Long-Term Fertilizer Postponing Reshapes Spatial and Temporal Patterns of Bacterial Communities and N-Cycling Potential in Paddy Soils
Abstract
1. Introduction
2. Materials and Methods
2.1. Soil Preparation
2.2. Experimental Design
2.3. Sampling and Measurements
2.4. Soil N Pool and Its Components
2.5. Soil N-Cycle-Related Enzymes
2.6. Soil DNA Extraction
2.7. Quantitative PCR (qPCR) Analysis of Key Genes in Soil N Cycling
2.8. 16S rRNA Amplicon Sequencing
2.9. Statistical Analysis
3. Results
3.1. Long-Term FP Improved Rice Productivity and Regulated Soil N Availability
3.2. Long-Term FP Reshaped N-Cycling Potential Across Soil Compartments
3.3. Long-Term FP Reshaped Bacterial Community Structure
3.4. Identification of Microbial Modules Associated with Soil C and N Status
3.5. Core Microbial Taxa Associated with N-Cycling Potential
3.6. Environmental Drivers of Bacterial Community Assembly and N-Cycling Potential
4. Discussion
4.1. Long-Term FP Improved Soil N Availability and Plant N Accumulation
4.2. Long-Term FP Induced Compartment-Dependent Shifts in N-Cycling Potential
4.3. Changes in Soil C and N Status Were Associated with Bacterial Community Assembly Under FP
4.4. Limitations and Future Perspectives
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CF | Conventional fertilizer |
| FP | Fertilizer postponing |
| N | Nitrogen |
| PI | Panicle initiation |
| HS | Heading stage |
| MS | Maturity stage |
| TC | Total carbon |
| TN | Total nitrogen |
| DOC | Dissolved organic corban |
| DN | Dissolved organic nitrogen |
| MBN | Microbial biomass nitrogen |
References
- Mueller, N.D.; Gerber, J.S.; Johnston, M.; Ray, D.K.; Ramankutty, N.; Foley, J.A. Closing yield gaps through nutrient and water management. Nature 2012, 490, 254–257. [Google Scholar] [CrossRef] [PubMed]
- Yan, M.; Pan, G.; Lavallee, J.M.; Conant, R.T. Rethinking sources of nitrogen to cereal crops. Glob. Change Biol. 2020, 26, 191–199. [Google Scholar]
- Zhou, W.; Yang, Z.; Wang, T.; Fu, Y.; Chen, Y.; Hu, B.; Yamagishi, J.; Ren, W. Environmental compensation effect and synergistic mechanism of optimized nitrogen management increasing nitrogen use efficiency in indica hybrid rice. Front. Plant Sci. 2019, 10, 245. [Google Scholar] [CrossRef] [PubMed]
- Elrys, A.S.; Ali, A.; Zhang, H.; Cheng, Y.; Zhang, J.; Cai, Z.-C.; Müller, C.; Chang, S.X. Patterns and drivers of global gross nitrogen mineralization in soils. Glob. Change Biol. 2021, 27, 5950–5962. [Google Scholar] [CrossRef]
- Nelson, M.B.; Martiny, A.C.; Martiny, J.B.H. Global biogeography of microbial nitrogen-cycling traits in soil. Proc. Natl. Acad. Sci. USA 2016, 113, 8033–8040. [Google Scholar] [CrossRef] [PubMed]
- Kuypers, M.M.M.; Marchant, H.K.; Kartal, B. The microbial nitrogen-cycling network. Nat. Rev. Microbiol. 2018, 16, 263–276. [Google Scholar] [CrossRef] [PubMed]
- Johnson, D.W.; Cheng, W.; Burke, I.C. Biotic and abiotic nitrogen retention in a variety of forest soils. Soil Sci. Soc. Am. J. 2000, 64, 1503–1514. [Google Scholar] [CrossRef]
- Barrett, J.E.; Johnson, D.W.; Burke, I.C. Abiotic nitrogen uptake in semiarid grassland soils of the US Great Plains. Soil Sci. Soc. Am. J. 2002, 66, 979–987. [Google Scholar] [CrossRef]
- Li, Z.; Zeng, Z.; Song, Z.; Wang, F.; Tian, D.; Mi, W.; Huang, X.; Wang, J.; Song, L.; Yang, Z.; et al. Vital roles of soil microbes in driving terrestrial nitrogen immobilization. Glob. Change Biol. 2021, 27, 1848–1858. [Google Scholar] [CrossRef]
- Cui, Y.; Fang, L.; Guo, X.; Wang, X.; Zhang, Y.; Li, P.; Zhang, X. Ecoenzymatic stoichiometry and microbial nutrient limitation in rhizosphere soil in the arid area of the northern Loess Plateau, China. Soil Biol. Biochem. 2018, 116, 11–21. [Google Scholar] [CrossRef]
- Turner, T.R.; Ramakrishnan, K.; Walshaw, J.; Heavens, D.; Alston, M.; Swarbreck, D.; Osbourn, A.; Grant, A.; Poole, P.S. Comparative metatranscriptomics reveals kingdom level changes in the rhizosphere microbiome of plants. ISME J. 2013, 7, 2248–2258. [Google Scholar] [CrossRef] [PubMed]
- Edwards, J.; Johnson, C.; Santos-Medellin, C.; Lurie, E.; Podishetty, N.K.; Bhatnagar, S.; Eisen, J.A.; Sundaresan, V. Structure, variation, and assembly of the root-associated microbiomes of rice. Proc. Natl. Acad. Sci. USA 2015, 112, E911–E920. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, J.E.; Vannette, R.L.; Igwe, A.; Blundell, R.; Casteel, C.L.; Gaudin, A.C.M. Effects of agricultural management on rhizosphere microbial structure and function in processing tomato plants. Appl. Environ. Microbiol. 2019, 85, e01087-19. [Google Scholar] [CrossRef]
- Yan, Y.; Kuramae, E.E.; de Hollander, M.; Klinkhamer, P.G.L.; van Veen, J.A. Functional traits dominate the diversity-related selection of bacterial communities in the rhizosphere. ISME J. 2017, 11, 56–66. [Google Scholar] [PubMed]
- Zhang, J.; Zhang, N.; Liu, Y.-X.; Zhang, X.; Hu, B.; Qin, Y.; Xu, H.; Wang, H.; Guo, X.; Qian, J.; et al. Root microbiota shift in rice correlates with resident time in the field and developmental stage. Sci. China Life Sci. 2018, 61, 613–621. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Rui, J.; Xiong, J.; Li, J.; He, Z.; Zhou, J.; Yannarell, A.C.; Mackie, R.I. Functional potential of soil microbial communities in the maize rhizosphere. PLoS ONE 2014, 9, e112609. [Google Scholar] [CrossRef] [PubMed]
- Nie, S.A.; Xu, H.J.; Li, S.; Li, H.; Su, J.Q. Relationships between abundance of microbial functional genes and the status and fluxes of carbon and nitrogen in rice rhizosphere and bulk soils. Pedosphere 2014, 24, 645–651. [Google Scholar] [CrossRef]
- Ehrenfeld, J.G.; Parsons, W.F.J.; Han, X.G.; Parmelee, R.W.; Zhu, W.X. Live and dead roots in forest soil horizons: Contrasting effects on nitrogen dynamics. Ecology 1997, 78, 348–362. [Google Scholar] [CrossRef]
- Knauth, S.; Hurek, T.; Brar, D.; Reinhold-Hurek, B. Influence of different Oryza cultivars on expression of nifH gene pools in roots of rice. Environ. Microbiol. 2005, 7, 1725–1733. [Google Scholar] [CrossRef] [PubMed]
- Treseder, K.K. Nitrogen additions and microbial biomass: A meta-analysis of ecosystem studies. Ecol. Lett. 2008, 11, 1111–1120. [Google Scholar] [PubMed]
- Wang, C.; Liu, D.; Bai, E. Decreasing soil microbial diversity is associated with decreasing microbial biomass under nitrogen addition. Soil Biol. Biochem. 2018, 120, 126–133. [Google Scholar] [CrossRef]
- Zhao, Z.; Ge, T.; Gunina, A.; Li, Y.; Zhu, Z.; Peng, P.; Wu, J.; Kuzyakov, Y. Carbon and nitrogen availability in paddy soil affects rice photosynthate allocation, microbial community composition, and priming: Combining continuous C-13 labeling with PLFA analysis. Plant Soil 2019, 445, 137–152. [Google Scholar]
- Wang, J.; Liao, L.R.; Ye, Z.C.; Liu, H.F.; Zhang, C.; Zhang, L.; Liu, G.B.; Wang, G.L. Different bacterial co-occurrence patterns and community assembly between rhizosphere and bulk soils under N addition in the plant-soil system. Plant Soil 2022, 471, 697–713. [Google Scholar]
- Dong, H.; Fan, S.; Sun, H.; Chen, C.; Wang, A.; Jiang, L.; Ma, D. Rhizosphere-associated microbiomes of rice (Oryza sativa L.) under the effect of increased nitrogen fertilization. Front. Microbiol. 2021, 12, 730506. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; Chen, X.; Zheng, S.; Gunina, A.; Ning, Z.; Hu, Y.; Tang, H.; Rui, Y.; Zhang, Z.; He, H.; et al. Manure application accumulates more nitrogen in paddy soils than rice straw but less from fungal necromass. Agric. Ecosyst. Environ. 2021, 319, 107552. [Google Scholar] [CrossRef]
- Vieira, S.; Sikorski, J.; Dietz, S.; Herz, K.; Schrumpf, M.; Bruelheide, H.; Scheel, D.; Friedrich, M.W.; Overmann, J. Drivers of the composition of active rhizosphere bacterial communities in temperate grasslands. ISME J. 2020, 14, 463–475. [Google Scholar] [PubMed]
- Beirinckx, S.; Viaene, T.; Haegeman, A.; Debode, J.; Amery, F.; Vandenabeele, S.; Nelissen, H.; Inzé, D.; Tito, R.; Raes, J.; et al. Tapping into the maize root microbiome to identify bacteria that promote growth under chilling conditions. Microbiome 2020, 8, 54. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Fu, P.; Wang, F.; Fahad, S.; Mohapatra, P.K.; Chen, Y.; Zhang, C.; Peng, S.; Cui, K.; Nie, L.; et al. Optimizing nitrogen management to balance rice yield and environmental risk in the Yangtze River’s middle reaches. Environ. Sci. Pollut. Res. 2019, 26, 4901–4912. [Google Scholar]
- Yi, J.; Gao, J.; Zhang, W.; Zhao, Y.; Zhao, C.; Zhao, Y.; Li, Z.; Xin, W. Delayed timing of tillering fertilizer improved grain yield and nitrogen use efficiency in japonica rice. Crop Sci. 2020, 60, 1021–1033. [Google Scholar] [CrossRef]
- Banayo, N.P.M.C.; Bueno, C.S.; Haefele, S.M.; Desamero, N.V.; Kato, Y. Site-specific nutrient management enhances sink size, a major yield constraint in rainfed lowland rice. Field Crops Res. 2018, 224, 76–79. [Google Scholar] [CrossRef]
- Zhou, Y.; Xu, L.; Zhang, J.; Li, W.; Jiang, Y.; Wang, S.; Ding, Y.; Liu, Z.; Li, G. Low N apparent surplus with higher rice yield under long-term fertilizer postponing in the rice-wheat cropping system. Crop J. 2022, 10, 1178–1186. [Google Scholar]
- Zhou, Y.; Zhang, J.; Xu, L.; Xu, C.; Chen, H.; Miao, C.; Li, W.; Jiang, Y.; Ding, Y.; Liu, Z.; et al. Long-term fertilizer postponing increases soil carbon sequestration by changing microbial composition in paddy soils: A 13CO2 labelling and PLFA study. Soil Biol. Biochem. 2023, 180, 108967. [Google Scholar] [CrossRef]
- Vance, E.D.; Brookes, P.C.; Jenkinson, D.S. An extraction method for measuring soil microbial biomass-C. Soil Biol. Biochem. 1987, 19, 703–707. [Google Scholar] [CrossRef]
- DeForest, J.L. The influence of time, storage temperature, and substrate age on potential soil enzyme activity in acidic forest soils using MUB-linked substrates and L-DOPA. Soil Biol. Biochem. 2009, 41, 1180–1186. [Google Scholar] [CrossRef]
- Luo, G.; Wang, T.; Li, K.; Li, L.; Zhang, J.; Guo, S.; Ling, N.; Shen, Q. Historical nitrogen deposition and straw addition facilitate the resistance of soil multifunctionality to drying-wetting cycles. Appl. Environ. Microbiol. 2019, 85, e02251-18. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Xu, C.; Ye, C.; Chen, S.; Chu, G.; Zhang, X. Low recovery efficiency of basal fertilizer-N in plants does not indicate high basal fertilizer-N loss from split-applied N in transplanted rice. Field Crops Res. 2018, 229, 8–16. [Google Scholar] [CrossRef]
- Ye, C.; Ma, H.; Huang, X.; Xu, C.; Chen, S.; Chu, G.; Zhang, X.; Wang, D. Effects of increasing panicle-stage N on yield and N use efficiency of indica rice and its relationship with soil fertility. Crop J. 2022, 10, 1784–1797. [Google Scholar] [CrossRef]
- Koranda, M.; Schnecker, J.; Kaiser, C.; Fuchslueger, L.; Kitzler, B.; Stange, C.F.; Sessitsch, A.; Zechmeister-Boltenstern, S.; Richter, A. Microbial processes and community composition in the rhizosphere of European beech—The influence of plant C exudates. Soil Biol. Biochem. 2011, 43, 551–558. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, Y.; Evans, S.E.; Friesen, M.L.; Tiemann, L.K. Effect of nitrogen fertilization on the abundance of nitrogen cycling genes in agricultural soils: A meta-analysis of field studies. Soil Biol. Biochem. 2018, 127, 71–78. [Google Scholar] [CrossRef]
- Zhong, Y.; Hu, J.; Xia, Q.; Zhang, S.; Li, X.; Pan, X.; Zhao, R.; Wang, R.; Yan, W.; Shangguan, Z.; et al. Soil microbial mechanisms promoting ultrahigh rice yield. Soil Biol. Biochem. 2020, 143, 107741. [Google Scholar] [CrossRef]
- Dondjou, D.T.; Diedhiou, A.G.; Mbodj, D.; Mofini, M.T.; Pignoly, S.; Ndiaye, C.; Diedhiou, I.; Assigbetse, K.; Manneh, B.; Laplaze, L.; et al. Rice developmental stages modulate rhizosphere bacteria and archaea co-occurrence and sensitivity to long-term inorganic fertilization in a West African Sahelian agro-ecosystem. Environ. Microbiome 2023, 18, 42. [Google Scholar] [CrossRef] [PubMed]
- Shu, X.; Liu, W.; Huang, H.; Ye, Q.; Zhu, S.; Peng, Z.; Li, Y.; Deng, L.; Yang, Z.; Chen, H.; et al. Meta-Analysis of Organic Fertilization Effects on Soil Bacterial Diversity and Community Composition in Agroecosystems. Plants 2023, 12, 3801. [Google Scholar] [CrossRef] [PubMed]
- Philippot, L.; Raaijmakers, J.M.; Lemanceau, P.; van der Putten, W.H. Going back to the roots: The microbial ecology of the rhizosphere. Nat. Rev. Microbiol. 2013, 11, 789–799. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Luan, L.; Chen, Y.; Wang, X.; Zhou, S.; Zou, W.; Han, X.; Duan, Y.; Zhu, B.; Li, Y.; et al. Community assembly of organisms regulates soil microbial functional potential through dual mechanisms. Glob. Change Biol. 2024, 30, e17160. [Google Scholar] [CrossRef]
- Luo, G.W.; Ling, N.; Xue, C.; Dippold, M.A.; Firbank, L.G.; Guo, S.W.; Kuzyakov, Y.; Shen, Q.R. Nitrogen-inputs regulate microbial functional and genetic resistance and resilience to drying-rewetting cycles, with implications for crop yields. Plant Soil 2019, 441, 301–315. [Google Scholar]
- Itakura, M.; Saeki, K.; Omori, H.; Yokoyama, T.; Kaneko, T.; Tabata, S.; Ohwada, T.; Tajima, S.; Uchiumi, T.; Honnma, K.; et al. Genomic comparison of Bradyrhizobium japonicum strains with different symbiotic nitrogen-fixing capabilities and other Bradyrhizobiaceae members. Isme J. 2009, 3, 326–339. [Google Scholar] [PubMed]
- Anderson, C.R.; Condron, L.M.; Clough, T.J.; Fiers, M.; Stewart, A.; Hill, R.A.; Sherlock, R.R. Biochar induced soil microbial community change: Implications for biogeochemical cycling of carbon, nitrogen and phosphorus. Pedobiologia 2011, 54, 309–320. [Google Scholar] [CrossRef]




| Fertilizers (kg ha−1) | Treatments | Basal:Tillering:Spikelet-Promoting:Spikelet-Protecting |
|---|---|---|
| N (300) | CF | 50:25:25:0 |
| FP | 40:20:20:20 | |
| P2O5 (150) | CF | 100:0:0:0 |
| FP | 50:0:50:0 | |
| K2O (240) | CF | 100:0:0:0 |
| FP | 50:0:50:0 |
| Target Gene | Primer Name | Primer Sequence (5′-3′) | Functional Process | at |
|---|---|---|---|---|
| amoA-a | CrenamoA23-F | ATGGTCTGGCTWAGACG | Nitrification | 56 °C |
| CrenamoA616-R | GCCATCCATCTGTATGTCCA | |||
| amoA-b | Bac-amoA-F | GGGGTTTCTACTGGTGGT | Nitrification | 56 °C |
| Bac-amoA-R | CCCCTCKGSAAAGCCTTCTTC | |||
| nifH | nifH-F | AAAGGYGGWATCGGYAARTCCACCAC | N fixation | 56 °C |
| nifH-R | TGSGCYTTGTCYTCRCGGATBGGCAT | |||
| narG | narG-F | TCGCCSATYCCGGCSATGTC | Denitrification | 56 °C |
| narG-R | GAGTTGTACCAGTCRGCSGAYTCSG | |||
| nirK | nirK1-F | GGMATGGTKCCSTGGCA | Denitrification | 56 °C |
| nirK5-R | GCCTCGATCAGRTTRTGG | |||
| nirS | nirS-F | AACGYSAAGGARACSGG | Denitrification | 56 °C |
| nirS-R | GASTTCGGRTGSGTCTTSAYGAA | |||
| nosZ | nosZ1-F | WCSYTGTTCMTCGAGCCAG | Denitrification | 56 °C |
| nosZ1-R | ATGTCGATCARCTGVKCRTTYTC | |||
| norB | cnorBB-F | AIGTGGTCGAGAAGTGGCTCTA | Denitrification | 56 °C |
| cnorBB-R | TCTGIACGGTGAAGATCACC |
| Comparison | PI | HS | MS | |||
|---|---|---|---|---|---|---|
| r Statistic | Significance | r Statistic | Significance | r Statistic | Significance | |
| CF–Bulk vs. FP–Bulk | 0.65 | 0.005 | 0.79 | 0.004 | 0.27 | 0.006 |
| CF–Rhizosphere vs. FP–Rhizosphere | 0.71 | 0.003 | 0.67 | 0.003 | 0.94 | 0.003 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Zhou, Y.; Xu, L.; Chen, J.; Li, G. Long-Term Fertilizer Postponing Reshapes Spatial and Temporal Patterns of Bacterial Communities and N-Cycling Potential in Paddy Soils. Agronomy 2026, 16, 1290. https://doi.org/10.3390/agronomy16131290
Zhou Y, Xu L, Chen J, Li G. Long-Term Fertilizer Postponing Reshapes Spatial and Temporal Patterns of Bacterial Communities and N-Cycling Potential in Paddy Soils. Agronomy. 2026; 16(13):1290. https://doi.org/10.3390/agronomy16131290
Chicago/Turabian StyleZhou, Yan, Lei Xu, Junhui Chen, and Ganghua Li. 2026. "Long-Term Fertilizer Postponing Reshapes Spatial and Temporal Patterns of Bacterial Communities and N-Cycling Potential in Paddy Soils" Agronomy 16, no. 13: 1290. https://doi.org/10.3390/agronomy16131290
APA StyleZhou, Y., Xu, L., Chen, J., & Li, G. (2026). Long-Term Fertilizer Postponing Reshapes Spatial and Temporal Patterns of Bacterial Communities and N-Cycling Potential in Paddy Soils. Agronomy, 16(13), 1290. https://doi.org/10.3390/agronomy16131290
