [CrossRef] [Scilit]
- Win, M.T.; Yamamoto, Y.; Munesue, S.; Saito, H.; Han, D.; Motoyoshi, S.; Kamal, T.; Ohara, T.; Watanabe, T.; Yamamoto, H. Regulation of RAGE for attenuating progression of diabetic vascular complications. Exp. Diabetes Res. 2012, 2012, 894605. [Google Scholar] [CrossRef] [Scilit]
- Ramasamy, R.; Yan, S.F.; Schmidt, A.M. Receptor for AGE (RAGE): Signaling mechanisms in the pathogenesis of diabetes and its complications. Ann. N. Y. Acad. Sci. 2011, 1243, 88–102. [Google Scholar] [CrossRef] [Scilit]
- Sousa, M.M.; Yan, S.D.; Stern, D.; Saraiva, M.J. Interaction of the receptor for advanced glycation end products (RAGE) with transthyretin triggers nuclear transcription factor kB (NF-kB) activation. Lab. Invest. 2000, 80, 1101–1110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, Y.; Kim, J.M.; Park, H.S.; Yang, A.; Islam, C.; Lakatta, E.G.; Lin, L. AGE-RAGE signal generates a specific NF-kappaB RelA “barcode” that directs collagen I expression. Sci. Rep. 2016, 6, 18822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simard, E.; Sollradl, T.; Maltais, J.S.; Boucher, J.; D’Orleans-Juste, P.; Grandbois, M. Receptor for Advanced Glycation End-Products Signaling Interferes with the Vascular Smooth Muscle Cell Contractile Phenotype and Function. PLoS ONE 2015, 10, e0128881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rucci, N.; Millimaggi, D.; Mari, M.; Del Fattore, A.; Bologna, M.; Teti, A.; Angelucci, A.; Dolo, V. Receptor activator of NF-kappaB ligand enhances breast cancer-induced osteolytic lesions through upregulation of extracellular matrix metalloproteinase inducer/CD147. Cancer Res. 2010, 70, 6150–6160. [Google Scholar] [CrossRef] [Scilit]
- Guo, H.; Pierce, J.M. Transcriptional Regulation of Glycan Expression. In Glycoscience: Biology and Medicine; Taniguchi, N., Endo, T., Hart, G.W., Seeberger, P.H., Wong, C.-H., Eds.; Springer: Tokyo, Japan, 2015; pp. 1173–1180. [Google Scholar] [CrossRef] [Scilit]
- Guo, H.; Zucker, S.; Gordon, M.K.; Toole, B.P.; Biswas, C. Stimulation of matrix metalloproteinase production by recombinant extracellular matrix metalloproteinase inducer from transfected Chinese hamster ovary cells. J. Biol. Chem. 1997, 272, 24–27. [Google Scholar] [CrossRef] [Scilit]
- von Ungern-Sternberg, S.N.I.; Zernecke, A.; Seizer, P. Extracellular Matrix Metalloproteinase Inducer EMMPRIN (CD147) in Cardiovascular Disease. Int. J. Mol. Sci. 2018, 19, 507. [Google Scholar] [CrossRef] [Scilit]
- Seizer, P.; Borst, O.; Langer, H.F.; Bultmann, A.; Munch, G.; Herouy, Y.; Stellos, K.; Kramer, B.; Bigalke, B.; Buchele, B.; et al. EMMPRIN (CD147) is a novel receptor for platelet GPVI and mediates platelet rolling via GPVI-EMMPRIN interaction. Thromb. Haemost. 2009, 101, 682–686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pennings, G.J.; Kritharides, L. CD147 in cardiovascular disease and thrombosis. Semin. Thromb. Hemost. 2014, 40, 747–755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Azevedo, A.; Prado, A.F.; Antonio, R.C.; Issa, J.P.; Gerlach, R.F. Matrix metalloproteinases are involved in cardiovascular diseases. Basic. Clin. Pharm. Toxicol. 2014, 115, 301–314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.H.; Li, Y.T.; Du, D.Y. Oxidized low-density lipoprotein-induced CD147 expression and its inhibition by high-density lipoprotein on platelets in vitro. Thromb. Res. 2013, 132, 702–711. [Google Scholar] [CrossRef] [Scilit]







| Gene Name | Orientation | Primer Sequence | Tm | Product Size |
|---|---|---|---|---|
| CD147 | Fw-primer | TTCAGCCTCTGGGTCTGAGT | 60.0 | 238 |
| Rv-primer | GCCAAGAGGTCAGAGTCGTC | 60.0 | ||
| MMP2 | Fw-primer | ACAGCAGGTCTCAGCCTCAT | 60.0 | 151 |
| Rv-primer | TGAAGCCAAGCGGTCTAAGT | 60.0 | ||
| MMP9 | Fw-primer | TTGACAGCGACAAGAAGTGG | 60.0 | 179 |
| Rv-primer | GCCATTCACGTCGTCCTTAT | 60.0 | ||
| FABP4 | Fw-primer | TACTGGGCCAGGAATTTGAC | 60.0 | 181 |
| Rv-primer | GTGGAAGTGACGCCTTTCAT | 60.0 | ||
| AdipoQ | Fw-primer | CCTAAGGGAGACATCGGTGA | 60.0 | 173 |
| Rv-primer | GTAAAGCGAATGGGCATGTT | 60.0 | ||
| MGAT5 | Fw-primer | CCTTCCCCTTCTTTTCCAAG | 60.0 | 235 |
| Rv-primer | CCTGGGAGCCAGTACACATT | 60.0 | ||
| GAPDH | Fw-primer | CGACCACTTTGTCAAGCTCA | 60.0 | 228 |
| Rv-primer | AGGGGTCTACATGGCAACTG | 60.0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mahmoud, A.M.; Ali, M.M. High Glucose and Advanced Glycation End Products Induce CD147-Mediated MMP Activity in Human Adipocytes. Cells 2021, 10, 2098. https://doi.org/10.3390/cells10082098
Mahmoud AM, Ali MM. High Glucose and Advanced Glycation End Products Induce CD147-Mediated MMP Activity in Human Adipocytes. Cells. 2021; 10(8):2098. https://doi.org/10.3390/cells10082098
Chicago/Turabian StyleMahmoud, Abeer M., and Mohamed M. Ali. 2021. "High Glucose and Advanced Glycation End Products Induce CD147-Mediated MMP Activity in Human Adipocytes" Cells 10, no. 8: 2098. https://doi.org/10.3390/cells10082098
APA StyleMahmoud, A. M., & Ali, M. M. (2021). High Glucose and Advanced Glycation End Products Induce CD147-Mediated MMP Activity in Human Adipocytes. Cells, 10(8), 2098. https://doi.org/10.3390/cells10082098

