Reactive Oxygen Species Downregulate Transient Receptor Potential Melastatin 6 Expression Mediated by the Elevation of miR-24-3p in Renal Tubular Epithelial Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture and Transfection
2.3. Isolation of Total RNA and Quantification of mRNA
2.4. Preparation of Cytoplasmic Extracts and Western Blotting
2.5. Luciferase Reporter Assay
2.6. Mg2+ Influx Assay
2.7. Reactive Oxygen Species (ROS) Generation
2.8. Statistical Analysis
3. Results and Discussion
3.1. Decrease in TRPM6 Expression in NRK-52E Cells by GA
3.2. Involvement of ROS in the GA-Induced Reduction of TRPM6 Expression
3.3. Involvement of miR-24-3p in the ROS-Induced Reduction of TRPM6 Expression
3.4. Effects of GA, H2O2, miR-24-3p siRNA on Mg2+ Influx
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lowenstein, F.W.; Stanton, M.F. Serum magnesium levels in the United States, 1971–1974. J. Am. Coll. Nutr. 1986, 5, 399–414. [Google Scholar] [CrossRef] [PubMed]
- Quamme, G.A.; de Rouffignac, C. Epithelial magnesium transport and regulation by the kidney. Front. Biosci. 2000, 5, D694–D711. [Google Scholar] [CrossRef]
- Xi, Q.; Hoenderop, J.G.; Bindels, R.J. Regulation of magnesium reabsorption in DCT. Pflugers Arch. 2009, 458, 89–98. [Google Scholar] [CrossRef] [PubMed]
- Stuiver, M.; Lainez, S.; Will, C.; Terryn, S.; Gunzel, D.; Debaix, H.; Sommer, K.; Kopplin, K.; Thumfart, J.; Kampik, N.B.; et al. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated in dominant hypomagnesemia. Am. J. Hum. Genet. 2011, 88, 333–343. [Google Scholar] [CrossRef] [PubMed]
- Sponder, G.; Mastrototaro, L.; Kurth, K.; Merolle, L.; Zhang, Z.; Abdulhanan, N.; Smorodchenko, A.; Wolf, K.; Fleig, A.; Penner, R.; et al. Human CNNM2 is not a Mg(2+) transporter per se. Pflugers Arch. 2016, 468, 1223–1240. [Google Scholar] [CrossRef] [PubMed]
- de Leeuw, I.H.; van Gaal, L.; Vanroelen, W. Magnesium and obesity: Effects of treatment on magnesium and other parameters. Magnesium 1987, 6, 40–47. [Google Scholar]
- Dousdampanis, P.; Trigka, K.; Fourtounas, C. Hypomagnesemia, chronic kidney disease and cardiovascular mortality: Pronounced association but unproven causation. Hemodial Int. 2014, 18, 730–739. [Google Scholar] [CrossRef] [PubMed]
- Colditz, G.A.; Manson, J.E.; Stampfer, M.J.; Rosner, B.; Willett, W.C.; Speizer, F.E. Diet and risk of clinical diabetes in women. Am. J. Clin. Nutr. 1992, 55, 1018–1023. [Google Scholar] [CrossRef] [PubMed]
- American Diabetes, A. Standards of medical care in diabetes—2013. Diabetes Care 2013, 36 (Suppl. 1), S11–S66. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Moran, M.; Guerrero-Romero, F. Oral magnesium supplementation improves insulin sensitivity and metabolic control in type 2 diabetic subjects: A randomized double-blind controlled trial. Diabetes Care 2003, 26, 1147–1152. [Google Scholar] [CrossRef] [PubMed]
- Takayanagi, K.; Shimizu, T.; Tayama, Y.; Ikari, A.; Anzai, N.; Iwashita, T.; Asakura, J.; Hayashi, K.; Mitarai, T.; Hasegawa, H. Downregulation of transient receptor potential M6 channels as a cause of hypermagnesiuric hypomagnesemia in obese type 2 diabetic rats. Am. J. Physiol. Renal Physiol. 2015, 308, F1386–F1397. [Google Scholar] [CrossRef] [PubMed]
- Ikari, A.; Okude, C.; Sawada, H.; Yamazaki, Y.; Sugatani, J.; Miwa, M. TRPM6 expression and cell proliferation are up-regulated by phosphorylation of ERK1/2 in renal epithelial cells. Biochem. Biophys. Res. Commun. 2008, 369, 1129–1133. [Google Scholar] [CrossRef] [PubMed]
- Ikari, A.; Sanada, A.; Okude, C.; Sawada, H.; Yamazaki, Y.; Sugatani, J.; Miwa, M. Up-regulation of TRPM6 transcriptional activity by AP-1 in renal epithelial cells. J. Cell. Physiol. 2010, 222, 481–487. [Google Scholar] [CrossRef] [PubMed]
- Furukawa, C.; Fujii, N.; Manabe, A.; Matsunaga, T.; Endo, S.; Hasegawa, H.; Ito, Y.; Yamaguchi, M.; Yamazaki, Y.; Ikari, A. Up-regulation of transient receptor potential melastatin 6 channel expression by tumor necrosis factor-alpha in the presence of epidermal growth factor receptor tyrosine kinase inhibitor. J. Cell. Physiol. 2017, 232, 2841–2850. [Google Scholar] [CrossRef]
- Ledeganck, K.J.; Boulet, G.A.; Bogers, J.J.; Verpooten, G.A.; De Winter, B.Y. The TRPM6/EGF pathway is downregulated in a rat model of cisplatin nephrotoxicity. PLoS ONE 2013, 8, e57016. [Google Scholar] [CrossRef]
- Miranda-Diaz, A.G.; Pazarin-Villasenor, L.; Yanowsky-Escatell, F.G.; Andrade-Sierra, J. Oxidative Stress in Diabetic Nephropathy with Early Chronic Kidney Disease. J. Diabetes Res. 2016, 2016, 7047238. [Google Scholar] [CrossRef]
- Cao, G.; Lee, K.P.; van der Wijst, J.; de Graaf, M.; van der Kemp, A.; Bindels, R.J.; Hoenderop, J.G. Methionine sulfoxide reductase B1 (MsrB1) recovers TRPM6 channel activity during oxidative stress. J. Biol. Chem. 2010, 285, 26081–26087. [Google Scholar] [CrossRef] [PubMed]
- Takashina, Y.; Manabe, A.; Hasegawa, H.; Matsunaga, T.; Endo, S.; Ikari, A. Sodium Citrate Increases Expression and Flux of Mg(2+) Transport Carriers Mediated by Activation of MEK/ERK/c-Fos Pathway in Renal Tubular Epithelial Cells. Nutrients 2018, 10, 1345. [Google Scholar] [CrossRef]
- Ikari, A.; Sanada, A.; Sawada, H.; Okude, C.; Tonegawa, C.; Sugatani, J. Decrease in transient receptor potential melastatin 6 mRNA stability caused by rapamycin in renal tubular epithelial cells. Biochim. Biophys. Acta 2011, 1808, 1502–1508. [Google Scholar] [CrossRef]
- Schlingmann, K.P.; Weber, S.; Peters, M.; Niemann Nejsum, L.; Vitzthum, H.; Klingel, K.; Kratz, M.; Haddad, E.; Ristoff, E.; Dinour, D.; et al. Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat. Genet. 2002, 31, 166–170. [Google Scholar] [CrossRef]
- Takezawa, R.; Schmitz, C.; Demeuse, P.; Scharenberg, A.M.; Penner, R.; Fleig, A. Receptor-mediated regulation of the TRPM7 channel through its endogenous protein kinase domain. Proc. Natl. Acad. Sci. USA 2004, 101, 6009–6014. [Google Scholar] [CrossRef] [PubMed]
- Song, G.; Han, P.; Sun, H.; Shao, M.; Yu, X.; Wang, W.; Wang, D.; Yi, W.; Ge, N.; Li, S.; et al. Astragaloside IV ameliorates early diabetic nephropathy by inhibition of MEK1/2-ERK1/2-RSK2 signaling in streptozotocin-induced diabetic mice. J. Int. Med. Res. 2018, 46, 2883–2897. [Google Scholar] [CrossRef] [PubMed]
- Hirasawa, Y.; Matsui, Y.; Yamane, K.; Yabuki, S.Y.; Kawasaki, Y.; Toyoshi, T.; Kyuki, K.; Ito, M.; Sakai, T.; Nagamatsu, T. Pioglitazone improves obesity type diabetic nephropathy: Relation to the mitigation of renal oxidative reaction. Exp. Anim. 2008, 57, 423–432. [Google Scholar] [CrossRef][Green Version]
- Nair, A.V.; Hocher, B.; Verkaart, S.; van Zeeland, F.; Pfab, T.; Slowinski, T.; Chen, Y.P.; Schlingmann, K.P.; Schaller, A.; Gallati, S.; et al. Loss of insulin-induced activation of TRPM6 magnesium channels results in impaired glucose tolerance during pregnancy. Proc. Natl. Acad. Sci. USA 2012, 109, 11324–11329. [Google Scholar] [CrossRef] [PubMed]
- Huerta, M.G.; Roemmich, J.N.; Kington, M.L.; Bovbjerg, V.E.; Weltman, A.L.; Holmes, V.F.; Patrie, J.T.; Rogol, A.D.; Nadler, J.L. Magnesium deficiency is associated with insulin resistance in obese children. Diabetes Care 2005, 28, 1175–1181. [Google Scholar] [CrossRef] [PubMed]
- Nadler, J.L.; Buchanan, T.; Natarajan, R.; Antonipillai, I.; Bergman, R.; Rude, R. Magnesium deficiency produces insulin resistance and increased thromboxane synthesis. Hypertension 1993, 21, 1024–1029. [Google Scholar] [CrossRef]
- Ishibashi, Y.; Matsui, T.; Takeuchi, M.; Yamagishi, S. Beneficial effects of metformin and irbesartan on advanced glycation end products (AGEs)-RAGE-induced proximal tubular cell injury. Pharmacol. Res. 2012, 65, 297–302. [Google Scholar] [CrossRef]
- Fukami, K.; Yamagishi, S.; Ueda, S.; Okuda, S. Role of AGEs in diabetic nephropathy. Curr. Pharm. Des. 2008, 14, 946–952. [Google Scholar] [CrossRef]
- Sebastian-delaCruz, M.; Gonzalez-Moro, I.; Olazagoitia-Garmendia, A.; Castellanos-Rubio, A.; Santin, I. The Role of lncRNAs in Gene Expression Regulation through mRNA Stabilization. Noncoding RNA 2021, 7, 3. [Google Scholar]
- Xie, B.; Zhao, R.; Bai, B.; Wu, Y.; Xu, Y.; Lu, S.; Fang, Y.; Wang, Z.; Maswikiti, E.P.; Zhou, X.; et al. Identification of key tumorigenesisrelated genes and their microRNAs in colon cancer. Oncol. Rep. 2018, 40, 3551–3560. [Google Scholar]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, X.; Wang, Z.Y.; Li, L. Circ_0080425 inhibits cell proliferation and fibrosis in diabetic nephropathy via sponging miR-24-3p and targeting fibroblast growth factor 11. J. Cell. Physiol. 2020, 235, 4520–4529. [Google Scholar] [CrossRef] [PubMed]
- Sun, I.O.; Lerman, L.O. Urinary Extracellular Vesicles as Biomarkers of Kidney Disease: From Diagnostics to Therapeutics. Diagnostics 2020, 10, 311. [Google Scholar] [CrossRef] [PubMed]
- Prabu, P.; Rome, S.; Sathishkumar, C.; Gastebois, C.; Meugnier, E.; Mohan, V.; Balasubramanyam, M. MicroRNAs from urinary extracellular vesicles are non-invasive early biomarkers of diabetic nephropathy in type 2 diabetes patients with the ‘Asian Indian phenotype’. Diabetes Metab. 2019, 45, 276–285. [Google Scholar] [CrossRef]
- Ikari, A.; Okude, C.; Sawada, H.; Takahashi, T.; Sugatani, J.; Miwa, M. Down-regulation of TRPM6-mediated magnesium influx by cyclosporin A. Naunyn Schmiedebergs Arch. Pharmacol. 2008, 377, 333–343. [Google Scholar] [CrossRef]
- Fan, J.M.; Ng, Y.Y.; Hill, P.A.; Nikolic-Paterson, D.J.; Mu, W.; Atkins, R.C.; Lan, H.Y. Transforming growth factor-beta regulates tubular epithelial-myofibroblast transdifferentiation in vitro. Kidney Int. 1999, 56, 1455–1467. [Google Scholar] [CrossRef]




| Genes | Direction | Sequence (5′→3′) |
|---|---|---|
| TRPM6 | Sense | CTTCTTGGGATACCAAATCAG |
| Antisense | GAAACTTTTCCTAGTGTAGCTG | |
| TRPM7 | Sense | AACCAACACTCTGGAAGAGATCA |
| Antisense | TCAGTCAAGTTTTCTCCCACAC | |
| CNNM2 | Sense | AACACCATCTTCCTCACCAAGT |
| Antisense | TCAGCTCTTCCTTAACGAGGTC | |
| β-Actin | Sense | CCAACCGTGAAAAGATGACC |
| Antisense | CCAGAGGCATACAGGGACAG | |
| miR-24-3p | Sense | TGGCTCAGTTCAGCAGGAAC |
| let-7d-5p | Sense | AGAGGTAGTAGGTTGCATAG |
| miR-26a-5p | Sense | TTCAAGTAATCCAGGATAGG |
| miR-140-3p | Sense | ATGGTGTCTTTAGTACCGTC |
| miR-143-3p | Sense | TCTCTACTCCGAGTCTCCCA |
| miR-34a | Sense | CCCGTCACTCTCTACTCCGA |
| miR-218-5p | Sense | AACACGAAAACAAAGTAAGT |
| miR-128-3p | Sense | GGTGTCACAAAGACTCGAAT |
| miR-193-3p | Sense | CTGACCGGTTCCTCTTGTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hirota, C.; Takashina, Y.; Yoshino, Y.; Hasegawa, H.; Okamoto, E.; Matsunaga, T.; Ikari, A. Reactive Oxygen Species Downregulate Transient Receptor Potential Melastatin 6 Expression Mediated by the Elevation of miR-24-3p in Renal Tubular Epithelial Cells. Cells 2021, 10, 1893. https://doi.org/10.3390/cells10081893
Hirota C, Takashina Y, Yoshino Y, Hasegawa H, Okamoto E, Matsunaga T, Ikari A. Reactive Oxygen Species Downregulate Transient Receptor Potential Melastatin 6 Expression Mediated by the Elevation of miR-24-3p in Renal Tubular Epithelial Cells. Cells. 2021; 10(8):1893. https://doi.org/10.3390/cells10081893
Chicago/Turabian StyleHirota, Chieko, Yui Takashina, Yuta Yoshino, Hajime Hasegawa, Ema Okamoto, Toshiyuki Matsunaga, and Akira Ikari. 2021. "Reactive Oxygen Species Downregulate Transient Receptor Potential Melastatin 6 Expression Mediated by the Elevation of miR-24-3p in Renal Tubular Epithelial Cells" Cells 10, no. 8: 1893. https://doi.org/10.3390/cells10081893
APA StyleHirota, C., Takashina, Y., Yoshino, Y., Hasegawa, H., Okamoto, E., Matsunaga, T., & Ikari, A. (2021). Reactive Oxygen Species Downregulate Transient Receptor Potential Melastatin 6 Expression Mediated by the Elevation of miR-24-3p in Renal Tubular Epithelial Cells. Cells, 10(8), 1893. https://doi.org/10.3390/cells10081893

