Next Article in Journal
Managing Tallgrass Prairies for Productivity and Ecological Function: A Long-Term Grazing Experiment in the Southern Great Plains, USA
Previous Article in Journal
Defining Fertilization Strategies for Sorghum (Sorghum bicolor (L.) Moench) Production Under Sudano-Sahelian Conditions: Options for Late Basal Fertilizer Application
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat

by
Adrian Duba
1,*,
Klaudia Goriewa-Duba
2 and
Urszula Wachowska
1
1
Department of Entomology, Phytopathology and Molecular Diagnostics, University of Warmia and Mazury, Prawocheńskiego 17, 10-720 Olsztyn, Poland
2
Department of Plant Breeding and Seed Production, University of Warmia and Mazury, Plac Łódzki 3, 10-724 Olsztyn, Poland
*
Author to whom correspondence should be addressed.
Agronomy 2019, 9(11), 698; https://doi.org/10.3390/agronomy9110698
Submission received: 12 September 2019 / Accepted: 29 October 2019 / Published: 30 October 2019
(This article belongs to the Section Crop Breeding and Genetics)

Abstract

:
New sources of resistance to fungal diseases, including FHB (Fusarium head blight), need to be identified. The results of research investigating ancient wheat species with desirable traits appear promising. The aim of this study was to determine the presence of Fusarium culmorum (W. G. Sm.) Sacc., F. graminearum Schwabe, F. poae (Peck) Wollenw, F. avenaceum (Fr.) Sacc. and F. langsethiae Torp & Nirenberg in the grain and glumes of diploid Triticum monococcum ssp. monococcum, tetraploid T. turgidum ssp. dicoccum, T. turgidum ssp. polonicum and T. turgidum ssp. durum, and hexaploid T. aestivum ssp. spelta and T. aestivum ssp. aestivum grown in north-eastern and south-eastern Poland and to analyze the trichothecene genotypes of the isolated strains. The results of this study also point to shifts in the genotype of Polish F. culmorum and F. graminearum populations from 3-ADON to NIV and 15-ADON to 3-ADON genotypes, respectively. Our findings indicate that selected einkorn lines could potentially be used as sources of genetic material for breeding new varieties resistant to FHB. The fungal genotypes should be closely screened in Poland and the neighboring countries to assess the effects of potential genotypes profile change on fungal virulence, toxin loading and host specificity.

1. Introduction

Fusarium culmorum (W. G. Sm.) Sacc. and F. graminearum Schwabe are the dominant pathogens of wheat spikes [1]. In wheat, the infections caused by the above species persist for a relatively long time from flowering to grain formation and maturation [2]. In addition to F. culmorum and F. graminearum, Fusarium head blight (FHB) is also caused by F. avenaceum (Fr.) Sacc., F. poae (Peck) Wollenw and F. langsethiae Torp & Nirenberg [3]. The disease compromises the quantity and quality of wheat yields by contaminating grain with mycotoxins, mainly trichothecenes, which pose a serious threat to human and animal health [4]. Trichothecenes are small molecules that can passively cross cell membranes. Ingested trichothecenes are easily absorbed by integumentary and gastrointestinal systems, and they directly affect rapidly proliferating tissues [5]. Trichothecenes are synthesized in a biochemical pathway from the trichodiene precursor [6]. The cluster of Tri genes is composed of 12 genes that are responsible for the synthesis of core trichothecene molecules, including Tri5 (which encodes the enzyme trichodiene synthase that catalyzes the cyclization and isomerization of furanyl phosphate to trichodiene), Tri4, Tri11 and Tri13 (which encode P450 cytochrome monooxygenase), Tri3, Tri7 and Tri8 (which encode specific enzymes that add or remove ester groups), Tri6 and Tri10 (regulatory genes which encode the regulators of other Tri genes) and Tri12 (which encodes a 14-membrane spanning domain major facilitator superfamily (MFS) transporter associated with trichothecene synthesis and resistance). The functions of genes Tri9 and Tri14 have not been elucidated to date [7]. Disruption of Tri5, Tri6 and Tri10 genes results in the complete elimination of trichothecenes [8]. The trichothecenes produced by fungi of the genus Fusarium have been classified into types A and B. All trichothecenes have a tricyclic 12,13-epoxytrichothec-9-ene (EPT) core structure [6] but they differ in substitution at position C-8. Type B trichothecenes have a keto (carbonyl) functional group at C-8 (nivalenol, deoxynivalenol, and trichothecin) [5].
The pathogenesis of FHB differs depending on the type of produced toxin. In wheat infected with isolates of F. graminearum and F. culmorum with the DON (deoxynivalenol) genotype, the disease spreads throughout the entire spike, whereas infections caused by NIV (nivalenol) genotype isolates are significantly less severe [9]. Fusarium species such as F. poae and F. langsethiae are unable to spread from the point of infection to the adjacent spikelets [10]. However, pathogens with a lower potential for producing mycotoxins, such as F. poae and F. langsethiae, co-infect plant tissues with the predominant F. graminearum and F. culmorum, and contribute to the contamination of grain with toxins [3].
Trichothecene chemotype diversity is biogeographically structured and correlated with species diversity [11]. Covarelli et al. [12] proved that climatic changes have a strong impact on the occurrence of the 3-ADON and 15-ADON genotypes. The same study indicates that the NIV genotype occurred regardless of weather conditions. On the other hand, Beyer et al. [13] analyzed the genotype shift of F. graminearum from 15-ADON to NIV during drought conditions. The hypothesis stated that drought might induce genotype change. At the same time, the percentage of F. culmorum strains with 3-ADON genotype was higher in comparison with previous years suggesting that dry weather was more inhibitive for F. graminearum. The drought favored F. culmorum of the NIV genotype but at the same time, those conditions suppressed FHB development on wheat heads. This could be an explanation of DON production dominance in European growing regions [13] by F. graminearum which is favored over F. culmorum in humid conditions [14]. However, there is also reported co-occurrence of NIV and DON producers, for example in Brazil [15], which suggests that genotype shifts might be conditioned by different responses of Fusarium strains to drought. In Dong’s [16] study, another environmental factor, the temperature, has been investigated. The results indicated that temperature may not be a critical factor in the distribution of Fusarium species and genotype composition.
The growing interest in healthy foods has contributed to the revival of ancient kinds of wheat. There is a general scarcity of research into Fusarium isolates from the grain of diploid einkorn (Triticum monococcum L. ssp. monococcum), tetraploid emmer (T. turgidum ssp. dicoccum (Schrank ex Schübl.) Thell.), tetraploid Polish wheat (T. turgidum L. ssp. polonicum (L.) Thell.) and hexaploid spelt (T. aestivum (L.) ssp. spelta Thell.). So far, researchers generally focused on fungal colonization of the most popular kinds of wheat: Tetraploid durum wheat (T. turgidum (L.) ssp. durum (Desf.) Husn.) and hexaploid bread wheat (T. aestivum (L.) ssp. aestivum) [17,18].
The aim of this study was to: (1) determine the presence of F. culmorum, F. graminearum, F. poae, F. avenaceum and F. langsethiae in the grain and glumes of diploid Triticum monococcum ssp. monococcum, tetraploid T. turgidum ssp. dicoccum, T. turgidum ssp. polonicum and T. turgidum ssp. durum, and hexaploid T. aestivum ssp. spelta and T. aestivum ssp. aestivum grown in north-eastern and eastern Poland; (2) analyze the trichothecene genotypes of the isolated strains.

2. Materials and Methods

2.1. Plant Material

Grain and glumes were obtained from the spikes of six spring and winter wheat species with low and moderate susceptibility to Fusarium spp. infections. The cultivar/line specific response to FHB disease was evaluated in 2014–2015 (see Table S1). The severity of disease was evaluated under field conditions. The FHB symptoms were determined in two growth stages: Milk maturity (BBCH 75) and hard maturity (BBCH 89). A minimum of 100 plants selected randomly from each line/cultivar were analyzed. The severity of infection was evaluated by calculating the average percentage of infected heads based on the scale developed by the European and Mediterranean Plant Protection Organization [19]. The disease symptoms of lines classified as susceptible appeared in early stages of development, symptoms of the disease were severe, pathogenic changes were observed on more than 30% of head surface area. The resistant lines were characterized by symptoms appearance in later stages of development, symptoms of the disease were not severe, pathogenic changes were observed on less than 30% of head surface area. In the first year of the experiment, 643 lines of the genus Triticum were sown, and in the second year 222 lines with high yield potential, including five lines of T. monococcum ssp. monococcum, 117 lines of T. turgidum ssp. dicoccum, 51 lines of T. turgidum ssp. polonicum, 48 lines of T. turgidum ssp. spelta and one T. aestivum ssp. aestivum line. Grain and glume colonization by fungi of the genus Fusarium was examined in plants characterized by high productive potential and resistance to infections. Spring wheats were sown in Bałcyny in north-eastern Poland (53°36′ N, 19°51′ E). The field experiment was carried out in a randomized complete blocks design (RCBD) with two replications. The area of a single plot was 6 m2 and the grains/spikelets were sown manually in spacing 10 cm × 20 cm. A plot experiment was established on medium-heavy silty pseudopodsolic soil developed from light loam of quality class IIIa, suitable for the production of wheat (good wheat complex, class 2 according to the Polish soil classification system). The preceding crop was a mixture of cereals and legumes. The seeds of winter durum wheat (T. turgidum ssp. durum) cvs. Duroflavus and Duromax were obtained from a commercial farm in south-east Poland (Lublin). The seeds of winter wheat cv. Komnata and spring wheat cv. Torka and Zebra were obtained from experimental plots in Bałcyny [20], and the seeds of winter bread wheat cv. Bogatka was obtained from experimental plots in Tomaszkowo [21].

2.2. Isolation and Morphological Identification of Fusarium Species

Wheat spikes were manually threshed to separate glumes from grain. The prevalence of Fusarium spp. in the grain of winter and spring wheat was determined by plating non-surface-disinfected glumes and kernels and kernels surface-disinfected in 1% NaOCl on potato dextrose agar (PDA, Merck, Poland) in Petri dishes. A total of 52 grain and glume samples were plated. The four technical replications were conducted. The number of Fusarium spp. colonies on grain and glumes were counted after seven days of incubation at 24 °C (En 120 Incubator, Warsaw, Poland). Filaments characteristic of Fusarium fungi were passaged onto small nutrient agar (SNA) and identified based on the morphological traits of colonies and spores. The isolates were initially identified to species level under a microscope (Nikon Eclipse, Tokyo, Japan) at 400× magnification. The morphological characteristics of Fusarium spp. isolates were determined according to Leslie and Sammerell [22]. A total of 305 isolates identified as F. culmorum, F. graminearum F. poae, F. langsethiae, F. avenaceum were obtained. The vast majority of these isolates belonged to F. culmorum and F. graminearum species. Molecular analyses were performed on 18 isolates of F. culmorum, 13 isolates of F. graminearum, 4 isolates of F. poae, 3 isolates of F. langsethiae and 1 isolate of F. avenaceum (Table 1). One technical replicate of PCR was conducted. The percentage structure of molecularly analyzed Fusarium isolates reflects the structure of 305 microscopically identified isolates.

2.3. Isolation and Amplification of Fungal DNA

Fungal filaments were cultured on PDA (Merck, Warsaw, Poland) for 48 h, then they were transferred to a liquid medium (0.1% beef extract, w/v, 0.5% soy peptone, w/v, 0.5% sodium chloride, w/v, 1% glucose, w/v, 0.7% yeast extract, w/v, distilled water) in 50 cm3 flasks. DNA was isolated from the filaments of fungi cultured on a liquid medium with the use of the Bead-Beat Micro AX Gravity kit (A&A Biotechnology, Gdansk, Poland) according to the manufacturer’s procedure. The quantity and quality of the isolated DNA were determined by measuring absorbance at a wavelength of 260 nm and 280 nm (NanoMaester Gen, Warsaw, Poland). The isolated DNA was amplified by PCR with primers specific for F. culmorum, F. graminearum, F. avenaceum, F. poae, F. langsethiae and F. equiseti (Table 2). A total of two biological and two technical replicates were conducted. The amplified products were electrophoresed on 1.2% agarose gel (Prona, Warsaw, Poland) with ethidium bromide (Merck Millipore, Warsaw, Poland) in TBE buffer (Sigma Aldrich, Warsaw, Poland). The products separated on agarose gel were visualized with a transilluminator (UVP, Poznan, Poland). The species identity of 24 isolates of Fusarium fungi was determined by PCR with conserved non-coding sequences ITS4 and ITS5 primers (Table 2). The reaction mixture contained 20 ng of previously isolated DNA. PCR was conducted according to the protocol described by White et al., [23]. The electrophoresis of ITS products was conducted on 1% agarose gel (Prona, Warsaw, Poland) with ethidium bromide (Merck Millipore, Warsaw, Poland) in TBE buffer (Sigma Aldrich, Warsaw, Poland). The separated products were visualized with a transilluminator (UVP, Poznan, Poland). Amplification products were sequenced by Genomed SA in Warsaw. Partial sequences of the small subunit 18S rDNA gene in the 5.8S rDNA region, large subunit 28S rDNA gene and ITS were obtained. Species identification based on sequence similarities was carried out with the BLAST tool in the NCBI database. After sequencing, ITS sequences were added into the test sequence window at the online BLAST program, which provided results in the form of best matches with the available sequences in GeneBank. A homology search was performed within the non-redundant databases of GeneBank using the BLAST algorithm at NCBI.

2.4. Determination of Trichothecene Genotypes

The strains identified as F. culmorum (18 isolates), F. graminearum (13 isolates) and F. poae (4 isolates) were screened for their potential ability to produce trichothecenes by detecting the amplification of the Tri5 gene marker with a specific primer pair (Table 2). F. culmorum and F. graminearum isolates with the ability to produce trichothecenes were subjected to multiplex-PCR analysis to determine their genotypes with specific primers that target genes involved in the synthesis of either 3ADON, 15ADON or NIV (Table 2). The PCR for Tri5 gene amplification and genotype identification was conducted according to a previously described procedure [28], and multiplex-PCR assays were conducted with 0.06 μL of each 100 μM forward primer and 0.18 μL of each 100 μM reverse primer. The described analyses were conducted in one technical replicate. Electrophoretic separation was carried out under the previously described conditions.

2.5. Sequence Homology

The sequences of the 24 analyzed isolates of Fusarium spp. were compared with the reference sequences from the NCBI database (Table 1), and their similarity was expressed in percentage terms. The reference material comprised four isolates of F. equiseti (Feq 3, Feq 25, Feq 36 and Feq 37) and two isolates of F. dimerum (Fd13 and Fd 15) from the seeds of Camelina sativa L. Crantz.

2.6. Statistical Analysis

The results were processed statistically in the Statistica program [31]. Data were subjected to ANOVA, and the significance of differences between means was estimated in Tukey’s test (p < 0.05) after Bliss transformation.

3. Results

3.1. Colonization of Wheat Glumes and Grain by Fusarium spp.

Since adhering spores on wheat kernels surface are able to cause infectious diseases, our aim was to compare non-disinfected and disinfected wheat Fusarium mycoflora in the same samples. This allowed us to compare Fusarium species occurrence between surface contamination and internal invasion. Fungi of the genus Fusarium colonized 45.03% of wheat glumes, 27.16% of non-surface-disinfected wheat kernels and 18.45% of surface-disinfected wheat kernels on average (Table 3). The prevalence of Fusarium spp. was highest on T. turgidum ssp. polonicum glumes (70%). The smallest average number of Fusarium colonies was observed on the glumes and grain of durum wheat. In emmer, spelt and Polish wheat, grain was significantly less colonized by Fusarium fungi (by 32.19%, 32.07% and 45.30%, respectively) than glumes (Table 3). The number of Fusarium colonies was significantly lower (by 47.32%) in surface-disinfected than in non-surface-disinfected kernels. Fusarium pathogens were detected in surface-disinfected kernels of three einkorn lines (out of six analyzed lines), 20 emmer lines (out of 21), one durum wheat cultivar (out of three) and three bread wheat cultivars/lines (out of three). In einkorn and bread wheat, the number of fungal colonies differed significantly between glumes and surface-disinfected kernels. Fusarium pathogens were not detected only in surface-disinfected kernels of three einkorn lines (out of six analyzed lines), one emmer line (out of 21 analyzed lines), two durum wheat cultivars (out of three analyzed cultivars) and three bread wheat cultivars/lines (out of three analyzed cultivars). In contrast to the other analyzed wheat species, einkorn was characterized by the lowest level of Fusarium infection. Additionally, the percentage of einkorn glumes and non-disinfected kernels colonized by Fusarium fungi is below the mean for other investigated wheats, except for durum wheat.

3.2. Identification of Fusarium Species

Specific PCR and morphological analyses supported the identification of 39 isolates of Fusarium fungi to species level. Analyses were performed on 18 isolates of F. culmorum, 13 isolates of F. graminearum, four isolates of F. poae, three isolates of F. langsethiae and one isolate of F. avenaceum. In the analyzed group of 39 strains, the predominant fungal species was F. culmorum (46.2% of all isolates) which was isolated from the grain of Polish wheat (seven isolates), durum wheat (cv. Komnata from Bałcyny, six isolates) and spelt (five isolates). From the grain of bread wheat only two isolates of F. culmorum have been isolated. F. graminearum accounted for 33.3% of all isolates, mainly from the grain and glumes of Polish wheat (seven isolates) and durum wheat (cvs. Duromax and Duroflavus from Lublin, four isolates), and from einkorn and emmer glumes (two isolates). Wheat grain grown in south-east Poland was colonized exclusively by F. graminearum. Isolates of F. poae, F. langsethiae and F. avenaceum accounted for, respectively, 10.3% (einkorn, emmer and Polish wheat), 7.7% (emmer, Polish wheat and bread wheat) and 2.5% (wheat cv. Bogatka) of analyzed isolates.

3.3. Genotype Determination in Fusarium spp. Isolates

The strains of F. culmorum (18 isolates), F. graminearum (13 isolates) and F. poae (four isolates) were analyzed for the presence of the Tri5 gene encoding trichothecene synthesis. All of the F. graminearum and F. culmorum isolates (Table 4, see Figure S1) had the potential ability to produce trichothecenes. None of the tested F. poae isolates were capable of producing trichothecenes.
The genotypes of trichothecene-producing isolates were identified based on the presence of the Tri12 gene encoding the transporter associated with trichothecene synthesis and resistance (Table 4). Fusarium genotypes were identified based on Tri12 gene polymorphism. Fusarium isolates differed in the size of amplification products of the Tri12 gene, which determined their genotype. Only isolates harboring the Tri5 gene, which encodes the production of different mycotoxins, were analyzed. In the group of 18 F. culmorum isolates, 10 isolates belonged to the NIV genotype (products with the size of 840 bp) and the remaining isolates belonged to the 3-ADON genotype (410 bp). The analyzed isolates of F. graminearum with the Tri5 gene belonged to the 3-ADON genotype (six isolates) and 15-ADON genotype (seven isolates) (see Figure S2).

3.4. Sequence Homology

The sequences of conserved ITS1 and ITS2 regions were used to confirm the species identity of Fusarium fungi identified by PCR. The nucleotide sequences of 30 own isolates had 90%–99% affinity with the reference sequences (see Table S2), which confirmed their species identity.

4. Discussion

Recent years have witnessed a revived interest in relict wheat species which are characterized by a unique population habit resulting from cultivation in isolated areas and the absence of selection [32]. The rich gene pool of these species can be reflected in increased resistance to pathogen infections, especially considering that ancient wheat species are referred to as “the covered wheats” since their kernels do not thresh free of the glumes. The objectives of this study were to evaluate the presence of selected Fusarium spp. on six wheat species grain and glumes (einkorn, Polish wheat, emmer, spelt and bread wheat) and analyse if Fusarium isolates are characterized by potential ability to produce trichothecenes. Most wheats were grown in north-eastern Poland (Region of Warmia and Mazury). The only exception was durum wheat which was grown in south-eastern Poland.
The visual examination of the grain samples constitutes an efficient tool in the selection of wheat grains with higher levels of Fusarium infection often caused by Fusarium spp. forming trichothecenes. Thus, trichothecene contamination monitoring of such grain is highly recommended before incorporating wheat grains into the food industry. We have investigated the spread of infection of Fusarium fungi between glumes and grain of different kinds of wheat including relict species. In this study, we have observed that grain and glumes of all analyzed lines of spelt and Polish wheat were colonized by Fusarium fungi that are able to effectively spread from glumes to grain of these wheats. The percentage of Polish wheat and spelt kernels and glumes colonized by toxin-producing Fusarium fungi was worryingly high. A similar threat was observed in Góral et al., [33] research in which the spelt genotype was characterized by the highest amount of DON in grain. Also, Wiśniewska and Kowalczyk [34] reported the susceptibility of Polish wheat to Fusarium infection. Polish wheat and spelt are characterized by high genetic variation [35,36,37]. However, genetic variability can lead to the emergence of both resistant and sensitive lines. The results of this study indicate that the analyzed lines of Polish wheat and spelt were susceptible to infections with Fusarium fungi; therefore, they should not be considered as potential donors of genetic material for modern wheats.
The pathogens were not determined in the surface-disinfected grain of three einkorn lines, one emmer line, two durum wheat cultivars, and four bread wheat cultivars/lines. This has shown that Fusarium spp. isolates present on wheat grains were not able to penetrate the grain tissues. The results of this study may suggest that several einkorn lines and one emmer line could be potentially used as sources of resistance to Fusarium fungi. The results of einkorn glumes and kernels colonization are promising due to the low mean values of Fusarium fungi colonization. The einkorn grain hulling could be a favorable factor as a morphological barrier that conditions resistance to infection. However, further molecular and biochemical analyses are required to confirm this hypothesis. Einkorn grain is less contaminated with Fusarium pathogens, in particular, mycotoxin-producing species, which could increase the popularity of products made of einkorn flour. According to Lombardo et al., [38], einkorn gluten is less immunoreactive; therefore, this wheat species could be a potential candidate in the production of hypoallergenic bakery products. Interestingly, the smallest average number of Fusarium colonies was observed on the glumes and grain of durum wheat. There are many findings concerning the paucity of FHB resistance in durum wheats [39,40,41]. Thus, a low level of Fusarium infections on durum wheat grain and glumes may be an indicator of the potential resistance genes presence which might be useful in durum wheat breeding, however that should be investigated in more detail.
Fungi that cause FHB in wheat grain should be closely monitored to guarantee a high degree of food security. In this study, PCR supported the rapid identification of Fusarium species and trichothecene-producing isolates, as well as the classification of fungal genotypes. Similar studies are conducted in other countries [42,43].
In north-eastern Poland, F. culmorum was isolated predominantly from wheat grain and glumes. The second most-often isolated species was F. graminearum. F. poae, F. langsethiae and F. avenaceum constituted the minority of the isolated species (extended data is not shown; the percentage structure of the 39 Fusarium spp. isolates analyzed reflects the diversity of 305 isolates previously microscopically identified). Perry et al., [44] and Wachowska et al., [45] observed a predominance of F. culmorum in cool and moderately humid regions. The experimental material for this study was obtained from north-eastern Poland which has a similar climate. In a study by Stępień et al., [46], 41 of 57 Fusarium species isolated from wheat grain in southern Poland belonged to F. graminearum species, and their identity was confirmed by specific PCR reactions. The climate of southern Poland is characterized by higher average temperatures and higher humidity, which could explain the predominance of F. graminearum fungi in that region. In this study, durum wheat grain grown in Lublin (south-eastern Poland) was also colonized exclusively by F. graminearum isolates. According to Xu and Nicholson [10], an increased presence of F. graminearum isolates decreases the prevalence of F. poae. In this research, F. graminearum colonies were isolated three times more often than F. poae, which seems to confirm the above observation. The prevalence of F. graminearum isolates could also be attributed to variations in temperature and humidity during the study. F. graminearum thrives in temperate regions with daytime temperatures of 12–24 °C and nighttime temperatures of 5–12 °C, whereas F. poae proliferate more readily in warmer and drier climates. In this study, average summer temperatures reached 20–22 °C, and they were conducive to the growth of F. graminearum, but not F. poae.
The variability of trichothecene genotypes has been thoroughly investigated in many studies of Fusarium populations that cause FHB [10,24,26]. Tri5, Tri7 and Tri12 are the major genes encoding mycotoxin synthesis [12]. Pinson-Gadais et al., [47] and Yörük and Albayrak [48] detected the Tri5 gene in all analyzed isolates of F. culmorum. However, those isolates were obtained from bread wheat grain. In our study, all analyzed F. culmorum isolates harbored the Tri5 gene encoding trichothecene production. The analyzed isolates of F. culmorum were obtained mainly from the grain of Polish wheat, durum wheat and spelt. Only two isolates from our collection were obtained from bread wheat grain. Fusarium culmorum isolates with the Tri5 gene synthesized mostly NIV (55.6% of analyzed isolates) and the acetylated forms of deoxynivalenol—3-ADON (44.4% of isolates). More than a decade ago, Stępień et al., [46] reported that in Poland the 3-ADON genotype was most frequent among F. culmorum isolates. Similar results were reported by Jennings et al., [25], Stępień et al., [46], Yörük and Albayrak [48] and Covarelli et al., [12] who found that all or most of the analyzed isolates of F. culmorum belonged to the 3-ADON genotype. Waalwijk et al., [30], Jennings et al., [25] and Pasquali et al., [49] reported in their studies that both DON and NIV chemotypes were present among the analyzed isolates of F. culmorum. Observed in our study high proportion of the NIV chemotype among F. culmorum population is consistent with some results present in a European database of F. graminearum and F. culmorum trichothecene genotypes [50] and other studies [30]. According to research by Pasquali et al., [50], the dominant NIV genotype among F. culmorum is characterized for some specific regions in Europe: South England, North France and North-East Germany. Our results could be indicative of a new wave of changes in the genotype of F. culmorum isolates. There are many reports on chemotype shifts in certain areas [51,52]. However, more extended studies should be performed to obtain epidemiological information. Several years ago, Pasquali et al., [49] emphasized that wheat grain should be closely monitored for the presence of NIV and DON to improve global food security standards. Grain contamination with NIV is often overlooked because this toxin frequently occurs in low concentrations in wheat [53]. However, NIV is more toxic than DON, it inhibits DNA synthesis and induces cell death. Nivalenol is also more toxic to human blood cells than DON [54].
In our study, all of the F. graminearum isolates from our own collection harbored the Tri5 gene marker and were DON genotype (six isolates belonged to 3-ADON and seven isolates to 15-ADON genotype). 15-ADON was the predominant genotype in F. graminearum strains isolated in different regions, including the Benelux countries [27], Poland [46] and Turkey [48]. According to the results of Pasquali et al., [50], the 15-ADON genotype is rarely observed in Northern Europe and is specific to the West, Central, East and South regions of Europe where it is considered the major cause of DON accumulation in wheat. The database from Pasquali et al., [50] showed that in Eastern Poland and South-East Poland F. graminearum strains are mostly characterized by 15-ADON genotype. F. graminearum strains in this study were collected from Warmia and Mazury region situated in North-East Poland and Lublin positioned in South-East Poland. The majority of these isolates (53.8%) were the 15-ADON genotype, however the authors have also observed a high proportion of 3-ADON isolates (46.2%) which are usually found in Northern regions of Europe. This data also suggests that a new wave of changes in the genotype across European F. graminearum strains may be present.
According to the literature, F. poae strains capable of producing type B trichothecenes generally belong to the NIV genotype [52], but type A trichothecene-producers capable of synthesizing HT-2 and T-2 toxins have also been identified [55]. In our study, none of the tested F. poae isolates were capable of producing trichothecenes. The isolates from our own collection did not produce type B trichothecenes; it appears that they produced mostly type A trichothecenes, which however requires further investigation.
The possible change of trichothecenes genotypes among F. culmorum and F. graminearum isolates in Poland require further investigation involving greater number of Fusarium isolates. However, our data indicate that previously rarely occurring in Poland genotypes of F. culmorum (NIV) and F. graminearum (3-ADON) are present in Fusarium species populations in high proportion thus there is a need to assess the effects of these genotypes on fungal virulence, toxin loading and host specificity that could impact on future disease management and plant breeding. The results of this study suggest that several einkorn lines and one emmer line could be potentially used as sources of resistance to Fusarium fungi. The genetic variability of relict wheat species can contribute to new resistant wheat varieties development.

Supplementary Materials

The following are available online at https://www.mdpi.com/2073-4395/9/11/698/s1, Figure S1: Gel image after electrophoresis. EtBr was added to the gel before electrophoresis to visualize products with the expected size of 544 bp. Line 1: 100–1000 bp marker. all lines- exemplary F.culmorum and F. graminearum isolates with the Tri5 gene marker; Figure S2, Gel image after electrophoresis. EtBr was added to the gel before electrophoresis to visualize products with the expected size of 410 bp. Lines 1–6: Exemplary F. graminearum isolates with the Tri12 gene producing 3-ADON. Line 7: 100–1000 bp marker; Table S1: Selected lines and cultivars of the genus Triticum with varied susceptibility to FHB; Table S2, Sequence alignment in Fusarium spp. isolates from own collection and reference isolates from NCBI.

Author Contributions

Conceptualization, A.D., K.G.-D. and U.W.; methodology, A.D. and K.G.-D.; software, A.D., K.G.-D. and U.W.; validation, A.D., K.G.-D.; formal analysis, A.D., K.G.-D.; investigation, A.D., K.G.-D. and U.W.; resources, A.D. and U.W.; data curation, K.G.-D. and U.W.; writing—original draft preparation, A.D. and K.G.-D.; writing—review and editing, A.D. and K.G.-D.; visualization, A.D. and K.G.-D.; supervision, U.W.; project administration, U.W.; funding acquisition, A.D. and U.W.

Funding

This research received no external funding.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yli-Mattila, T.; Rämö, S.; Hietaniemi, V.; Hussien, T.; Carlobos-Lopez, A.L.; Cumagun, C.J.R. Molecular quantification and genetic diversity of toxigenic Fusarium species in Northern Europe as compared to those in Southern Europe. Microorganisms 2013, 1, 162–174. [Google Scholar] [CrossRef] [PubMed]
  2. Ma, L.J.; Geiser, D.M.; Proctor, R.H.; Rooney, A.P.; O’Donnell, K.; Trail, F.; Gardiner, D.M.; Manners, J.M.; Kazan, K. Fusarium pathogenomics. Annu. Rev. Microbiol. 2013, 67, 399–416. [Google Scholar] [CrossRef] [PubMed]
  3. Drakulic, J.; Kahar, M.H.; Ajigboye, O.; Bruce, T.; Ray, R.V. Contrasting roles of deoxynivalenol and nivalenol in host-mediated interactions between Fusarium graminearum and Sitobion avenae. Toxins 2016, 8, 353. [Google Scholar] [CrossRef] [PubMed]
  4. Palacios, S.A.; Erazo, J.G.; Ciasca, B.; Lattanzio, V.M.; Reynoso, M.M.; Farnochi, M.C.; Torres, A.M. Occurrence of deoxynivalenol and deoxynivalenol-3-glucoside in durum wheat from Argentina. Food Chem. 2017, 230, 728–734. [Google Scholar] [CrossRef]
  5. McCormick, S.P.; Stanley, A.M.; Stover, N.A.; Alexander, N.J. Trichothecenes: From simple to complex mycotoxins. Toxins 2011, 3, 802–814. [Google Scholar] [CrossRef]
  6. Grove, J.F. The trichothecenes and their biosynthesis. Fortschr. Chem. Org. Naturst. 2007, 88, 63–130. [Google Scholar] [CrossRef]
  7. Proctor, R.H.; McCormick, S.P.; Alexander, N.J.; Desjardins, A.E. Evidence that a secondary metabolic biosynthetic gene cluster has grown by gene relocation during evolution of the filamentous fungus Fusarium. Mol. Microbiol. 2009, 74, 1128–1142. [Google Scholar] [CrossRef]
  8. Desjardins, A.E.; Proctor, R.H. Molecular biology of Fusarium mycotoxins. Int. J. Food Microbiol. 2007, 119, 47–50. [Google Scholar] [CrossRef]
  9. Foroud, N.A.; McCormick, S.P.; MacMillan, T.; Badea, A.; Kendra, D.F.; Ellis, B.E.; Eudes, F. Greenhouse studies reveal increased aggressiveness of emergent Canadian Fusarium graminearum genotypes in wheat. Plant Dis. 2012, 96, 1271–1279. [Google Scholar] [CrossRef]
  10. Xu, X.; Nicholson, P. Community ecology of fungal pathogens causing wheat head blight. Annu. Rev. Phytopathol. 2009, 47, 83–103. [Google Scholar] [CrossRef]
  11. Vaughan, M.; Backhouse, D.; Ponte, E.D. Climate change impacts on the ecology of Fusarium graminearum species complex and susceptibility of wheat to Fusarium head blight: A review. World Mycotoxin J. 2016, 9, 685–700. [Google Scholar] [CrossRef]
  12. Covarelli, L.; Beccari, G.; Prodi, A.; Generotti, S.; Etruschi, F.; Juan, C.; Ferrer, E.; Mañes, J. Fusarium species, genotype characterisation and trichothecene contamination of durum and soft wheat in an area of central Italy. J. Sci. Food Agric. 2015, 95, 540–551. [Google Scholar] [CrossRef] [PubMed]
  13. Beyer, M.; Pogoda, F.; Pallez, M.; Lazic, J.; Hoffmann, L.; Pasquali, M. Evidence for a reversible drought induced shift in the species composition of mycotoxin producing Fusarium head blight pathogens isolated from symptomatic wheat heads. Int. J. Food Microbiol. 2014, 182–183, 51–56. [Google Scholar] [CrossRef] [PubMed]
  14. Beyer, M.; Klix, M.B.; Verreet, J.A. Estimating mycotoxin contents of Fusarium-damaged winter wheat kernels. Int. J. Food Microbiol. 2007, 119, 153–158. [Google Scholar] [CrossRef] [PubMed]
  15. Del Ponte, E.M.; Garda-Buffon, J.; Badiale-Furlong, E. Deoxynivalenol and nivalenol in commercial wheat grain related to Fusarium head blight epidemics in southern Brazil. Food Chem. 2012, 132, 1087–1091. [Google Scholar] [CrossRef]
  16. Dong, F.; Qiu, J.; Xu, J.; Yu, M.; Wang, S.; Sun, Y.; Zhang, G.; Shi, J. Effect of environmental factors on Fusarium population and associated trichothecenes in wheat grain grown in Jiangsu province, China. Int. J. Food Microbiol. 2016, 230, 58–63. [Google Scholar] [CrossRef] [PubMed]
  17. Alkadri, D.; Nipoti, P.; Döll, K.; Karlovsky, P.; Prodi, A.; Pisi, A. Study of fungal colonization of wheat kernels in Syria with a focus on Fusarium species. Int. J. Mol. Sci. 2013, 14, 5938–5951. [Google Scholar] [CrossRef]
  18. Lenc, L. Fusarium head blight (FHB) and Fusarium populations in grain of winter wheat grown in different cultivation systems. J. Plant Prot. Res. 2015, 55, 94–109. [Google Scholar] [CrossRef]
  19. EPPO. European and Mediterranean Plant Protection Organization Global Database. 2018. Available online: https://gd.eppo.int (accessed on 6 August 2018).
  20. Wachowska, U.; Duba, A.; Ratuszny, J.; Goriewa, K.; Wiwart, M. The health status of Triticum aestivum and T. durum leaves protected with biological control agents, a plant biostimulator, a plant resistance inducer and chemical fungicides. Commun. Appl. Biol. Sci. Univ. 2016, 81, 85–90. [Google Scholar]
  21. Wachowska, U.; Waśkiewicz, A.; Jędryczka, M. Using a protective treatment to reduce Fusarium pathogens and mycotoxins contaminating winter wheat. Pol. J. Environ. Stud. 2017, 26, 2277–2286. [Google Scholar] [CrossRef]
  22. Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Blackwell Publishing: Ames, IA, USA, 2006. [Google Scholar]
  23. White, T.J.; Bruns, T.; Lee, S.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Shinsky, J., White, T.J., Eds.; Academic Press Inc.: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
  24. Miedaner, T.; Cumagun, C.J.R.; Chakraborty, S. Population genetics of three important head blight pathogens Fusarium graminearum, F. pseudograminearum and F. culmorum. J. Phytopathol. 2008, 156, 129–139. [Google Scholar] [CrossRef]
  25. Jennings, P.; Coates, M.E.; Turner, J.A.; Chandler, E.A.; Nicholson, P. Determination of deoxynivalenol and nivalenol genotypes of Fusarium culmorum isolates from England and Wales by PCR assay. Plant Pathol. 2004, 53, 182–190. [Google Scholar] [CrossRef]
  26. Starkey, D.E.; Ward, T.J.; Aoki, T.; Gale, L.R.; Kistler, H.C.; Geiser, D.M.; Suga, H.; Toth, B.; Varga, J.; O’Donnell, K. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genet. Biol. 2007, 44, 1191–1204. [Google Scholar] [CrossRef]
  27. Audenaert, K.; van Broeck, R.; Bekaert, B.; de Witte, F.; Heremans, B.; Höfte, M.; Haesaert, G. Fusarium head blight (FHB) in Flanders: Population diversity, inter-species associations and DON contamination in commercial winter wheat varieties. Eur. J. Plant Pathol. 2009, 125, 445–458. [Google Scholar] [CrossRef]
  28. Nicholson, P.; Simpson, D.R.; Wilson, A.H.; Chandler, E.; Thomsett, M. Detection and differentiation of trichothecene and enniatin-producing Fusarium species on small-grain cereals. In Molecular Diversity and PCR-Detection of Toxigenic Fusarium Species and Ochratoxigenic Fungi; Mulè, G., Bailey, J.A., Cooke, B.M., Logrieco, A., Eds.; Springer: Dordrecht, The Netherlands, 2004; pp. 503–514. [Google Scholar]
  29. Ward, T.J.; Clear, R.M.; Rooney, A.P.; O’Donnell, K.; Gaba, D.; Patrick, S.; Starkey, D.E.; Gilbert, J.; Geiser, D.M.; Nowicki, T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008, 45, 473–484. [Google Scholar] [CrossRef]
  30. Waalwijk, C.; Kastelein, P.; de Vries, I.; Kerényi, Z.; van der Lee, T.; Hesselink, T.; Köhl, J.; Kema, G. Major changes in Fusarium spp. in wheat in the Netherlands. Eur. J. Plant Pathol. 2003, 109, 743–754. [Google Scholar] [CrossRef]
  31. StatSoft, Inc. Electronic Statistics Textbook; StatSoft: Tulsa, OK, USA, 2013; Available online: http://www.statsoft.com/textbook/ (accessed on 25 June 2019).
  32. Gurcan, K.; Demirel, F.; Tekin, M.; Demirel, S.; Akar, T. Molecular and agro-morphological characterization of ancient wheat landraces of turkey. BMC Plant Biol. 2017, 17, 171. [Google Scholar] [CrossRef]
  33. Góral, T.; Ochodzki, P.; Bulinska-Radomska, Z. Resistance of species from genus Triticum to Fusarium head blight and accumulation of Fusarium-metabolites in grain. Cereal Res. Commun. 2008, 36, 95–97. [Google Scholar]
  34. Wiśniewska, H.; Kowalczyk, K. Resistance of cultivars and breeding lines of spring wheat to Fusarium culmorum and powdery mildew. J. Appl. Genet. 2005, 46, 35–40. [Google Scholar]
  35. Pan, D.; Hong, L.; Wei, L.; Peng-Fei, Q.; Yu-Ming, W.; Zheng, Y.L. Genetic diversity of storage proteins in Triticum polonicum L. J. Plant Sci. 2007, 2, 416–424. [Google Scholar]
  36. Laidò, G.; Mangini, G.; Taranto, F.; Gadaleta, A.; Blanco, A.; Cattivelli, L.; Marone, D.; Mastrangelo, A.M.; Papa, R.; de Vita, P. Genetic diversity and population structure of tetraploid wheats (Triticum turgidum L.) estimated by SSR, DArT and pedigree data. PLoS ONE 2013, 8, e67280. [Google Scholar] [CrossRef] [PubMed]
  37. Müller, T.; Schierscher-Viret, B.; Fossati, D.; Brabant, C.; Schori, A.; Keller, B.; Krattinger, S.G. Unlocking the diversity of genebanks: Whole-genome marker analysis of Swiss bread wheat and spelt. Theor. Appl. Genet. 2018, 131, 407–416. [Google Scholar] [CrossRef] [PubMed]
  38. Lombardo, C.; Bolla, M.; Chignola, R.; Senna, G.; Rossin, G.; Caruso, B.; Tomelleri, C.; Cecconi, D.; Brandolini, A.; Zoccatelli, G. Study on the immunoreactivity of Triticum monococcum (Einkorn) wheat in patients with wheat-dependent exercise-induced anaphylaxis for the production of hypoallergenic foods. J. Agric. Food Chem. 2015, 63, 8299–8306. [Google Scholar] [CrossRef] [PubMed]
  39. Chen, X.; Faris, J.D.; Hu, J.; Stack, R.W.; Adhikari, T.; Elias, E.M.; Kianian, S.F.; Cai, X. Saturation and comparative mapping of a major Fusarium head blight resistance QTL in tetraploid wheat. Mol. Breed. 2007, 19, 113–124. [Google Scholar] [CrossRef]
  40. Buerstmayr, H.; Ban, T.; Anderson, J.A. QTL mapping and marker-assisted selection for Fusarium head blight resistance in wheat: A review. Plant Breed. 2009, 128, 1–26. [Google Scholar] [CrossRef]
  41. Steiner, B.; Michel, S.; Maccaferri, M.; Lemmens, M.; Tuberosa, R.; Buerstmayr, H. Exploring and exploiting the genetic variation of Fusarium head blight resistance for genomic-assisted breeding in the elite durum wheat gene pool. Theor. Appl. Genet. 2019, 132, 969–988. [Google Scholar] [CrossRef] [PubMed]
  42. Quarta, A.; Mita, G.; Haidukowski, M.; Logrieco, A.; Mule, G.; Visconti, A. Multiplex PCR assay for the identification of nivalenol, 3-and 15-acetyl-deoxynivalenol genotypes in Fusarium. FEMS Microbiol. Lett. 2006, 259, 7–13. [Google Scholar] [CrossRef]
  43. Sanoubar, R.; Bauer, A.; Seigner, L. Detection, identification and quantification of Fusarium graminearum and Fusarium culmorum in wheat kernels by PCR techniques. J. Plant Pathol. Microbiol. 2015, 6, 1–8. [Google Scholar]
  44. Perry, J.N. Spatial analysis by distance indices. J. Anim. Ecol. 1995, 64, 303–314. [Google Scholar] [CrossRef]
  45. Wachowska, U.; Stasiulewicz-Paluch, A.D.; Glowacka, K.; Mikolajczyk, W.; Kucharska, K. Response of epiphytes and endophytes isolated from winter wheat grain to biotechnological and fungicidal treatments. Pol. J. Environ. Stud. 2013, 22, 267–273. [Google Scholar]
  46. Stępień, Ł.; Popiel, D.; Koczyk, G.; Chełkowski, J. Wheat-infecting Fusarium species in Poland—Their genotypes and frequencies revealed by PCR assay. J. Appl. Genet. 2008, 49, 433–441. [Google Scholar] [CrossRef] [PubMed]
  47. Pinson-Gadais, L.; Barreau, C.; Chaurand, M.; Gregoire, S.; Monmarson, M.; Richard-Forget, F. Distribution of toxigenic Fusarium spp. and mycotoxin production in milling fractions of durum wheat. Food Addit. Contam. 2007, 24, 53–62. [Google Scholar] [CrossRef] [PubMed]
  48. Yörük, E.; Albayrak, G. Chemotyping of Fusarium graminearum and F. culmorum isolates from Turkey by PCR assay. Mycopathologia 2012, 173, 53–61. [Google Scholar] [CrossRef] [PubMed]
  49. Pasquali, M.; Giraud, F.; Brochot, C.; Cocco, E.; Hoffmann, L.; Bohn, T. Genetic Fusarium chemotyping as a useful tool for predicting nivalenol contamination in winter wheat. Int. J. Food Microbiol. 2010, 137, 246–253. [Google Scholar] [CrossRef]
  50. Pasquali, M.; Beyer, M.M.; Logrieco, A.; Audenaert, K.; Balmas, V.; Basler, R.; Boutigny, A.L.; Chrpová, J.; Czembor, E.; Gagkaeva, T.; et al. A European database of Fusarium graminearum and F. culmorum trichothecene genotypes. Front. Microbiol. 2016, 7, 406. [Google Scholar] [CrossRef]
  51. Nielsen, L.K.; Jensen, J.D.; Rodríguez, A.; Jørgensen, L.N.; Justesen, A.F. TRI12 based quantitative real-time PCR assays reveal the distribution of trichothecene genotypes of F. graminearum and F. culmorum isolates in Danish small grain cereals. Int. J. Food Microbiol. 2012, 157, 384–392. [Google Scholar] [CrossRef]
  52. Stenglein, S.A.; Dinolfo, M.I.; Barros, G.; Bongiorno, F.; Chulze, S.N.; Moreno, M.V. Fusarium poae pathogenicity and mycotoxin accumulation on selected wheat and barley genotypes at a single location in Argentina. Plant Dis. 2014, 98, 1733–1738. [Google Scholar] [CrossRef]
  53. Alkadri, D.; Rubert, J.; Prodi, A.; Pisi, A.; Mañes, J.; Soler, C. Natural co-occurrence of mycotoxins in wheat grains from Italy and Syria. Food Chem. 2014, 157, 111–118. [Google Scholar] [CrossRef]
  54. Minervini, F.; Fornelli, F.; Flynn, K.M. Toxicity and apoptosis induced by the mycotoxins nivalenol, deoxynivalenol and fumonisin B1 in a human erythroleukemia cell line. Toxicol. Vitr. 2004, 18, 21–28. [Google Scholar] [CrossRef]
  55. Thrane, U.; Adler, A.; Clasen, P.E.; Galvano, F.; Langseth, W.; Lew, H.; Logrieco, A.; Nielsen, K.F.; Ritieni, A. Diversity in metabolite production by Fusarium langsethiae, Fusarium poae, and Fusarium sporotrichioides. Int. J. Food Microbiol. 2004, 95, 257–266. [Google Scholar] [CrossRef]
Table 1. List of Fusarium spp. isolates.
Table 1. List of Fusarium spp. isolates.
Code of Fusarium Isolates SpeciesCollectionSequence Alignment AnalysisReference Isolate (NCBI)
Fg35Fusarium graminearumUWM+KX878931.1 Fusarium graminearum
Fg36Fusarium graminearumUWMN/AN/A
Fg37Fusarium graminearumUWM+MF800906.1 Fusarium graminearum
Fg49Fusarium graminearumUWM+MF800906.1 Fusarium graminearum
Fg71Fusarium graminearumUWMN/AN/A
Fg74Fusarium graminearumUWM+KX421420.1 Fusarium graminearum
Fg106Fusarium graminearumUWMN/AN/A
Fg107Fusarium graminearumUWM+KU377276.1 Fusarium graminearum
Fg182Fusarium graminearumUWMN/AN/A
Fg184Fusarium graminearumUWMN/AN/A
Fg249Fusarium graminearumUWM+KX421420.1 Fusarium graminearum
Fg19Fusarium graminearumUWMN/AN/A
Fg39Fusarium graminearumUWMN/AN/A
Fc321Fusarium culmorumUWM+KP292806.1 Fusarium culmorum
Fc329Fusarium culmorumUWM+AY147341.1 Fusarium culmorum
Fc331Fusarium culmorumUWMN/AN/A
Fc333Fusarium culmorumUWMN/AN/A
Fc335Fusarium culmorumUWMN/AN/A
Fc10Fusarium culmorumUWMN/AN/A
Fc20Fusarium culmorumUWMN/AN/A
Fc21Fusarium culmorumUWMN/AN/A
Fc22Fusarium culmorumUWMN/AN/A
Fc31Fusarium culmorumUWM+KX349468.1 Fusarium culmorum
Fc32Fusarium culmorumUWM+KT318585.1 Fusarium culmorum
Fc56Fusarium culmorumUWMN/AN/A
Fc58Fusarium culmorumUWMN/AN/A
Fc59Fusarium culmorumUWMN/AN/A
Fc60Fusarium culmorumUWMN/AN/A
Fc61Fusarium culmorumUWM+MF372583.1 Fusarium culmorum
Fc62Fusarium culmorumUWM+KT992460.1 Fusarium culmorum
Fc64Fusarium culmorumUWMN/AN/A
Fp21Fusarium poaeUWM+KP271956.1 Fusarium poae
Fp22Fusarium poaeUWM+GU480965.1 Fusarium poae
Fp48Fusarium poaeUWM+AF414967.1 Fusarium poae
Fp206Fusarium poaeUWM+KF889085.1 Fusarium poae
Fl53Fusarium langsethiaeUWM+AB587023.1 Fusarium langsethiae
Fl87Fusarium langsethiaeUWM+NR.121214.1 Fusarium langsethiae
Fl130Fusarium langsethiaeUWM+AF414969.1 Fusarium langsethiae
FaFa9Fusarium avenaceumUWM+KT362194.1 Fusarium avenaceum
Feq3Fusarium equisetiUWM+MF166765.1 Fusarium equiseti
Feq25Fusarium equisetiUWM+KR094440.1 Fusarium equiseti
Feq36Fusarium equisetiUWM+KU680356.1 Fusarium equiseti
Feq37Fusarium equisetiUWM+KU680356.1 Fusarium equiseti
Fd13Fusarium equisetiUWM+KX270351.1 Fusarium dimerum
Fd15Fusarium equisetiUWM+KX270351.1 Fusarium dimerum
Designations: UWM—University of Warmia and Mazury in Olsztyn, N/A—not applicable.
Table 2. Primer sequences and PCR conditions for species identification based on ITS sequences and the determination of trichothecene genotypes.
Table 2. Primer sequences and PCR conditions for species identification based on ITS sequences and the determination of trichothecene genotypes.
Species/Target GenePrimerSequence (5′–3′)Product Size (bp)ReferencePCR Reaction Condition
F. avenaceumJIAF (F)GCTAATTCTTAACTTACTAGGGGCC220[24]94 °C 2 min; [94 °C 30 s, 58 °C 30 s, 72 °C 2 min] × 40; 72 °C 5 min
JIAR (R)CTGTAATAGGTTATTTACATGGGCG
F. culmorumFc01F (F)ATGGTGAACTCGTCGTGGC570[25]94 °C 5 min; [94 °C 20 s, 66 °C 1 min, 72 °C 45 s] × 5, [94 °C 20 s, 64 °C 1 min, 72 °C 45 s] × 5, [94 °C 20 s, 62 °C 1 min, 72 °C 45 s] × 25; 72 °C 5 min
Fc01R (R)CCCTTCTTACGCCAATCTCG
F. equisetiFeqF (F)GGCCTGCCCGATGCGTC990[26]94 °C 2 min.; [95 °C 35 s, 66 °C 30 s, 72 °C 30 s] × 35; 72 °C 5 min
FeqR (R)CGATACTGAAACCGACCTC
F. graminearumFg16NF (F)ACAGATGACAAGATTCAGGCACA280[25]94 °C 5 min; [94 °C 20 s, 66 °C 1 min, 72 °C 45 s] × 5, [94 °C 20 s, 64 °C 1 min, 72 °C 45 s] × 5, [94 °C 20 s, 62 °C 1 min, 72 °C 45 s] × 25; 72 °C 5 min
Fg16NR (R)TTCTTTGACATCTGTTCAACCCA
F. langsethiaeFlangF (F)CAAAGTTCAGGGCGAAAACT320[27]94 °C 2 min; [95 °C 35 s, 61 °C 30 s, 72 °C 30 s] × 35; 72 °C 5 min
LansporR (R)TACAAGAAGAGCGTGGCGATAT
F. poaeFpsF (F)CGCACGTATAGATGGACAAG400[26]94 °C 2 min.; [95 °C 35 s, 61 °C 30 s, 72 °C 30 s] × 35; 72 °C 5 min
FpoR (R)CAGCGCACCCCTCAGAGC
TRI5TRI5 (F)AGCGACTACAGGCTTCCCTC544[28]Touch-down PCR
98 °C 2 s; [95 °C 10 s, 56 °C 5 s, 72 °C 40 s] × 5, [95 °C 10 s, 54 °C 10 s, 72 °C 40 s] × 5, [95 °C 10 s, 52 °C 20 s, 72 °C 40 s] × 25; 72 °C 5 min
TRI5 (R)AAACCATCCAGTTCTCCATCTG
TRI12 (NIV)12NF(F)TCTCCTCGTTGTATCTGG840[29]Multiplex-PCR
98 °C 2 s; [95 °C 10 s, 56 °C 20 s, 72 °C 40 s] × 30, 72 °C 5 min
TRI12 (15-ADON)12-15F (F)TACAGCGGTCGCAACTTC670
TRI12 (3-ADON)12-3F (F)CTTTGGCAAGCCCGTGCA410
TRI1212CON (R) CATGAGCATGGTGATGTC
ITSITS5 (F)GTATCGGACGGAGATCCAGC550[30]94 °C 4 min; [94 °C 40 s, 57 °C 30 s, 72 °C 10 min] × 35, 72 °C 10 min
Table 3. The origin and percentage of glumes and kernels colonized by Fusarium spp.
Table 3. The origin and percentage of glumes and kernels colonized by Fusarium spp.
Species of WheatLines/CultivarGlumesNon-Disinfected KernelsDisinfected KernelsMeanGlumesNon-disinfected KernelsDisinfected Kernels
Colonization by Fusarium Fungi (%)Number of Lines/Cultivars Where Fusarium Colonies were not Isolated
T. monococcum ssp. monococcumTm222, Tm166, Tm 166, Tm219, Tm220, Tm16818.09 efg6.11 gh3.33 h9.65 C013
T. turgidum spp. dicoccumTd64, Td1, Td12, Td116, Td14,Td126, Td20, Td15, Td216, Td71, Td111, Td214, Td60, Td454, Td57, Td235, Td35, Td3, Td115, Td13, Td4840.95 bc27.77 de21.31 ef30.04 B001
T. turgidum spp. polonicumTp160, Tp131, Tp138, Tp157, Tp163, Tp161, Tp162, Tp149, Tp154, Tp121, Tp15970.00 a39.69 cd20.91 ef43.54 A000
T. turgidum ssp. durumcvs. Duromax, Duroflavus, Komnata13.33 c-h7.14 fgh2.08 h5.71 C012
T. aestivum spp. speltaTs173, Ts217, Ts212, Ts208, Ts205, Ts202, Ts211, cv. Wirtas54.58 b37.08 cd32.92 cde41.53 A000
T. aestivum ssp. aestivumcvs. Torka, Zebra, Ta 14030.00 b-e11.11 e-h0 h13.40 C013
Mean 45.03 X27.16 Y18.45 Z
Values in columns that did not differ significantly in Tukey’s test (p ≤ 0.05) are marked with identical letters.
Table 4. Mycotoxin-production ability of Fusarium isolates.
Table 4. Mycotoxin-production ability of Fusarium isolates.
GeneProductNumber (%) of Isolates Capable of Producing Trichothecenes
F. culmorumF. graminearumF. poae
Tri5Enzyme responsible for the synthesis of a specific substance that initiates the mycotoxin biosynthesis pathway18 (100)13 (100)0
Tri12Nivalenol10 (55.6)00
15-Acetyl Deoxynivalenol0 (0)7 (53.8)0
3-Acetyl Deoxynivalenol8 (44.4)6 (46.2)0
The percentage of F. culmorum and F. graminearum isolates with the products of Tri5 and Tri12 genes is indicated in parentheses. None of the analyzed F. poae isolates were capable of producing any of the researched molecules of the mycotoxin biosynthesis pathway.

Share and Cite

MDPI and ACS Style

Duba, A.; Goriewa-Duba, K.; Wachowska, U. Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat. Agronomy 2019, 9, 698. https://doi.org/10.3390/agronomy9110698

AMA Style

Duba A, Goriewa-Duba K, Wachowska U. Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat. Agronomy. 2019; 9(11):698. https://doi.org/10.3390/agronomy9110698

Chicago/Turabian Style

Duba, Adrian, Klaudia Goriewa-Duba, and Urszula Wachowska. 2019. "Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat" Agronomy 9, no. 11: 698. https://doi.org/10.3390/agronomy9110698

APA Style

Duba, A., Goriewa-Duba, K., & Wachowska, U. (2019). Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat. Agronomy, 9(11), 698. https://doi.org/10.3390/agronomy9110698

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop