Exogenous Melatonin Delays Methyl Jasmonate-Triggered Senescence in Tomato Leaves
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Treatment
2.2. Measurement of Chlorophyll Content
2.3. Measurement of Reactive Oxygen Species (ROS) Accumulation
2.4. Measurement of Malonaldehyde (MDA) Content
2.5. Measurement of Electrolyte Leakage
2.6. Measurement of Antioxidant Enzyme Activities
2.7. Determination of SBPase Activity
2.8. Measurement of Photosynthesis and Maximum Photochemical Efficiency
2.9. Measurement of Transcript Abundance by Quantitative Real-Time PCR
2.10. Statistical Analysis
3. Results
3.1. Melatonin Alleviates MeJA-Induced Senescence in Tomato Leaves
3.2. Melatonin Represses the Upregulation of Senescence-Related Genes and Chlorophyll Degradation Genes in MeJA-Treated Tomato Leaves
3.3. Melatonin Reduces Electrolyte Leakage and MDA Content in MeJA-Induced Tomato Leaves
3.4. Melatonin Decreases Levels of Reactive Oxygen Species (ROS) in MeJA-Treated Tomato Leaves
3.5. Melatonin Stimulates Activities of Antioxidant Enzymes in MeJA-Treated Tomato Leaves
3.6. Melatonin Mitigates the Inhibition of Photosynthetic Capacity in MeJA-Treated Tomato Leaves
3.7. Melatonin Increases the Expression of SlSBPASE and Promotes SBPase Activity in MeJA-Treated Tomato Leaves
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Lim, P.O.; Kim, H.J.; Gil Nam, H. Leaf senescence. Annu. Rev. Plant Biol. 2007, 58, 115–136. [Google Scholar] [CrossRef]
- Hörtensteiner, S. Chlorophyll degradation during senescence. Annu. Rev. Plant Biol. 2006, 57, 55–77. [Google Scholar] [CrossRef]
- Park, J.H.; Oh, S.A.; Kim, Y.H.; Woo, H.R.; Nam, H.G. Differential expression of senescence-associated mRNAs during leaf senescence induced by different senescence-inducing factors in Arabidopsis. Plant Mol. Biol. 1998, 37, 445–454. [Google Scholar] [CrossRef]
- Weaver, L.M.; Gan, S.; Quirino, B.; Amasino, R.M. A comparison of the expression patterns of several senescence-associated genes in response to stress and hormone treatment. Plant Mol. Biol. 1998, 37, 455–469. [Google Scholar] [CrossRef]
- Woo, H.R.; Chung, K.M.; Park, J.-H.; Oh, S.A.; Ahn, T.; Hong, S.H.; Jang, S.K.; Nam, H.G. ORE9, an F-Box protein that regulates leaf senescence in Arabidopsis. Plant Cell 2001, 13, 1779–1790. [Google Scholar] [CrossRef]
- Gütle, D.D.; Roret, T.; Müller, S.J.; Couturier, J.; Lemaire, S.D.; Hecker, A.; Dhalleine, T.; Buchanan, B.B.; Reski, R.; Einsle, O.; et al. Chloroplast FBPase and SBPase are thioredoxin-linked enzymes with similar architecture but different evolutionary histories. Proc. Natl. Acad. Sci. USA 2016, 113, 6779–6784. [Google Scholar] [CrossRef]
- Wu, A.; Allu, A.D.; Garapati, P.; Siddiqui, H.; Dortay, H.; Zanor, M.-I.; Asensi-Fabado, M.A.; Munne-Bosch, S.; Antonio, C.; Tohge, T.; et al. JUNGBRUNNEN1, a reactive oxygen species-responsive NAC transcription factor, regulates longevity in Arabidopsis. Plant Cell 2012, 24, 482–506. [Google Scholar] [CrossRef]
- Lerner, A.B.; Case, J.D.; Takahashi, Y.; Lee, T.H.; Mori, W. Isolation of melatonin, the pineal gland factor that lightens melanocytes. J. Am. Chem. Soc. 1958, 80, 2587. [Google Scholar] [CrossRef]
- Carrillo-Vico, A.; Lardone, P.J.; Álvarez-Śnchez, N.; Rodrĩguez-Rodrĩguez, A.; Guerrero, J.M. Melatonin: Buffering the immune system. Int. J. Mol. Sci. 2013, 14, 8638–8683. [Google Scholar] [CrossRef]
- Arnao, M.B.; Hernández-Ruiz, J. Melatonin and its relationship to plant hormones. Ann. Bot. 2018, 121, 195–207. [Google Scholar] [CrossRef]
- Dubbels, R.; Reiter, R.J.; Klenke, E.; Goebel, A.; Schnakenberg, E.; Ehlers, C.; Schiwara, H.W.; Schloot, W. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatography-mass spectrometry. J. Pineal Res. 1995, 18, 28–31. [Google Scholar] [CrossRef]
- Hattori, A.; Migitaka, H.; Iigo, M.; Itoh, M.; Yamamoto, K.; Ohtani-Kaneko, R.; Hara, M.; Suzuki, T.; Reiter, R.J. Identification of melatonin in plants and its effects on plasma melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int. 1995, 35, 627–634. [Google Scholar]
- Reiter, R.J.; Tan, D.X.; Zhou, Z.; Cruz, M.H.C.; Fuentes-Broto, L.; Galano, A. Phytomelatonin: Assisting plants to survive and thrive. Molecules 2015, 20, 7396–7437. [Google Scholar] [CrossRef]
- Fan, J.; Xie, Y.; Zhang, Z.; Chen, L. Melatonin: A multifunctional factor in plants. Int. J. Mol. Sci. 2018, 19, 1528. [Google Scholar] [CrossRef]
- Arnao, M.B.; Hernández-Ruiz, J. Growth activity, rooting capacity, and tropism: Three auxinic precepts fulfilled by melatonin. Acta Physiol. Plant. 2017, 39, 127. [Google Scholar] [CrossRef]
- Shi, H.; Wang, X.; Tan, D.X.; Reiter, R.J.; Chan, Z. Comparative physiological and proteomic analyses reveal the actions of melatonin in the reduction of oxidative stress in Bermuda grass (Cynodon dactylon (L). Pers.). J. Pineal Res. 2015, 59, 120–131. [Google Scholar] [CrossRef]
- Ding, F.; Wang, G.; Wang, M.; Zhang, S. Exogenous melatonin improves tolerance to water deficit by promoting cuticle formation in tomato plants. Molecules 2018, 23, 1605. [Google Scholar] [CrossRef]
- Fan, J.; Hu, Z.; Xie, Y.; Chan, Z.; Chen, K.; Amombo, E.; Chen, L.; Fu, J. Alleviation of cold damage to photosystem II and metabolisms by melatonin in Bermudagrass. Front. Plant Sci. 2015, 6, 925. [Google Scholar] [CrossRef]
- Marta, B.; Szafrańska, K.; Posmyk, M.M. Exogenous melatonin improves antioxidant defense in cucumber seeds (Cucumis sativus L.) germinated under chilling stress. Front. Plant Sci. 2016, 7, 1–12. [Google Scholar] [CrossRef]
- Ding, F.; Liu, B.; Zhang, S. Exogenous melatonin ameliorates cold-induced damage in tomato plants. Sci. Hortic. (Amst.) 2017, 219, 264–271. [Google Scholar] [CrossRef]
- Xu, W.; Cai, S.Y.; Zhang, Y.; Wang, Y.; Ahammed, G.J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Yu, J.Q.; Reiter, R.J.; et al. Melatonin enhances thermotolerance by promoting cellular protein protection in tomato plants. J. Pineal Res. 2016, 61, 457–469. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.; Zheng, G.; Li, W.; Wang, Y.; Hu, B.; Wang, H.; Wu, H.; Qian, Y.; Zhu, X.G.; Tan, D.X.; et al. Melatonin delays leaf senescence and enhances salt stress tolerance in rice. J. Pineal Res. 2015, 59, 91–101. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.Y.; Liu, J.L.; Wang, W.X.; Sun, Y. Exogenous melatonin improves growth and photosynthetic capacity of cucumber under salinity-induced stress. Photosynthetica 2016, 54, 19–27. [Google Scholar] [CrossRef]
- Li, M.Q.; Hasan, M.K.; Li, C.X.; Ahammed, G.J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Reiter, R.J.; Yu, J.Q.; Xu, M.X.; et al. Melatonin mediates selenium-induced tolerance to cadmium stress in tomato plants. J. Pineal Res. 2016, 61, 291–302. [Google Scholar] [CrossRef] [PubMed]
- Ding, F.; Wang, G.; Zhang, S. Exogenous melatonin mitigates methyl viologen-triggered oxidative stress in poplar leaf. Molecules 2018, 23, 2852. [Google Scholar] [CrossRef] [PubMed]
- Wei, Z.; Gao, T.; Liang, B.; Zhao, Q.; Ma, F.; Li, C. Effects of exogenous melatonin on methyl viologen-mediated oxidative stress in apple leaf. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef]
- Lee, H.Y.; Byeon, Y.; Back, K. Melatonin as a signal molecule triggering defense responses against pathogen attack in Arabidopsis and tobacco. J. Pineal Res. 2014, 57, 262–268. [Google Scholar] [CrossRef]
- Shi, H.; Chen, Y.; Tan, D.X.; Reiter, R.J.; Chan, Z.; He, C. Melatonin induces nitric oxide and the potential mechanisms relate to innate immunity against bacterial pathogen infection in Arabidopsis. J. Pineal Res. 2015, 59, 102–108. [Google Scholar] [CrossRef]
- Wang, P.; Sun, X.; Chang, C.; Feng, F.; Liang, D.; Cheng, L.; Ma, F. Delay in leaf senescence of Malus hupehensis by long-term melatonin application is associated with its regulation of metabolic status and protein degradation. J. Pineal Res. 2013, 55, 424–434. [Google Scholar]
- Zhang, N.; Zhao, B.; Zhang, H.J.; Weeda, S.; Yang, C.; Yang, Z.C.; Ren, S.; Guo, Y.D. Melatonin promotes water-stress tolerance, lateral root formation, and seed germination in cucumber (Cucumis sativus L.). J. Pineal Res. 2013, 54, 15–23. [Google Scholar] [CrossRef]
- Gao, H.; Zhang, Z.K.; Chai, H.K.; Cheng, N.; Yang, Y.; Wang, D.N.; Yang, T.; Cao, W. Melatonin treatment delays postharvest senescence and regulates reactive oxygen species metabolism in peach fruit. Postharvest Biol. Technol. 2016, 118, 103–110. [Google Scholar] [CrossRef]
- Zhang, J.; Shi, Y.; Zhang, X.; Du, H.; Xu, B.; Huang, B. Melatonin suppression of heat-induced leaf senescence involves changes in abscisic acid and cytokinin biosynthesis and signaling pathways in perennial ryegrass (Lolium perenne L.). Environ. Exp. Bot. 2017, 138, 36–45. [Google Scholar] [CrossRef]
- Zhou, X.; Zhao, H.; Cao, K.; Hu, L.; Du, T.; Baluška, F.; Zou, Z. Beneficial roles of melatonin on redox regulation of photosynthetic electron transport and synthesis of D1 protein in tomato seedlings under salt stress. Front. Plant Sci. 2016, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Reiter, R.J.; Tan, D.X.; Chan, Z. INDOLE-3-ACETIC ACID INDUCIBLE 17 positively modulates natural leaf senescence through melatonin-mediated pathway in Arabidopsis. J. Pineal Res. 2015, 58, 26–33. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Li, H.; Xu, B.; Li, J.; Huang, B. Exogenous melatonin suppresses dark-induced leaf senescence by activating the superoxide dismutase-catalase antioxidant pathway and down-regulating chlorophyll degradation in excised leaves of perennial ryegrass (Lolium perenne L.). Front. Plant Sci. 2016, 7, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Liang, D.; Shen, Y.; Ni, Z.; Wang, Q.; Lei, Z.; Xu, N.; Deng, Q.; Lin, L.; Wang, J.; Lv, X.; et al. Exogenous melatonin application delays senescence of kiwifruit leaves by regulating the antioxidant capacity and biosynthesis of flavonoids. Front. Plant Sci. 2018, 9, 1–14. [Google Scholar] [CrossRef]
- Shi, X.; Xu, S.; Mu, D.; Sadeghnezhad, E.; Li, Q.; Ma, Z.; Zhao, L.; Zhang, Q.; Wang, L. Exogenous melatonin delays dark-induced grape leaf senescence by regulation of antioxidant system and senescence associated genes (SAGs). Plants 2019, 8. [Google Scholar] [CrossRef]
- Arnao, M.B.; Hernández-Ruiz, J. Protective effect of melatonin against chlorophyll degradation during the senescence of barley leaves. J. Pineal Res. 2009, 46, 58–63. [Google Scholar] [CrossRef]
- Weeda, S.; Zhang, N.; Zhao, X.; Ndip, G.; Guo, Y.; Buck, G.A.; Fu, C.; Ren, S. Arabidopsis transcriptome analysis reveals key roles of melatonin in plant defense systems. PLoS ONE 2014, 9. [Google Scholar] [CrossRef]
- Hong, Y.; Zhang, Y.; Sinumporn, S.; Yu, N.; Zhan, X.; Shen, X.; Chen, D.; Yu, P.; Wu, W.; Liu, Q.; et al. Premature leaf senescence 3, encoding a methyltransferase, is required for melatonin biosynthesis in rice. Plant J. 2018, 95, 877–891. [Google Scholar] [CrossRef]
- Wasternack, C.; Hause, B. Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann. Bot. 2013, 111, 1021–1058. [Google Scholar] [CrossRef] [PubMed]
- Wasternack, C.; Strnad, M. Jasmonates: News on occurrence, biosynthesis, metabolism and action of an ancient group of signaling compounds. Int. J. Mol. Sci. 2018, 19, 2539. [Google Scholar] [CrossRef] [PubMed]
- Xie, D.; Xie, D.; Feys, B.F.; James, S.; Nieto-rostro, M.; Turner, J.G. COI1: An Arabidopsis gene required for jasmonate-regulated defense and fertility. Science (80-. ) 1998, 280, 1091–1994. [Google Scholar] [CrossRef] [PubMed]
- Pauwels, L.; Morreel, K.; De Witte, E.; Lammertyn, F.; Van Montagu, M.; Boerjan, W.; Inze, D.; Goossens, A. Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Arabidopsis cells. Proc. Natl. Acad. Sci. USA 2008, 105, 1380–1385. [Google Scholar] [CrossRef]
- Maksymiec, W.; Wianowska, D.; Dawidowicz, A.L.; Radkiewicz, S.; Mardarowicz, M.; Krupa, Z. The level of jasmonic acid in Arabidopsis thaliana and Phaseolus coccineus plants under heavy metal stress. J. Plant Physiol. 2005, 162, 1338–1346. [Google Scholar] [CrossRef]
- Clarke, S.M.; Cristescu, S.M.; Miersch, O.; Harren, F.J.M.; Wasternack, C.; Mur, L.A.J. Jasmonates act with salicylic acid to confer basal thermotolerance in Arabidopsis thaliana. New Phytol. 2009, 182, 175–187. [Google Scholar] [CrossRef]
- Zhao, Y.; Dong, W.; Zhang, N.; Ai, X.; Wang, M.; Huang, Z.; Xiao, L.; Xia, G. A wheat allene oxide cyclase gene enhances salinity tolerance via jasmonate signaling. Plant Physiol. 2014, 164, 1068–1076. [Google Scholar] [CrossRef]
- Yan, Y.; Christensen, S.; Isakeit, T.; Engelberth, J.; Meeley, R.; Hayward, A.; Emery, R.J.N.; Kolomiets, M.V. Disruption of OPR7 and OPR8 reveals the versatile functions of jasmonic acid in maize development and defense. Plant Cell 2012, 24, 1420–1436. [Google Scholar] [CrossRef]
- Lee, S.H.; Sakuraba, Y.; Lee, T.; Kim, K.W.; An, G.; Lee, H.Y.; Paek, N.C. Mutation of Oryza sativa CORONATINE INSENSITIVE 1b (OsCOI1b) delays leaf senescence. J. Integr. Plant Biol. 2015, 57, 562–576. [Google Scholar] [CrossRef]
- Shan, X.; Wang, J.; Chua, L.; Jiang, D.; Peng, W.; Xie, D. The role of arabidopsis rubisco activase in jasmonate-induced leaf senescence. Plant Physiol. 2011, 155, 751–764. [Google Scholar] [CrossRef]
- Ding, F.; Wang, M.; Zhang, S. Sedoheptulose-1,7-bisphosphatase is involved in methyl jasmonate- and dark-induced leaf senescence in tomato plants. Int. J. Mol. Sci. 2018, 19, 3673. [Google Scholar] [CrossRef] [PubMed]
- Patterson, B.D.; MacRae, E.A.; Ferguson, I.B. Estimation of hydrogen peroxide in plant extracts using titanium(IV). Anal. Biochem. 1984, 139, 487–492. [Google Scholar] [CrossRef]
- Jabs, T.; Dietrich, R.A.; Dang, J.L. Initiation of runaway cell death in an Arabidopsis mutant by extracellular superoxide. Science (80-. ) 1996, 273, 1853–1856. [Google Scholar] [CrossRef] [PubMed]
- Hodges, D.M.; Delong, J.M.; Forney, C.F.; Prange, R.K.; Delong, J.M.; Hodges, D.M.; Forney, C.F.; Prange, R.K. Improving the thiobarbituric anthocyanin for estimating lipid peroxidation in plant tissues containing anthocyanin and Other Interfering compounds. Planta 2015, 207, 604–611. [Google Scholar] [CrossRef]
- Li, M.; Ji, L.; Jia, Z.; Yang, X.; Meng, Q.; Guo, S. Constitutive expression of CaHSP22.5 enhances chilling tolerance in transgenic tobacco by promoting the activity of antioxidative enzymes. Funct. Plant Biol. 2018, 45, 575–585. [Google Scholar] [CrossRef]
- Li, M.F.; Guo, S.J.; Yang, X.H.; Meng, Q.W.; Wei, X.J. Exogenous gamma-aminobutyric acid increases salt tolerance of wheat by improving photosynthesis and enhancing activities of antioxidant enzymes. Biol. Plant. 2016, 60, 123–131. [Google Scholar] [CrossRef]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogenperoxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Harrison, E.P.; Willingham, N.M.; Lloyd, J.C.; Raines, C.A. Reduced sedoheptulose-1,7-bisphosphatase levels in transgenic tobacco lead to decreased photosynthetic capacity and altered carbohydrate accumulation. Planta 1998, 204, 27–36. [Google Scholar] [CrossRef]
- Wang, M.; Bi, H.; Liu, P.; Ai, X. Molecular cloning and expression analysis of the gene encoding sedoheptulose-1, 7-bisphosphatase from Cucumis sativus. Sci. Hortic. (Amst.) 2011, 129, 414–420. [Google Scholar] [CrossRef]
- Li, P.; Lei, K.; Li, Y.; He, X.; Wang, S.; Liu, R.; Ji, L.; Hou, B. Identification and characterization of the first cytokinin glycosyltransferase from rice. Rice 2019, 12. [Google Scholar] [CrossRef] [PubMed]
- Ding, F.; Wang, M.; Zhang, S.; Ai, X. Changes in SBPase activity influence photosynthetic capacity, growth, and tolerance to chilling stress in transgenic tomato plants. Sci. Rep. 2016, 6, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, W.; Wang, L.; Sun, Y. Exogenous melatonin improves seedling health index and drought tolerance in tomato. Plant Growth Regul. 2015, 77, 317–326. [Google Scholar] [CrossRef]
- Shi, H.; Wang, X.; Ye, T.; Chen, F.; Deng, J.; Yang, P.; Zhang, Y.; Chan, Z. The Cysteine2/Histidine2-type transcription factor ZINC FINGER OF ARABIDOPSIS THALIANA6 modulates biotic and abiotic stress responses by activating salicylic acid-related genes and C-REPEAT-BINDING FACTOR genes in Arabidopsis. Plant Physiol. 2014, 165, 1367–1379. [Google Scholar] [CrossRef] [PubMed]
- Arnao, M.B.; Hernández-Ruiz, J. Melatonin as a chemical substance or as phytomelatonin rich-extracts for use as plant protector and/or biostimulant in accordance with EC Legislation. Agronomy 2019, 9. [Google Scholar] [CrossRef]
- Ding, F.; Wang, M.; Liu, B.; Zhang, S. Exogenous melatonin mitigates photoinhibition by accelerating non-photochemical quenching in tomato seedlings exposed to moderate light during chilling. Front. Plant Sci. 2017, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Hu, W.; Kong, H.; Guo, Y.; Zhang, Y.; Ding, Z.; Tie, W.; Yan, Y.; Huang, Q.; Peng, M.; Shi, H.; et al. Comparative physiological and transcriptomic analyses reveal the actions of melatonin in the delay of postharvest physiological deterioration of cassava. Front. Plant Sci. 2016, 7, 1–12. [Google Scholar] [CrossRef]
- Ren, G.; An, K.; Liao, Y.; Zhou, X.; Cao, Y.; Zhao, H.; Ge, X.; Kuai, B. Identification of a Novel Chloroplast Protein AtNYE1 Regulating Chlorophyll Degradation during Leaf Senescence in Arabidopsis. Plant Physiol. 2007, 144, 1429–1441. [Google Scholar] [CrossRef]
- Jespersen, D.; Zhang, J.; Huang, B. Chlorophyll loss associated with heat-induced senescence in bentgrass. Plant Sci. 2016, 249, 1–12. [Google Scholar] [CrossRef]
- Morita, R.; Sato, Y.; Masuda, Y.; Nishimura, M.; Kusaba, M. Defect in non-yellow coloring 3, an α/β hydrolase-fold family protein, causes a stay-green phenotype during leaf senescence in rice. Plant J. 2009, 59, 940–952. [Google Scholar] [CrossRef]
- Muller, F.L.; Lustgarten, M.S.; Jang, Y.; Richardson, A.; Van Remmen, H. Trends in oxidative aging theories. Free Radic. Biol. Med. 2007, 43, 477–503. [Google Scholar] [CrossRef] [PubMed]
- Rolny, N.; Costa, L.; Carrión, C.; Guiamet, J.J. Is the electrolyte leakage assay an unequivocal test of membrane deterioration during leaf senescence? Plant Physiol. Biochem. 2011, 49, 1220–1227. [Google Scholar] [CrossRef] [PubMed]
- Debnath, B.; Hussain, M.; Irshad, M.; Mitra, S.; Li, M.; Liu, S.; Qiu, D. Exogenous melatonin mitigates acid rain stress to tomato plants through modulation of leaf ultrastructure, photosynthesis and antioxidant potential. Molecules 2018, 23. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wang, P.; Wei, Z.; Liang, D.; Liu, C.; Yin, L.; Jia, D.; Fu, M.; Ma, F. The mitigation effects of exogenous melatonin on salinity-induced stress in Malus hupehensis. J. Pineal Res. 2012, 53, 298–306. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Wang, K.; Li, Y.; Tan, Y.; Kong, J.; Li, H.; Li, Y.; Zhu, Y. Overexpression of SBPase enhances photosynthesis against high temperature stress in transgenic rice plants. Plant Cell Rep. 2007, 26, 1635–1646. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′-3′) |
---|---|
SAG-F | TGCAGTAGCAGCTATGGAAGG |
SAG-R | ACACCATCTGCTGCCTGGTAT |
SEN-F | AGGGTAGTGGAAATCTTGGAG |
SEN-R | GTTCCTTCAGCAATTGCTTTA |
PAO-F | TCATCTCCTCTTAGAGTAGCTGC |
PAO-R | ACCCACTGAGATCCAGATTTATC |
SlSBPASE-F | CGTGACATCTCCAACAGCTAAGG |
SlSBPASE-R | CATCGCTGCTGTAACCTCCAG |
SGR1-F | CTCAAGGCTTTTGTTCATGGAG |
SGR1-R | AGCCAAGGCATAACACTCACTG |
Actin-F | ATGTATGTTGCTATTCAGGCTGTG |
Actin-R | TAACCCTCGTAGATAGGGACAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, M.; Zhang, T.; Ding, F. Exogenous Melatonin Delays Methyl Jasmonate-Triggered Senescence in Tomato Leaves. Agronomy 2019, 9, 795. https://doi.org/10.3390/agronomy9120795
Wang M, Zhang T, Ding F. Exogenous Melatonin Delays Methyl Jasmonate-Triggered Senescence in Tomato Leaves. Agronomy. 2019; 9(12):795. https://doi.org/10.3390/agronomy9120795
Chicago/Turabian StyleWang, Meiling, Tong Zhang, and Fei Ding. 2019. "Exogenous Melatonin Delays Methyl Jasmonate-Triggered Senescence in Tomato Leaves" Agronomy 9, no. 12: 795. https://doi.org/10.3390/agronomy9120795
APA StyleWang, M., Zhang, T., & Ding, F. (2019). Exogenous Melatonin Delays Methyl Jasmonate-Triggered Senescence in Tomato Leaves. Agronomy, 9(12), 795. https://doi.org/10.3390/agronomy9120795