Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Isolation and Morphological Identification of Fusarium Species
2.3. Isolation and Amplification of Fungal DNA
2.4. Determination of Trichothecene Genotypes
2.5. Sequence Homology
2.6. Statistical Analysis
3. Results
3.1. Colonization of Wheat Glumes and Grain by Fusarium spp.
3.2. Identification of Fusarium Species
3.3. Genotype Determination in Fusarium spp. Isolates
3.4. Sequence Homology
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Yli-Mattila, T.; Rämö, S.; Hietaniemi, V.; Hussien, T.; Carlobos-Lopez, A.L.; Cumagun, C.J.R. Molecular quantification and genetic diversity of toxigenic Fusarium species in Northern Europe as compared to those in Southern Europe. Microorganisms 2013, 1, 162–174. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.J.; Geiser, D.M.; Proctor, R.H.; Rooney, A.P.; O’Donnell, K.; Trail, F.; Gardiner, D.M.; Manners, J.M.; Kazan, K. Fusarium pathogenomics. Annu. Rev. Microbiol. 2013, 67, 399–416. [Google Scholar] [CrossRef] [PubMed]
- Drakulic, J.; Kahar, M.H.; Ajigboye, O.; Bruce, T.; Ray, R.V. Contrasting roles of deoxynivalenol and nivalenol in host-mediated interactions between Fusarium graminearum and Sitobion avenae. Toxins 2016, 8, 353. [Google Scholar] [CrossRef] [PubMed]
- Palacios, S.A.; Erazo, J.G.; Ciasca, B.; Lattanzio, V.M.; Reynoso, M.M.; Farnochi, M.C.; Torres, A.M. Occurrence of deoxynivalenol and deoxynivalenol-3-glucoside in durum wheat from Argentina. Food Chem. 2017, 230, 728–734. [Google Scholar] [CrossRef]
- McCormick, S.P.; Stanley, A.M.; Stover, N.A.; Alexander, N.J. Trichothecenes: From simple to complex mycotoxins. Toxins 2011, 3, 802–814. [Google Scholar] [CrossRef]
- Grove, J.F. The trichothecenes and their biosynthesis. Fortschr. Chem. Org. Naturst. 2007, 88, 63–130. [Google Scholar] [CrossRef]
- Proctor, R.H.; McCormick, S.P.; Alexander, N.J.; Desjardins, A.E. Evidence that a secondary metabolic biosynthetic gene cluster has grown by gene relocation during evolution of the filamentous fungus Fusarium. Mol. Microbiol. 2009, 74, 1128–1142. [Google Scholar] [CrossRef]
- Desjardins, A.E.; Proctor, R.H. Molecular biology of Fusarium mycotoxins. Int. J. Food Microbiol. 2007, 119, 47–50. [Google Scholar] [CrossRef]
- Foroud, N.A.; McCormick, S.P.; MacMillan, T.; Badea, A.; Kendra, D.F.; Ellis, B.E.; Eudes, F. Greenhouse studies reveal increased aggressiveness of emergent Canadian Fusarium graminearum genotypes in wheat. Plant Dis. 2012, 96, 1271–1279. [Google Scholar] [CrossRef]
- Xu, X.; Nicholson, P. Community ecology of fungal pathogens causing wheat head blight. Annu. Rev. Phytopathol. 2009, 47, 83–103. [Google Scholar] [CrossRef]
- Vaughan, M.; Backhouse, D.; Ponte, E.D. Climate change impacts on the ecology of Fusarium graminearum species complex and susceptibility of wheat to Fusarium head blight: A review. World Mycotoxin J. 2016, 9, 685–700. [Google Scholar] [CrossRef]
- Covarelli, L.; Beccari, G.; Prodi, A.; Generotti, S.; Etruschi, F.; Juan, C.; Ferrer, E.; Mañes, J. Fusarium species, genotype characterisation and trichothecene contamination of durum and soft wheat in an area of central Italy. J. Sci. Food Agric. 2015, 95, 540–551. [Google Scholar] [CrossRef] [PubMed]
- Beyer, M.; Pogoda, F.; Pallez, M.; Lazic, J.; Hoffmann, L.; Pasquali, M. Evidence for a reversible drought induced shift in the species composition of mycotoxin producing Fusarium head blight pathogens isolated from symptomatic wheat heads. Int. J. Food Microbiol. 2014, 182–183, 51–56. [Google Scholar] [CrossRef] [PubMed]
- Beyer, M.; Klix, M.B.; Verreet, J.A. Estimating mycotoxin contents of Fusarium-damaged winter wheat kernels. Int. J. Food Microbiol. 2007, 119, 153–158. [Google Scholar] [CrossRef] [PubMed]
- Del Ponte, E.M.; Garda-Buffon, J.; Badiale-Furlong, E. Deoxynivalenol and nivalenol in commercial wheat grain related to Fusarium head blight epidemics in southern Brazil. Food Chem. 2012, 132, 1087–1091. [Google Scholar] [CrossRef]
- Dong, F.; Qiu, J.; Xu, J.; Yu, M.; Wang, S.; Sun, Y.; Zhang, G.; Shi, J. Effect of environmental factors on Fusarium population and associated trichothecenes in wheat grain grown in Jiangsu province, China. Int. J. Food Microbiol. 2016, 230, 58–63. [Google Scholar] [CrossRef] [PubMed]
- Alkadri, D.; Nipoti, P.; Döll, K.; Karlovsky, P.; Prodi, A.; Pisi, A. Study of fungal colonization of wheat kernels in Syria with a focus on Fusarium species. Int. J. Mol. Sci. 2013, 14, 5938–5951. [Google Scholar] [CrossRef]
- Lenc, L. Fusarium head blight (FHB) and Fusarium populations in grain of winter wheat grown in different cultivation systems. J. Plant Prot. Res. 2015, 55, 94–109. [Google Scholar] [CrossRef]
- EPPO. European and Mediterranean Plant Protection Organization Global Database. 2018. Available online: https://gd.eppo.int (accessed on 6 August 2018).
- Wachowska, U.; Duba, A.; Ratuszny, J.; Goriewa, K.; Wiwart, M. The health status of Triticum aestivum and T. durum leaves protected with biological control agents, a plant biostimulator, a plant resistance inducer and chemical fungicides. Commun. Appl. Biol. Sci. Univ. 2016, 81, 85–90. [Google Scholar]
- Wachowska, U.; Waśkiewicz, A.; Jędryczka, M. Using a protective treatment to reduce Fusarium pathogens and mycotoxins contaminating winter wheat. Pol. J. Environ. Stud. 2017, 26, 2277–2286. [Google Scholar] [CrossRef]
- Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Blackwell Publishing: Ames, IA, USA, 2006. [Google Scholar]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Shinsky, J., White, T.J., Eds.; Academic Press Inc.: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- Miedaner, T.; Cumagun, C.J.R.; Chakraborty, S. Population genetics of three important head blight pathogens Fusarium graminearum, F. pseudograminearum and F. culmorum. J. Phytopathol. 2008, 156, 129–139. [Google Scholar] [CrossRef]
- Jennings, P.; Coates, M.E.; Turner, J.A.; Chandler, E.A.; Nicholson, P. Determination of deoxynivalenol and nivalenol genotypes of Fusarium culmorum isolates from England and Wales by PCR assay. Plant Pathol. 2004, 53, 182–190. [Google Scholar] [CrossRef]
- Starkey, D.E.; Ward, T.J.; Aoki, T.; Gale, L.R.; Kistler, H.C.; Geiser, D.M.; Suga, H.; Toth, B.; Varga, J.; O’Donnell, K. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genet. Biol. 2007, 44, 1191–1204. [Google Scholar] [CrossRef]
- Audenaert, K.; van Broeck, R.; Bekaert, B.; de Witte, F.; Heremans, B.; Höfte, M.; Haesaert, G. Fusarium head blight (FHB) in Flanders: Population diversity, inter-species associations and DON contamination in commercial winter wheat varieties. Eur. J. Plant Pathol. 2009, 125, 445–458. [Google Scholar] [CrossRef]
- Nicholson, P.; Simpson, D.R.; Wilson, A.H.; Chandler, E.; Thomsett, M. Detection and differentiation of trichothecene and enniatin-producing Fusarium species on small-grain cereals. In Molecular Diversity and PCR-Detection of Toxigenic Fusarium Species and Ochratoxigenic Fungi; Mulè, G., Bailey, J.A., Cooke, B.M., Logrieco, A., Eds.; Springer: Dordrecht, The Netherlands, 2004; pp. 503–514. [Google Scholar]
- Ward, T.J.; Clear, R.M.; Rooney, A.P.; O’Donnell, K.; Gaba, D.; Patrick, S.; Starkey, D.E.; Gilbert, J.; Geiser, D.M.; Nowicki, T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008, 45, 473–484. [Google Scholar] [CrossRef]
- Waalwijk, C.; Kastelein, P.; de Vries, I.; Kerényi, Z.; van der Lee, T.; Hesselink, T.; Köhl, J.; Kema, G. Major changes in Fusarium spp. in wheat in the Netherlands. Eur. J. Plant Pathol. 2003, 109, 743–754. [Google Scholar] [CrossRef]
- StatSoft, Inc. Electronic Statistics Textbook; StatSoft: Tulsa, OK, USA, 2013; Available online: http://www.statsoft.com/textbook/ (accessed on 25 June 2019).
- Gurcan, K.; Demirel, F.; Tekin, M.; Demirel, S.; Akar, T. Molecular and agro-morphological characterization of ancient wheat landraces of turkey. BMC Plant Biol. 2017, 17, 171. [Google Scholar] [CrossRef]
- Góral, T.; Ochodzki, P.; Bulinska-Radomska, Z. Resistance of species from genus Triticum to Fusarium head blight and accumulation of Fusarium-metabolites in grain. Cereal Res. Commun. 2008, 36, 95–97. [Google Scholar]
- Wiśniewska, H.; Kowalczyk, K. Resistance of cultivars and breeding lines of spring wheat to Fusarium culmorum and powdery mildew. J. Appl. Genet. 2005, 46, 35–40. [Google Scholar]
- Pan, D.; Hong, L.; Wei, L.; Peng-Fei, Q.; Yu-Ming, W.; Zheng, Y.L. Genetic diversity of storage proteins in Triticum polonicum L. J. Plant Sci. 2007, 2, 416–424. [Google Scholar]
- Laidò, G.; Mangini, G.; Taranto, F.; Gadaleta, A.; Blanco, A.; Cattivelli, L.; Marone, D.; Mastrangelo, A.M.; Papa, R.; de Vita, P. Genetic diversity and population structure of tetraploid wheats (Triticum turgidum L.) estimated by SSR, DArT and pedigree data. PLoS ONE 2013, 8, e67280. [Google Scholar] [CrossRef] [PubMed]
- Müller, T.; Schierscher-Viret, B.; Fossati, D.; Brabant, C.; Schori, A.; Keller, B.; Krattinger, S.G. Unlocking the diversity of genebanks: Whole-genome marker analysis of Swiss bread wheat and spelt. Theor. Appl. Genet. 2018, 131, 407–416. [Google Scholar] [CrossRef] [PubMed]
- Lombardo, C.; Bolla, M.; Chignola, R.; Senna, G.; Rossin, G.; Caruso, B.; Tomelleri, C.; Cecconi, D.; Brandolini, A.; Zoccatelli, G. Study on the immunoreactivity of Triticum monococcum (Einkorn) wheat in patients with wheat-dependent exercise-induced anaphylaxis for the production of hypoallergenic foods. J. Agric. Food Chem. 2015, 63, 8299–8306. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Faris, J.D.; Hu, J.; Stack, R.W.; Adhikari, T.; Elias, E.M.; Kianian, S.F.; Cai, X. Saturation and comparative mapping of a major Fusarium head blight resistance QTL in tetraploid wheat. Mol. Breed. 2007, 19, 113–124. [Google Scholar] [CrossRef]
- Buerstmayr, H.; Ban, T.; Anderson, J.A. QTL mapping and marker-assisted selection for Fusarium head blight resistance in wheat: A review. Plant Breed. 2009, 128, 1–26. [Google Scholar] [CrossRef]
- Steiner, B.; Michel, S.; Maccaferri, M.; Lemmens, M.; Tuberosa, R.; Buerstmayr, H. Exploring and exploiting the genetic variation of Fusarium head blight resistance for genomic-assisted breeding in the elite durum wheat gene pool. Theor. Appl. Genet. 2019, 132, 969–988. [Google Scholar] [CrossRef] [PubMed]
- Quarta, A.; Mita, G.; Haidukowski, M.; Logrieco, A.; Mule, G.; Visconti, A. Multiplex PCR assay for the identification of nivalenol, 3-and 15-acetyl-deoxynivalenol genotypes in Fusarium. FEMS Microbiol. Lett. 2006, 259, 7–13. [Google Scholar] [CrossRef]
- Sanoubar, R.; Bauer, A.; Seigner, L. Detection, identification and quantification of Fusarium graminearum and Fusarium culmorum in wheat kernels by PCR techniques. J. Plant Pathol. Microbiol. 2015, 6, 1–8. [Google Scholar]
- Perry, J.N. Spatial analysis by distance indices. J. Anim. Ecol. 1995, 64, 303–314. [Google Scholar] [CrossRef]
- Wachowska, U.; Stasiulewicz-Paluch, A.D.; Glowacka, K.; Mikolajczyk, W.; Kucharska, K. Response of epiphytes and endophytes isolated from winter wheat grain to biotechnological and fungicidal treatments. Pol. J. Environ. Stud. 2013, 22, 267–273. [Google Scholar]
- Stępień, Ł.; Popiel, D.; Koczyk, G.; Chełkowski, J. Wheat-infecting Fusarium species in Poland—Their genotypes and frequencies revealed by PCR assay. J. Appl. Genet. 2008, 49, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Pinson-Gadais, L.; Barreau, C.; Chaurand, M.; Gregoire, S.; Monmarson, M.; Richard-Forget, F. Distribution of toxigenic Fusarium spp. and mycotoxin production in milling fractions of durum wheat. Food Addit. Contam. 2007, 24, 53–62. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yörük, E.; Albayrak, G. Chemotyping of Fusarium graminearum and F. culmorum isolates from Turkey by PCR assay. Mycopathologia 2012, 173, 53–61. [Google Scholar] [CrossRef] [PubMed]
- Pasquali, M.; Giraud, F.; Brochot, C.; Cocco, E.; Hoffmann, L.; Bohn, T. Genetic Fusarium chemotyping as a useful tool for predicting nivalenol contamination in winter wheat. Int. J. Food Microbiol. 2010, 137, 246–253. [Google Scholar] [CrossRef]
- Pasquali, M.; Beyer, M.M.; Logrieco, A.; Audenaert, K.; Balmas, V.; Basler, R.; Boutigny, A.L.; Chrpová, J.; Czembor, E.; Gagkaeva, T.; et al. A European database of Fusarium graminearum and F. culmorum trichothecene genotypes. Front. Microbiol. 2016, 7, 406. [Google Scholar] [CrossRef]
- Nielsen, L.K.; Jensen, J.D.; Rodríguez, A.; Jørgensen, L.N.; Justesen, A.F. TRI12 based quantitative real-time PCR assays reveal the distribution of trichothecene genotypes of F. graminearum and F. culmorum isolates in Danish small grain cereals. Int. J. Food Microbiol. 2012, 157, 384–392. [Google Scholar] [CrossRef]
- Stenglein, S.A.; Dinolfo, M.I.; Barros, G.; Bongiorno, F.; Chulze, S.N.; Moreno, M.V. Fusarium poae pathogenicity and mycotoxin accumulation on selected wheat and barley genotypes at a single location in Argentina. Plant Dis. 2014, 98, 1733–1738. [Google Scholar] [CrossRef]
- Alkadri, D.; Rubert, J.; Prodi, A.; Pisi, A.; Mañes, J.; Soler, C. Natural co-occurrence of mycotoxins in wheat grains from Italy and Syria. Food Chem. 2014, 157, 111–118. [Google Scholar] [CrossRef]
- Minervini, F.; Fornelli, F.; Flynn, K.M. Toxicity and apoptosis induced by the mycotoxins nivalenol, deoxynivalenol and fumonisin B1 in a human erythroleukemia cell line. Toxicol. Vitr. 2004, 18, 21–28. [Google Scholar] [CrossRef]
- Thrane, U.; Adler, A.; Clasen, P.E.; Galvano, F.; Langseth, W.; Lew, H.; Logrieco, A.; Nielsen, K.F.; Ritieni, A. Diversity in metabolite production by Fusarium langsethiae, Fusarium poae, and Fusarium sporotrichioides. Int. J. Food Microbiol. 2004, 95, 257–266. [Google Scholar] [CrossRef]
| Code of Fusarium Isolates | Species | Collection | Sequence Alignment Analysis | Reference Isolate (NCBI) |
|---|---|---|---|---|
| Fg35 | Fusarium graminearum | UWM | + | KX878931.1 Fusarium graminearum |
| Fg36 | Fusarium graminearum | UWM | N/A | N/A |
| Fg37 | Fusarium graminearum | UWM | + | MF800906.1 Fusarium graminearum |
| Fg49 | Fusarium graminearum | UWM | + | MF800906.1 Fusarium graminearum |
| Fg71 | Fusarium graminearum | UWM | N/A | N/A |
| Fg74 | Fusarium graminearum | UWM | + | KX421420.1 Fusarium graminearum |
| Fg106 | Fusarium graminearum | UWM | N/A | N/A |
| Fg107 | Fusarium graminearum | UWM | + | KU377276.1 Fusarium graminearum |
| Fg182 | Fusarium graminearum | UWM | N/A | N/A |
| Fg184 | Fusarium graminearum | UWM | N/A | N/A |
| Fg249 | Fusarium graminearum | UWM | + | KX421420.1 Fusarium graminearum |
| Fg19 | Fusarium graminearum | UWM | N/A | N/A |
| Fg39 | Fusarium graminearum | UWM | N/A | N/A |
| Fc321 | Fusarium culmorum | UWM | + | KP292806.1 Fusarium culmorum |
| Fc329 | Fusarium culmorum | UWM | + | AY147341.1 Fusarium culmorum |
| Fc331 | Fusarium culmorum | UWM | N/A | N/A |
| Fc333 | Fusarium culmorum | UWM | N/A | N/A |
| Fc335 | Fusarium culmorum | UWM | N/A | N/A |
| Fc10 | Fusarium culmorum | UWM | N/A | N/A |
| Fc20 | Fusarium culmorum | UWM | N/A | N/A |
| Fc21 | Fusarium culmorum | UWM | N/A | N/A |
| Fc22 | Fusarium culmorum | UWM | N/A | N/A |
| Fc31 | Fusarium culmorum | UWM | + | KX349468.1 Fusarium culmorum |
| Fc32 | Fusarium culmorum | UWM | + | KT318585.1 Fusarium culmorum |
| Fc56 | Fusarium culmorum | UWM | N/A | N/A |
| Fc58 | Fusarium culmorum | UWM | N/A | N/A |
| Fc59 | Fusarium culmorum | UWM | N/A | N/A |
| Fc60 | Fusarium culmorum | UWM | N/A | N/A |
| Fc61 | Fusarium culmorum | UWM | + | MF372583.1 Fusarium culmorum |
| Fc62 | Fusarium culmorum | UWM | + | KT992460.1 Fusarium culmorum |
| Fc64 | Fusarium culmorum | UWM | N/A | N/A |
| Fp21 | Fusarium poae | UWM | + | KP271956.1 Fusarium poae |
| Fp22 | Fusarium poae | UWM | + | GU480965.1 Fusarium poae |
| Fp48 | Fusarium poae | UWM | + | AF414967.1 Fusarium poae |
| Fp206 | Fusarium poae | UWM | + | KF889085.1 Fusarium poae |
| Fl53 | Fusarium langsethiae | UWM | + | AB587023.1 Fusarium langsethiae |
| Fl87 | Fusarium langsethiae | UWM | + | NR.121214.1 Fusarium langsethiae |
| Fl130 | Fusarium langsethiae | UWM | + | AF414969.1 Fusarium langsethiae |
| FaFa9 | Fusarium avenaceum | UWM | + | KT362194.1 Fusarium avenaceum |
| Feq3 | Fusarium equiseti | UWM | + | MF166765.1 Fusarium equiseti |
| Feq25 | Fusarium equiseti | UWM | + | KR094440.1 Fusarium equiseti |
| Feq36 | Fusarium equiseti | UWM | + | KU680356.1 Fusarium equiseti |
| Feq37 | Fusarium equiseti | UWM | + | KU680356.1 Fusarium equiseti |
| Fd13 | Fusarium equiseti | UWM | + | KX270351.1 Fusarium dimerum |
| Fd15 | Fusarium equiseti | UWM | + | KX270351.1 Fusarium dimerum |
| Species/Target Gene | Primer | Sequence (5′–3′) | Product Size (bp) | Reference | PCR Reaction Condition |
|---|---|---|---|---|---|
| F. avenaceum | JIAF (F) | GCTAATTCTTAACTTACTAGGGGCC | 220 | [24] | 94 °C 2 min; [94 °C 30 s, 58 °C 30 s, 72 °C 2 min] × 40; 72 °C 5 min |
| JIAR (R) | CTGTAATAGGTTATTTACATGGGCG | ||||
| F. culmorum | Fc01F (F) | ATGGTGAACTCGTCGTGGC | 570 | [25] | 94 °C 5 min; [94 °C 20 s, 66 °C 1 min, 72 °C 45 s] × 5, [94 °C 20 s, 64 °C 1 min, 72 °C 45 s] × 5, [94 °C 20 s, 62 °C 1 min, 72 °C 45 s] × 25; 72 °C 5 min |
| Fc01R (R) | CCCTTCTTACGCCAATCTCG | ||||
| F. equiseti | FeqF (F) | GGCCTGCCCGATGCGTC | 990 | [26] | 94 °C 2 min.; [95 °C 35 s, 66 °C 30 s, 72 °C 30 s] × 35; 72 °C 5 min |
| FeqR (R) | CGATACTGAAACCGACCTC | ||||
| F. graminearum | Fg16NF (F) | ACAGATGACAAGATTCAGGCACA | 280 | [25] | 94 °C 5 min; [94 °C 20 s, 66 °C 1 min, 72 °C 45 s] × 5, [94 °C 20 s, 64 °C 1 min, 72 °C 45 s] × 5, [94 °C 20 s, 62 °C 1 min, 72 °C 45 s] × 25; 72 °C 5 min |
| Fg16NR (R) | TTCTTTGACATCTGTTCAACCCA | ||||
| F. langsethiae | FlangF (F) | CAAAGTTCAGGGCGAAAACT | 320 | [27] | 94 °C 2 min; [95 °C 35 s, 61 °C 30 s, 72 °C 30 s] × 35; 72 °C 5 min |
| LansporR (R) | TACAAGAAGAGCGTGGCGATAT | ||||
| F. poae | FpsF (F) | CGCACGTATAGATGGACAAG | 400 | [26] | 94 °C 2 min.; [95 °C 35 s, 61 °C 30 s, 72 °C 30 s] × 35; 72 °C 5 min |
| FpoR (R) | CAGCGCACCCCTCAGAGC | ||||
| TRI5 | TRI5 (F) | AGCGACTACAGGCTTCCCTC | 544 | [28] | Touch-down PCR 98 °C 2 s; [95 °C 10 s, 56 °C 5 s, 72 °C 40 s] × 5, [95 °C 10 s, 54 °C 10 s, 72 °C 40 s] × 5, [95 °C 10 s, 52 °C 20 s, 72 °C 40 s] × 25; 72 °C 5 min |
| TRI5 (R) | AAACCATCCAGTTCTCCATCTG | ||||
| TRI12 (NIV) | 12NF(F) | TCTCCTCGTTGTATCTGG | 840 | [29] | Multiplex-PCR 98 °C 2 s; [95 °C 10 s, 56 °C 20 s, 72 °C 40 s] × 30, 72 °C 5 min |
| TRI12 (15-ADON) | 12-15F (F) | TACAGCGGTCGCAACTTC | 670 | ||
| TRI12 (3-ADON) | 12-3F (F) | CTTTGGCAAGCCCGTGCA | 410 | ||
| TRI12 | 12CON (R) | CATGAGCATGGTGATGTC | |||
| ITS | ITS5 (F) | GTATCGGACGGAGATCCAGC | 550 | [30] | 94 °C 4 min; [94 °C 40 s, 57 °C 30 s, 72 °C 10 min] × 35, 72 °C 10 min |
| Species of Wheat | Lines/Cultivar | Glumes | Non-Disinfected Kernels | Disinfected Kernels | Mean | Glumes | Non-disinfected Kernels | Disinfected Kernels |
|---|---|---|---|---|---|---|---|---|
| Colonization by Fusarium Fungi (%) | Number of Lines/Cultivars Where Fusarium Colonies were not Isolated | |||||||
| T. monococcum ssp. monococcum | Tm222, Tm166, Tm 166, Tm219, Tm220, Tm168 | 18.09 efg | 6.11 gh | 3.33 h | 9.65 C | 0 | 1 | 3 |
| T. turgidum spp. dicoccum | Td64, Td1, Td12, Td116, Td14,Td126, Td20, Td15, Td216, Td71, Td111, Td214, Td60, Td454, Td57, Td235, Td35, Td3, Td115, Td13, Td48 | 40.95 bc | 27.77 de | 21.31 ef | 30.04 B | 0 | 0 | 1 |
| T. turgidum spp. polonicum | Tp160, Tp131, Tp138, Tp157, Tp163, Tp161, Tp162, Tp149, Tp154, Tp121, Tp159 | 70.00 a | 39.69 cd | 20.91 ef | 43.54 A | 0 | 0 | 0 |
| T. turgidum ssp. durum | cvs. Duromax, Duroflavus, Komnata | 13.33 c-h | 7.14 fgh | 2.08 h | 5.71 C | 0 | 1 | 2 |
| T. aestivum spp. spelta | Ts173, Ts217, Ts212, Ts208, Ts205, Ts202, Ts211, cv. Wirtas | 54.58 b | 37.08 cd | 32.92 cde | 41.53 A | 0 | 0 | 0 |
| T. aestivum ssp. aestivum | cvs. Torka, Zebra, Ta 140 | 30.00 b-e | 11.11 e-h | 0 h | 13.40 C | 0 | 1 | 3 |
| Mean | 45.03 X | 27.16 Y | 18.45 Z | |||||
| Gene | Product | Number (%) of Isolates Capable of Producing Trichothecenes | ||
|---|---|---|---|---|
| F. culmorum | F. graminearum | F. poae | ||
| Tri5 | Enzyme responsible for the synthesis of a specific substance that initiates the mycotoxin biosynthesis pathway | 18 (100) | 13 (100) | 0 |
| Tri12 | Nivalenol | 10 (55.6) | 0 | 0 |
| 15-Acetyl Deoxynivalenol | 0 (0) | 7 (53.8) | 0 | |
| 3-Acetyl Deoxynivalenol | 8 (44.4) | 6 (46.2) | 0 | |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duba, A.; Goriewa-Duba, K.; Wachowska, U. Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat. Agronomy 2019, 9, 698. https://doi.org/10.3390/agronomy9110698
Duba A, Goriewa-Duba K, Wachowska U. Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat. Agronomy. 2019; 9(11):698. https://doi.org/10.3390/agronomy9110698
Chicago/Turabian StyleDuba, Adrian, Klaudia Goriewa-Duba, and Urszula Wachowska. 2019. "Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat" Agronomy 9, no. 11: 698. https://doi.org/10.3390/agronomy9110698
APA StyleDuba, A., Goriewa-Duba, K., & Wachowska, U. (2019). Trichothecene Genotypes Analysis of Fusarium Isolates from di-, tetra- and Hexaploid Wheat. Agronomy, 9(11), 698. https://doi.org/10.3390/agronomy9110698
