Intercropping Green Manure Species with Tea Plants Enhances Soil Fertility and Enzyme Activity and Improves Microbial Community Structure and Diversity in Tea Plantations

Abstract

To investigate the effects of intercropping green manure on the tea plantation ecosystem, this study was conducted using 40-year-old Camellia sinensis cv. “Fuding Dabai” tea plants at the Tea Experimental Base of the Jiangxi Institute of Cash Crops. Four treatments were established: clean tillage (CK), tea intercropped with ryegrass (Lolium perenne, TRG), tea intercropped with rapeseed (Brassica napus, TRP), and tea intercropped with alfalfa (Medicago sativa, TAL). The study systematically evaluated the effects of green manure on tea yield, soil nutrient content, enzyme activity, and microbial community structure. The results showed that intercropping with green manure significantly increased the bud density, hundred-bud weight, and yield of tea in spring, summer, and autumn, with the TAL treatment showing the best overall performance. In terms of soil physicochemical properties, green manure treatments significantly improved soil organic matter, total nitrogen, available nitrogen, available phosphorus, and available potassium contents, with TRP and TAL showing the most pronounced improvements. Enzyme activity analysis indicated that the TRP treatment significantly enhanced the activities of amylase, urease, and invertase. High-throughput sequencing results revealed that green manure treatments significantly increased both the number of bacterial and fungal OTUs (Operational Taxonomic Units) and alpha diversity indices. The TAL and TRP treatments showed superior performance in terms of Shannon, Chao, and ACE indices compared to CK. Principal coordinate analysis (PCoA) indicated that green manure had a greater influence on fungal community structure than on bacterial structure. Correlation analysis demonstrated that dominant microbial taxa were significantly associated with soil nitrogen, phosphorus, and potassium levels, suggesting that green manure modulates microbial community composition by improving soil nutrient status. Intercropping green manure significantly increased tea yield and soil quality compared with clean tillage. Alfalfa intercropping (TAL) increased tea yield by 49.61%, 40.88%, and 43.79% in spring, summer, and autumn, respectively, compared with the control. Soil organic matter and total nitrogen under TAL were 29.02% and 15.67% higher than the control, while rapeseed intercropping (TRP) increased available phosphorus by 186%. TAL and TRP also enhanced microbial diversity, with bacterial Shannon index values 14.11% and 11.25% higher than the control. These results indicate that alfalfa intercropping is the most effective green manure practice for improving tea plantation productivity and soil ecology.

1. Introduction

Camellia sinensis, a perennial and economically important crop, is highly dependent on soil quality and ecological stability for its growth and development. For decades, intensive chemical fertilization and clean-tillage practices have been widely adopted in tea plantations to maintain yield and quality. However, these conventional practices often lead to soil compaction, depletion of organic matter, loss of microbial diversity, and degradation of ecological functions, thereby constraining the sustainable development of the tea industry [1,2,3]. Consequently, the pursuit of green, ecological, and efficient management practices has become a key focus in improving tea plantation systems.

Previous studies have shown that a variety of organic amendments, such as biochar, zeolite, and cattle manure, have been applied to tea plantations to improve soil properties. Biochar can enhance soil pH buffering capacity and carbon sequestration [4]; zeolite is effective in increasing cation exchange capacity and nutrient retention [5], while cattle manure improves soil organic matter and microbial activity [6]. However, these amendments often require external inputs and may not be sustainable for long-term ecological management. In contrast, green manure can be directly cultivated within tea plantations, providing a continuous source of organic matter and nutrients while reducing dependence on external fertilizers. This study highlights the advantage of green manure over other organic amendments and explores its potential for sustainable tea plantation management. Green manure, as an important input in ecological agriculture, offers multiple ecological benefits such as enhancing soil fertility, improving soil structure, and boosting microbial activity [7,8,9]. Recent studies on the rotation or intercropping of green manures in orchards, paddy fields, and drylands have demonstrated promising ecological and economic outcomes. Research has shown that green manure species like rapeseed (Brassica napus), alfalfa (Medicago sativa), and ryegrass (Lolium perenne) can significantly increase soil organic carbon, enhance soil enzyme activities, and improve nutrient availability [10,11,12], while also optimizing microbial community structure and promoting beneficial microbial populations [13,14,15]. Although previous studies demonstrated the ecological benefits of green manure in orchards and paddy fields, its application in tea plantations, particularly in subtropical red soil regions, remains poorly understood. The knowledge gap lies in how different green manure species regulate soil fertility, enzyme activity, and microbial diversity in long-term acidified tea soils. This study addresses this gap by systematically comparing alfalfa, rapeseed, and ryegrass intercropping systems, thereby providing new insights into the sustainable management of tea plantations. Soil microorganisms play a critical role in ecosystem function, and changes in their diversity and structure often reflect variations in nutrient dynamics and soil health [16,17]. With the advancement of high-throughput sequencing technologies, it has become possible to comprehensively assess the impacts of various management practices on both bacterial and fungal communities [18].

This study was conducted in a tea plantation located in the subtropical red soil region of Jiangxi Province, China, and involved intercropping Medicago sativa, Brassica napus, and Lolium perenne with tea trees. We systematically evaluated the effects of green manure intercropping on soil fertility, enzyme activities, and bacterial and fungal community structures. We hypothesized that intercropping tea with different green manure species would significantly improve soil fertility, enzyme activities, and microbial diversity compared with clean tillage, and that leguminous green manure (alfalfa) would provide the most pronounced benefits due to its nitrogen-fixing ability. The objective is to evaluate the effects of different green manure species on soil fertility, enzyme activity, and microbial community diversity in tea plantations

2. Materials and Methods

2.1. Experimental Site

The experiment was initiated in October 2022 at the Tea Experimental Station of the Jiangxi Academy of Economic Crops (28°22′ N, 116°00′ E). The site is located in a subtropical monsoon climate zone, characterized by abundant rainfall, mild temperatures, and a long frost-free period. The tea plants used in the study were 40 years old, with a row spacing of 1.5 m and maintained under a light pruning regime, and the spacing between clusters is 20 cm. The soil type is red soil developed from Quaternary red clay. Prior to the experiment, the surface soil of the tea plantation was acidic (pH 4.48). The contents of soil organic matter, total nitrogen, total phosphorus, and total potassium were 31.04, 2.59, 2.19, and 4.21 g·kg⁻¹, respectively, while the concentrations of alkali-hydrolyzable nitrogen, available phosphorus, and available potassium were 130.71, 115.34, and 158.25 mg·kg⁻¹, respectively.

2.2. Experimental Design and Materials

The tea cultivar used in this study was Camellia sinensis cv. “Fudingdabai”. The green manure species included ryegrass (Lolium perenne “Bond No. 3”), rapeseed (Brassica napus “Zhongyoufei No. 1”), and alfalfa (Medicago sativa “Zhongmu No. 1”). The fertilizers used were rapeseed cake (organic matter content: 70.3%, purchased from Wuyuan County, Jiangxi Province, China) and a tea-specific compound fertilizer (N ≥ 18%, P₂O₅ ≥ 8%, K₂O ≥ 12%, obtained from Hubei Yishizhuang Agricultural Technology Co., Ltd., Yichang City, Hubei Province, China). The basic physicochemical properties of the green manures are shown in

Table 1. Basic physicochemical properties of the green manures.

Properties	TK (g·kg−1)	TP (g·kg−1)	Ca (mg·kg−1)	Mg (mg·kg−1)	TN (g·kg−1)	TC (g·kg−1)
Ryegrass	32.45	4.93	0.63	2.70	45.33	376.11
Rapeseed	15.09	4.78	2.29	3.95	40.64	389.31
Alfalfa	12.06	4.47	1.90	3.77	57.43	394.03

Note: TK: total potassium; TP: total phosphorus; TN: total nitrogen; TC: total carbon.

.

A randomized single-factor design was adopted in this study, comprising four treatments: clean-tillage tea plantation (CK), tea intercropped with ryegrass (Lolium perenne, TRG), tea intercropped with rapeseed (Brassica napus, TRP), and tea intercropped with alfalfa (Medicago sativa, TAL). Each treatment was replicated three times, with a plot area of 134 m² and each plot was planted with three rows of tea plants, resulting in a total of 12 plots. The plots were separated by cement ridges to prevent cross-contamination. Green manure seeds were uniformly broadcast between tea rows on 30 October 2022, and 5 November 2023. The seeding rate for ryegrass, rapeseed, and alfalfa was 30 kg·hm⁻². Green manures were incorporated into the soil during their full-bloom stages: ryegrass (21 March 2023, and 26 March 2024), rapeseed (21 March 2023, and 26 March 2024), and alfalfa (25 March 2023, and 1 April 2024). The average fresh biomass of ryegrass, rapeseed, and alfalfa in 2023 was 5857.31, 6341.25, and 6382.97 kg·hm⁻², respectively; in 2024, the corresponding values were 6035.44, 6542.18, and 6615.42 kg·hm⁻². Organic fertilizer (rapeseed cake) was applied as a basal fertilizer on 13 October 2022, and 11 October 2023, at a rate of 3750 kg·hm⁻², incorporated into the soil at a depth of 30 cm. A tea-specific compound fertilizer was top-dressed on 23 February 2023, and 25 February 2024, at a rate of 600 kg·hm⁻². All plots were managed identically in terms of weed control, pest and disease management, and other standard tea plantation practices.

2.3. Data Collection

2.3.1. Measurement of Tea Yield and Agronomic Characteristics

For each plot, bud density was recorded by randomly selecting three quadrats (each 0.33 m × 0.33 m in size, with an area of 0.11 m²). In addition, 100 tea buds were randomly collected from each plot to determine the hundred-bud weight. According to the standard tea harvesting criteria of Jiangxi Province, all fresh tea shoots in the experimental plots were harvested during the spring, summer, and autumn of 2024 to calculate the fresh shoot yield per unit area.

2.3.2. Measurement of Soil Physicochemical Properties

On 2 April 2024, during the spring tea harvest, soil samples were collected from each plot using a five-point random sampling method. Samples were taken from the 0–20 cm soil layer, with coarse roots and small stones removed. The samples were then brought back to the laboratory, air-dried, and passed through a sieve for subsequent soil nutrient analysis. According to the Soil Agrochemical Analysis manual [19], soil physicochemical properties were determined. The specific parameters and methods are listed in

Table 2. Determination of soil nutrient items and determination methods.

Measurement Items	Determination Method
pH	pH Meter Method
Soil organic matter (SOM)	Potassium Dichromate Method (Concentrated H2SO4 Heating)
Total nitrogen (TN)	Semi-micro Kjeldahl Method
Total phosphorus (TP)	Molybdenum Blue Colorimetric Method
Total potassium (TK)	Flame Photometry
Available Nitrogen (AN)	Alkali-hydrolysis Diffusion Method
Available Phosphorus (AP)	Sodium Bicarbonate Extraction
Available Potassium (AK)	Ammonium Acetate Extraction Followed by Flame Photometry

Note: All experimental methods in this table are cited from “Soil Agrochemical Analysis” [19].

.

2.3.3. Measurement of Soil Enzyme Activities

The determination of soil enzyme activities included the following methods: soil amylase activity was measured using the 3,5-dinitrosalicylic acid (DNS) colorimetric method; soil catalase activity was determined by the potassium permanganate titration method; soil urease activity was assayed using the phenol sodium-sodium hypochlorite colorimetric method; soil invertase activity was measured by the 3,5-dinitrosalicylic acid colorimetric method; soil acid phosphatase activity was determined using the p-nitrophenyl phosphate method; and soil alkaline phosphatase activity was assessed by fluorescence microplate analysis.

2.3.4. Measurement of Soil Microbial Community Structure

After the spring tea harvest (2 April 2024), rhizosphere soil samples were collected from each plot using a randomized five-point sampling method. Microbial DNA was extracted from the soil samples using the DNeasy^® PowerSoil^® Pro Kit (QIAGEN, Germantown, MD, USA). DNA concentration and purity were measured with an ultramicro spectrophotometer, and DNA integrity was assessed by 1% agarose gel electrophoresis. PCR amplification of microbial 16S rRNA genes was performed using primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). For microbial 18S rDNA amplification, primers SSU0817 (FTTAGCATGGAATAATRRAATAGGA) and 1196R (TCTGGACCTGGTGAGTTTCC) were used. PCR products were verified by 2% agarose gel electrophoresis. The PCR products were then identified, purified, and quantified to construct the MiSeq library. Sequencing was conducted on the Illumina MiSeq PE300 platform.

2.4. Data Processing

Data entry and processing were performed using Microsoft Excel 2019. Statistical analysis and analysis of variance (ANOVA) were conducted with SPSS 26.0 software, employing one-way ANOVA for variance analysis and multiple comparisons. The Least Significant Difference (LSD) test was used to assess significant differences among sample means. Graphs were generated using Origin 2022 and GraphPad Prism 9.

The paired-end (PE) reads obtained from MiSeq sequencing were first merged based on overlapping regions. Quality control and filtering of sequences were conducted, followed by sample demultiplexing. Operational Taxonomic Unit (OTU) clustering and taxonomic classification were performed at a 97% similarity threshold. Based on OTU data, various diversity indices were calculated, including observed species richness (Sobs), evenness index (Simpson’s evenness), Shannon diversity index (Shannon), and coverage index (Coverage). OTU clustering analysis was further conducted using CD-HIT software (version 4.8.1) (http://www.bioinformatics.org/cd-hit/) (accessed on 25 June 2025) with default parameters (90% identity and 90% coverage) to construct a non-redundant gene set. Microbial functional metabolism was annotated by aligning sequences to the COG (Clusters of Orthologous Groups of proteins) database, and gene function annotation profiles were statistically summarized. Functional metabolic abundance was calculated using the RPKM (reads per kilobase per million mapped reads) method. Visualization of relationships between samples and functions was generated using Circos-0.67-7 (http://circos.ca/). Circos plots typically illustrate the distribution of microbial functions across different samples. SPSS software (IBM SPSS Statistics 26) was used to analyze the significance of differences in soil physicochemical properties among different species. Spearman correlation coefficients between environmental factors and different species were calculated using the R language (R 4.3.3), and the results were visualized by heatmaps. Venn diagrams and community bar plots were created with the R language (R 4.3.3).

3. Results and Analysis

3.1. Effects of Green Manure Intercropping on Tea Yield and Agronomic Traits

During the spring tea season, all intercropping treatments showed significantly higher bud densities than the CK group by 20.92% to 23.53% (p < 0.05). The hundred-bud weight in TAL and TRP treatments was significantly higher than that in other treatments by 5.81% to 14.68% (p < 0.05). In terms of yield, the TAL treatment produced significantly higher yields than other treatments, with increases ranging from 5.40% to 49.61% (p < 0.05). During the summer tea season, bud densities in all treatments remained significantly higher than the CK group by 25.09–27.27% (p < 0.05). The TRG treatment showed a significantly higher hundred-bud weight than the other treatments by 3.39–16.08% (p < 0.05). The yield of the TAL treatment was significantly higher than other treatments by 6.72–40.88% (p < 0.05), and the yields of TRG and TRP were also significantly higher than the CK group by 26.46% and 32.01%, respectively (p < 0.05). In the autumn tea season, all treatments continued to show significantly higher bud densities than the CK group, with increases ranging from 38.03 to 48.83% (p < 0.05). The hundred-bud weight in all treatments was also significantly higher than that of the CK group by 6.70–10.83% (p < 0.05). Similarly, the yields of all treatments were significantly higher than the CK group by 38.06–43.39% (p < 0.05). In summary, across the spring, summer, and autumn tea seasons, the TAL, TRG, and TRP treatments significantly improved bud density, hundred-bud weight, and overall tea yield, showing clear advantages over the CK group. These results suggest that green manure intercropping has a positive effect on increasing tea production (

Table 3. Effects of Intercropping Tea Plants with Different Green Manures on Tea Yield and Agronomic Traits.

Period	Treatment	Bud Density (Buds·m−2)	Hundred-Bud Weight (g)	Yield (kg·hm−2)
Spring tea	CK	918.00 ± 15.59 b	27.93 ± 0.70 c	601.00 ± 51.42 c
	TAL	1110.00 ± 65.11 a	32.03 ± 0.93 a	899.17 ± 97.16 a
	TRG	1128.00 ± 36.37 a	30.27 ± 0.65 b	784.13 ± 11.78 b
	TRP	1134.00 ± 47.62 a	31.93 ± 0.76 a	853.43 ± 25.42 ab
Summer tea	CK	825.00 ± 27.50 b	25.50 ± 0.72 c	532.90 ± 32.26 c
	TAL	1050.00 ± 93.67 a	28.63 ± 0.50 ab	750.77 ± 46.57 a
	TRG	1038.00 ± 63.21 a	29.60 ± 0.61 a	673.93 ± 23.99 b
	TRP	1032.00 ± 93.67 a	28.27 ± 0.76 b	703.50 ± 25.06 ab
Autumn tea	CK	639.00 ± 9.00 b	24.93 ± 1.41 b	429.77 ± 25.39 b
	TAL	948.00 ± 22.65 a	26.60 ± 0.50 a	616.23 ± 50.67 a
	TRG	882.00 ± 86.79 a	27.63 ± 0.64 a	601.40 ± 36.32 a
	TRP	951.00 ± 68.15 a	26.60 ± 0.20 a	593.33 ± 23.53 a

Note: CK: Clean tillage; TAL: Tea intercropped with alfalfa; TRG: Tea intercropped with ryegrass; TRP: Tea intercropped with rapeseed. Data are expressed as the mean ± standard error of three replicates. Different letters within the same column indicate significant differences at the 5% level (p < 0.05); the same applies hereafter.

).

3.2. Effects of Green Manure Intercropping with Tea Plants on Soil Chemical Properties and Enzyme Activities

3.2.1. Chemical Properties of Tea Plantation Soil

As shown in

Table 4. Effects of Different Green Manures Intercropped with Tea Plants on Soil Chemical Properties.

Treatment	pH	SOM g·kg−1	TN g·kg−1	TP g·kg−1	TK g·kg−1	AN mg·kg−1	AP mg·kg−1	AK mg·kg−1
CK	4.43 ± 0.05 b	28.05 ± 2.05 b	2.17 ± 0.02 c	2.12 ± 0.14 b	4.02 ± 0.82 b	144.02 ± 12.18 c	99.22 ± 3.25 d	147.88 ± 0.29 c
TAL	4.52 ± 0.08 ab	36.19 ± 0.22 a	2.51 ± 0.02 a	2.34 ± 0.29 ab	5.02 ± 0.26 a	185.62 ± 7.30 a	179.31 ± 2.37 b	167.30 ± 4.45 b
TRG	4.50 ± 0.03 ab	34.47 ± 1.71 a	2.22 ± 0.04 b	2.29 ± 0.01 ab	5.47 ± 0.13 a	164.17 ± 2.93 b	119.10 ± 4.52 c	161.02 ± 4.76 b
TRP	4.51 ± 0.07 a	34.75 ± 1.21 a	2.23 ± 0.19 b	2.63 ± 0.19 a	5.92 ± 0.50 a	170.35 ± 6.75 b	283.88 ± 7.78 a	176.16 ± 4.80 a

Note: CK: Clean tillage; TAL: Tea intercropped with alfalfa; TRG: Tea intercropped with ryegrass; TRP: Tea intercropped with rapeseed; SOM: Soil organic matter; TN: Total nitrogen; TP: Total phosphorus; TK: Total potassium; AN: Alkali-hydrolyzable nitrogen; AP: Available phosphorus; AK: Available potassium. Data are presented as mean ± standard error of three replicates. Different letters within the same column indicate significant differences at the 5% level (p < 0.05); the same applies below.

, compared with the control treatment CK, the three green manure treatments (TAL, TRG, and TRP) all improved soil physicochemical properties to varying degrees. Among them, soil pH showed no significant difference among treatments. Regarding soil organic matter, the TAL treatment was significantly higher than CK by 29.02%, while TRG and TRP treatments were also significantly higher than CK by 22.89% and 23.89%, respectively (p < 0.05). For total nitrogen (TN), the TAL treatment was significantly higher than the other treatments by 12.56–15.67% (p < 0.05). Soil total phosphorus (TP) was significantly increased under the TRP treatment, exceeding the control CK by 24.06% (p < 0.05). Total potassium (TK) was significantly higher than CK under all three green manure treatments. Available nitrogen (AN) was significantly enhanced by green manure treatments, with TAL reaching the highest level, exceeding other treatments by 8.96–28.88% (p < 0.05). Available phosphorus (AP) was significantly increased in the TRP treatment, approximately 2.86 times that of CK (p < 0.05); TAL and TRG treatments were also significantly higher than CK. Available potassium (AK) was highest in the TRP treatment, significantly exceeding CK, followed by TAL and TRG.

Overall, green manure treatments significantly improved soil physicochemical properties, with rapeseed (TRP) and alfalfa (TAL) treatments showing the most pronounced effects. This was reflected in significant increases in organic matter and available nutrients (available nitrogen, phosphorus, and potassium), thereby promoting soil fertility and crop growth potential.

3.2.2. Enzyme Activities in Tea Plantation Soil

As shown in

Table 5. Effects of Different Green Manures Intercropped with Tea Plants on Soil Enzyme Activities.

Treatment	Amylase mg·(g·d)−1	Catalase (U·g−1)	Urease mg·(g·h)−1	Invertase (U·g−1)	Acid Phosphatase (U·g−1)	Alkaline Phosphatase (U·g−1)
CK	1.64 ± 0.13 b	2.50 ± 0.38 a	427.04 ± 98.25 b	6.78 ± 0.50 b	53,706.46 ± 3032.75 a	7231.22 ± 470.17 a
TAL	2.51 ± 0.88 b	2.87 ± 0.39 a	819.06 ± 53.86 a	7.80 ± 0.52 b	58,341.26 ± 3152.41 a	7508.64 ± 190.68 a
TRG	1.67 ± 0.89 b	3.06 ± 0.08 a	467.89 ± 50.35 b	7.69 ± 0.24 b	56,013.15 ± 5074.06 a	7074.17 ± 697.94 a
TRP	9.67 ± 3.45 a	3.10 ± 0.38 a	930.31 ± 125.37 a	12.06 ± 0.80 a	58,134.01 ± 2179.15 a	7237.27 ± 406.38 a

Note: CK: Clean tillage; TAL: Tea intercropped with alfalfa; TRG: Tea intercropped with ryegrass; TRP: Tea intercropped with rapeseed; Data are presented as mean ± standard error of three replicates. Different letters within the same column indicate significant differences at the 5% level (p < 0.05); the same applies below.

, intercropping tea plants with green manure significantly affected soil enzyme activities in the tea plantation. For soil amylase, the TRP treatment was significantly higher than other treatments, approximately 5.9 times that of the CK (p < 0.05). Catalase activity was higher in all green manure treatments compared to CK, but the differences were not significant. Urease activity significantly increased under TAL and TRP treatments, which were 91.80% and 117.85% higher than CK, respectively (p < 0.05). Invertase activity was also significantly enhanced in the TRP treatment, exceeding other treatments by approximately 54.62% (p < 0.05). Overall, green manure treatments significantly improved soil enzyme activities, with the rapeseed (TRP) treatment showing the most pronounced effect.

3.3. Effects of Intercropping Tea Plants with Green Manure on the Soil Bacterial and Fungal Community Structure in Tea Plantations

3.3.1. Composition of Soil Bacterial and Fungal Communities

As shown in Figure 1a, the number of bacterial OTUs in tea garden soil under different treatments was as follows: CK (4187), TAL (6863), TRG (6654), and TRP (6594). A total of 1266 OTUs were shared among all treatments, accounting for 30.24% of CK, 18.45% of TAL, 19.03% of TRG, and 19.20% of TRP. The number of unique OTUs in TAL, TRG, and TRP was significantly higher than that in CK, exceeding it by 91.61%, 84.48%, and 82.40%, respectively (p < 0.05). In the fungal Venn diagram (Figure 1b), the number of fungal OTUs in the tea garden soil was CK (904), TAL (1160), TRG (948), and TRP (1114). There were 465 OTUs shared among all treatments, accounting for 51.44% of CK, 40.09% of TAL, 49.05% of TRG, and 41.74% of TRP (p < 0.05). The number of unique fungal OTUs in TAL and TRP was also higher than that in CK, by 58.31% and 47.84%, respectively (p < 0.05). In summary, different green manure treatments influenced the composition of both bacterial and fungal communities in the tea garden soil. Among them, the TAL treatment had the highest proportion of unique bacterial and fungal OTUs, indicating that intercropping with alfalfa (Medicago sativa) resulted in the highest microbial community similarity within that treatment group.

As shown in Figure 2a, at the phylum level for bacteria, the top five dominant bacterial phyla were Acidobacteriota, Pseudomonadota, Chloroflexi, Planctomycetota, and Actinomycetota, with relative abundances ranging from 19.25 to 23.06%, 18.76–19.97%, 14.45–18.70%, 6.98–12.03%, and 7.40–8.33%, respectively (p < 0.05). The relative abundance of Planctomycetota was highest in the TAL treatment, exceeding the other treatments by 37.96–72.35% (p < 0.05). In contrast, Acidobacteriota, Pseudomonadota, Chloroflexi, and Actinomycetota were most abundant in the CK treatment.

As shown in Figure 2b, at the fungal phylum level, the top five dominant fungal phyla were Ascomycota, Basidiomycota, Mucoromycota, Anthophyta, and Ciliophora, with relative abundances ranging from 38.95 to 55.69%, 17.90–25.81%, 7.72–10.14%, 0.77–21.55%, and 1.43–7.47%, respectively (p < 0.05). The TAL treatment had the highest proportions of Mucoromycota and Anthophyta, exceeding the other treatments by 7.07–31.35% and 643.10–2698.70%, respectively (p < 0.05). The TRG treatment had the highest abundances of Ascomycota and Ciliophora, exceeding the other treatments by 11.38–42.98% and 101.62–422.38%, respectively. Additionally, Basidiomycota was most abundant in the CK treatment, surpassing the other treatments by 21.98–44.19%.

Based on the PCoA analysis using Euclidean distance (Figure 3), the effects of different green manure treatments on soil bacterial and fungal community structures in tea plantations varied. For fungal communities (Figure 3b), the structures of CK and treatments TAL, TRG, and TRP were clearly separated with no overlap, indicating significant differences between groups and good explanatory power (20.7% and 11.9%). In contrast, for bacterial communities (Figure 3a), there was considerable overlap among treatments, and the separation was not obvious. In summary, the impact of different green manure treatments on the soil fungal community structure was greater than that on the bacterial community structure.

3.3.2. Soil Bacterial and Fungal Community Diversity

As shown in

Table 6. Alpha Diversity Indices of Bacterial and Fungal Communities at the Species Level Under Different Green Manure Treatments.

Treatment	Simpson Index		Shannon Index		Chao Index		ACE Index
	Bacteria	Fungi	Bacteria	Fungi	Bacteria	Fungi	Bacteria	Fungi
CK	0.9838 a	0.9125 a	9.07 b	5.30 a	5647 a	940 b	5915 a	924 b
TAL	0.9921 a	0.9309 a	10.35 a	5.54 a	6190 a	1062 a	6791 a	1063 a
TRG	0.9947 a	0.9345 a	9.77 ab	5.63 a	6230 a	1010 ab	6506 a	1001 ab
TRP	0.9960 a	0.9558 a	10.09 a	6.07 a	6503 a	1106 a	6453 a	1079 b

Note: All table data are calculated based on the mean values and corresponding standard errors of three replicates. Different lowercase letters following the values within the same column indicate significant differences among treatments at the 5% level (p < 0.05); the same applies below.

, there were no significant differences in the Simpson index of bacterial and fungal communities among the different green manure treatments. Based on the Shannon index, the bacterial community diversity under TAL and TRP treatments was significantly higher than that of the CK group, by 14.11% and 11.25%, respectively (p < 0.05), while no significant differences were observed among treatments for the fungal communities (p > 0.05). According to the Chao index, the fungal community richness under TAL and TRP treatments was significantly higher than that of CK, by 12.98% and 17.66%, respectively, whereas differences in bacterial communities were not significant. Similarly, the ACE index showed that fungal community richness was significantly higher under TAL and TRP treatments than CK, by 15.04% and 16.77%, respectively (p < 0.05), with no significant differences observed in the bacterial communities. In summary, the TAL and TRP green manure treatments significantly increased the diversity of bacterial communities (Shannon index) and the richness of fungal communities (Chao and ACE indices), indicating that green manure has different effects on bacterial and fungal community diversity.

3.4. Correlation Analysis Between Soil Environmental Factors and the Structures of Soil Bacterial and Fungal Communities

The correlation analysis between dominant microbial taxa and soil factors showed that the relationships between dominant bacterial (Figure 4a) and fungal (Figure 4b) communities and soil physicochemical properties varied under different green manure treatments. In Figure 4a, Planctomycetota was significantly positively correlated with soil organic matter, total nitrogen (TN), total phosphorus (TP), available nitrogen (AN), available phosphorus (AP), and available potassium (AK), among which the correlations with TN, AN, AP, and AK were highly significant (p < 0.01), and those with SOM and TP were significant (p < 0.05). Patescibacteria showed a highly significant positive correlation with TP (p < 0.01). Myxococcota was significantly positively correlated with TN, TP, and AP (p < 0.05). Cyanobacteriota showed a significant negative correlation with total potassium (TK) (p < 0.05). Methylomirabiliora was significantly negatively correlated with TN, AN, and AP (p < 0.05). Candidatus Kapabacteria exhibited a highly significant negative correlation with TK (p < 0.01).

As shown in Figure 4b, Anthophyta was significantly positively correlated with TP and AP (p < 0.05). Mortierellomycota showed a significant negative correlation with SOM (p < 0.05). Chlorophyta was highly significantly positively correlated with TP and TK (p < 0.01), and significantly positively correlated with AP (p < 0.05). Cercozoa was highly significantly positively correlated with soil pH (p < 0.01), and significantly positively correlated with TN and AK (p < 0.05). Calcarisporiellomycota was highly significantly negatively correlated with AP (p < 0.01), and significantly negatively correlated with TN, TP, and AK (p < 0.05).

These results indicate that under different green manure treatments, dominant soil bacterial and fungal taxa were significantly or highly significantly correlated with multiple soil physicochemical factors. This suggests that green manure influences microbial community structure by altering soil nutrient status. Bacterial communities appeared to be more sensitive to changes in nitrogen, phosphorus, and potassium, while fungal communities showed stronger associations with phosphorus and soil pH. Only a subset of bacterial and fungal taxa, such as Planctomycetota and Anthophyta, showed significant correlations with soil N, P, and K levels, while most microbial groups did not respond strongly.

3.5. Microbial Metabolic Functions

The functional prediction results showed that different treatments had significant effects on the potential contributions of bacterial metabolic functions (Figure 5a). In the ansamycin biosynthesis pathway, the TRG treatment exhibited the highest abundance, which was significantly higher than the other treatments by 9.61% to 32.49% (p < 0.05), indicating that TRG may be more conducive to enhancing the functional potential related to antibiotic biosynthesis. In the vancomycin group antibiotic biosynthesis pathway, the CK treatment showed the highest abundance, significantly higher than the other treatments by 6.90% to 22.76% (p < 0.05), suggesting a potential promoting effect on this metabolic pathway. In contrast, TAL and TRP exhibited significantly lower abundances in this function. In the branched-chain amino acid (valine, leucine, and isoleucine) biosynthesis pathway, CK and TRG treatments had relatively high abundances, whereas TAL and TRP remained at lower levels, indicating that different treatments exerted varying impacts on amino acid metabolism. Overall, TRG and CK showed higher abundances across multiple functional pathways, which may contribute more strongly to sustaining nutrient cycling and metabolic potential, whereas TAL and TRP were relatively lower, reflecting weaker potential in the corresponding metabolic functions.

The fungal functional prediction results showed that in pathotroph and pathotroph-saprotroph groups, the abundances under different treatments were consistently low with little variation (Figure 5b). In contrast, in the pathotroph-saprotroph-symbiotroph group, the differences among treatments were more pronounced. The TRP treatment exhibited the highest abundance, significantly higher than the other treatments by 7.24% to 50.37% (p < 0.05). This indicates that TRP may promote the enrichment of fungal taxa with multiple trophic modes, thereby enhancing the ecological functional complexity and environmental adaptability of the community. Overall, fungal communities were dominated by mixed trophic modes, while the proportion of purely pathotrophic fungi remained relatively low.

4. Discussion

4.1. The Effect of Green Manure Intercropping on Tea Yield

Soil: The results of this study indicate that, compared with the bare soil treatment (CK), all three green manure intercropping treatments (TAL, TRG, and TRP) significantly increased bud density, hundred-bud weight, and tea yield across the spring, summer, and autumn tea harvest periods (Table 4). Among them, the alfalfa intercropping treatment (TAL) achieved the highest yield in all three seasons, demonstrating the most pronounced yield-enhancing effect. This improvement in yield can likely be attributed to several factors. First, the biomass contribution from green manure is a key driver of tea plant growth. The results showed that the plowed-in fresh biomass of alfalfa and rapeseed was higher than that of ryegrass, with alfalfa reaching 6615.42 kg·hm⁻² in 2024, thus providing a substantial source of organic matter. This helped improve the rhizosphere environment and soil fertility, thereby enhancing nutrient supply to tea plants, which is consistent with the findings of Wei K et al. [20]. Alfalfa also possesses nitrogen-fixing capabilities through symbiotic rhizobia that convert atmospheric nitrogen into plant-available ammonium nitrogen, offering a stable nitrogen source to meet the high nitrogen demand of tea plants [21]. Second, green manure intercropping improved soil physicochemical properties, especially by increasing alkali-hydrolyzable nitrogen and available phosphorus (Table 1), which are critical for the sprouting and growth of tea buds [22]. El Idrissi A et al. [23] reported that sufficient nitrogen availability promotes the differentiation and sprouting of axillary buds in tea plants, thereby increasing bud density. In the present study, all green manure treatments significantly improved bud density compared to CK, with the TAL treatment increasing spring tea bud density by 23.53% and autumn tea by 48.83%, supporting this mechanism. The increase in hundred-bud weight reflects enhanced individual bud quality, likely associated with improved root absorption driven by soluble organic carbon and active enzymes released from green manure decomposition [24]. Additionally, green manures such as rapeseed and alfalfa contain high levels of amino acids, low-molecular-weight peptides, and physiologically active substances, which can act as plant growth stimulants to promote tea shoot growth, thereby increasing hundred-bud weight [25]. Furthermore, green manures may indirectly enhance tea plant growth by suppressing weeds and regulating soil temperature and moisture. For instance, ryegrass, as a winter cover crop, can reduce water evaporation and stabilize soil temperature, promoting early spring bud sprouting in tea plants [26]. In this study, ryegrass (TRG) resulted in higher hundred-bud weight during summer, indicating its positive impact on tea growth in early to mid-summer.

In summary, intercropping tea trees with green manure not only increased tea yield but also likely improved bud quality, demonstrating a synergistic effect on both productivity and quality. Among the treatments, TAL exhibited the most substantial comprehensive effect, suggesting that in red soil tea plantations of southern China, nitrogen-fixing green manure such as alfalfa is a particularly effective strategy for simultaneously enhancing soil fertility and tea yield.

4.2. The Regulatory Mechanisms of Green Manure on the Physicochemical Properties of Tea Garden Soil

Intercropping with green manure significantly improved the physicochemical properties of tea garden soils, as evidenced by increased levels of soil organic matter, total nitrogen, alkali-hydrolyzable nitrogen, and available phosphorus and potassium. Specifically, the Medicago sativa (TAL) treatment increased soil organic matter and total nitrogen contents by 29.02% and 15.67%, respectively, compared with the clean-tillage (CK) control, highlighting its advantages in nitrogen fixation and organic matter input. Liang et al. [27] reported that leguminous green manure enhances soil nitrogen availability through symbiotic nitrogen fixation and promotes organic carbon accumulation. The Brassica napus (TRP) treatment showed outstanding performance in terms of available phosphorus (AP) and available potassium (AK), with AP content reaching 2.86 times that of CK. This may be attributed to two factors: first, root exudation of organic acids by Brassica species can mobilize fixed phosphorus, enhancing its bioavailability [28]; second, decomposition of green manure residues may release water-soluble potassium, improving its uptake efficiency by crops [29]. Although green manure treatments slightly increased soil pH, the changes were not statistically significant compared with the control, which is consistent with the findings of Park S [30]. In addition, the input of green manure provides carbon sources for microbial metabolism, facilitating nutrient mineralization and sustained release. In conclusion, different green manures modulate soil nutrient status through variations in rhizosphere effects and organic matter inputs. Among them, TAL is more suitable for nitrogen supplementation, while TRP is more effective in enhancing phosphorus and potassium availability, providing a scientific basis for precision fertilization in tea plantations.

4.3. The Promotive Effect of Green Manure on Soil Enzyme Activities

Intercropping with green manure significantly enhanced the activity of key soil enzymes in tea plantations, particularly amylase, urease, and invertase. For example, in the Brassica napus treatment (TRP), amylase activity was approximately 5.9 times higher than that of the clean-tillage control (CK), while urease and invertase activities increased by 117.85% and 77.75%, respectively. This enhancement in enzyme activity likely indicates accelerated nutrient transformation processes, improving the availability of nutrients such as nitrogen and carbon [31]. Moreover, Jia L et al. [32] reported that organic acids and low-molecular-weight organic compounds released during green manure decomposition can serve as substrates or inducers for enzymatic reactions, thereby stimulating microbial metabolic activity and enhancing related enzyme activities. Urease, a key enzyme in nitrogen mineralization, plays a crucial role in converting organic nitrogen into plant-available forms. Invertase, which is closely related to carbon cycling, facilitates carbon supply and supports microbial growth when its activity increases [33]. Although the increases in catalase and phosphatase activities were less pronounced, the overall trend still supports the positive effect of green manure on microbial vitality. Hu A et al. [34] found that green manure application in acidic soils enhances the ecological sensitivity and functional stability of soil enzymes, especially in systems with high organic carbon inputs, which is consistent with the findings of this study. In conclusion, green manure effectively promotes the activity of nutrient transformation-related enzymes by supplying degradable organic substrates and optimizing the microbial environment, thereby improving nutrient dynamics and supporting the sustained growth of tea plants.

4.4. The Effects of Green Manure on Soil Microbial Community Structure and Diversity

In intercropping, green manure not only improved the physicochemical properties and enzymatic activities of tea garden soils but also profoundly influenced the composition and diversity of soil microbial communities. In terms of operational taxonomic units (OTUs), both bacterial and fungal richness under the three green manure treatments were higher than those in the clean-tillage (CK) treatment. Particularly, the purple alfalfa (TAL) treatment increased bacterial and fungal OTU numbers by 63.94% and 28.54%, respectively, compared to CK. This result indicates that green manure significantly enhances microbial habitat availability and ecological niche diversity by providing energy and carbon sources [35]. Regarding bacterial community composition, green manure treatments promoted the relative abundance of functional phyla such as Actinomycetota and Planctomycetota, whereas Acidobacteriota and Pseudomonadota dominated in the CK treatment. This may be attributed to the increased supply of degradable organic carbon under green manure, which supports the expansion of carbon-metabolizing bacterial groups [36]. Planctomycetota was significantly enriched under the TAL treatment; this phylum is known for its capacity to decompose complex carbon substrates and participate in nitrogen cycling, making it an important microbial group for maintaining soil ecological functions [37]. In terms of fungal communities, the TAL and TRP treatments increased the relative abundance of Mucoromycota and Anthophyta, while Basidiomycota was dominant in the CK group. Mucoromycota is typically associated with organic matter mineralization and nutrient release, suggesting that the application of green manure enhances the nutritional function and activity of fungal communities [38]. Principal coordinate analysis (PCoA) further revealed a clear separation in fungal community structure between green manure treatments and CK, indicating a strong structuring effect of green manure on fungal communities, while its impact on bacterial communities was relatively weaker.

Alpha diversity analysis further supported these findings. Shannon index results showed that TAL and TRP treatments significantly increased bacterial diversity by 14.11% and 11.25%, respectively, compared to CK. Meanwhile, the Chao and ACE indices indicated significant increases in fungal species richness under both treatments. These results suggest that green manure differentially regulates microbial communities: it primarily enhances species evenness in bacteria and promotes the expansion and accumulation of rare taxa in fungi, consistent with the findings of Tan Y et al. [39]. In conclusion, green manure optimized the microbial community structure and functional potential in tea garden soils by improving nutrient availability and supplying abundant carbon sources. Among the treatments, purple alfalfa (TAL) demonstrated the most pronounced effects on enhancing both bacterial and fungal diversity, indicating its strong role in promoting soil ecosystem complexity and stability. This not only facilitates efficient nutrient cycling but also provides a healthier micro-ecological environment for tea plant rhizospheres.

4.5. Linkages Between Soil Physicochemical Properties, Microbial Community Structure, and Predicted Microbial Functions

In this study, heatmap analysis revealed that dominant microbial taxa under different green manure treatments exhibited significant correlations with various soil physicochemical factors, indicating a strong environmental driving force in shaping microbial community structures. Among bacterial phyla, Planctomycetota showed highly significant positive correlations with total nitrogen, alkaline hydrolyzable nitrogen, available phosphorus, and available potassium, suggesting that this group is highly responsive to nutrient enrichment and proliferates rapidly under green manure regulation [40]. Within the fungal community, Mucoromycota was significantly associated with soil organic matter, while Anthophyta showed a significant positive correlation with available phosphorus, indicating that organic carbon and phosphorus are key environmental factors influencing fungal diversity in tea garden soils [41]. These findings are consistent with previous studies [42], which reported that nutrient-rich environments promote the dominance of functional fungal groups (e.g., decomposers and symbionts), thereby enhancing the functional stability of soil micro-ecosystems. Furthermore, the correlation results indicated that bacterial communities were more sensitive to rapidly available nutrients such as nitrogen and potassium, whereas fungal communities were more strongly driven by phosphorus availability and soil pH. This may be attributed to the rapid turnover, high metabolic activity, and fast response rate of bacteria, in contrast to the more conservative resource-use strategies commonly observed in fungi [43]. In summary, green manure application reshaped the soil microbial community by improving nitrogen, phosphorus, potassium, and organic matter levels, particularly promoting the expansion of functional microbial groups closely linked to nutrient cycling. This provides a microbial foundation for enhancing the ecological functions of tea garden soils.

The bacterial functional prediction results indicated that CK and TRG treatments exhibited higher abundances across multiple metabolic pathways, particularly in antibiotic biosynthesis and amino acid metabolism, highlighting their potential advantages in sustaining soil nutrient cycling and metabolic capacity. These findings are consistent with previous studies reporting that appropriate management practices can enhance ecosystem functions by stimulating bacterial metabolic activity [44]. In contrast, TAL and TRP treatments showed relatively lower functional potential, likely due to the enrichment of bacterial taxa adapted to high-fiber or inhibitory environments, which generally exhibit weaker metabolic capabilities such as antibiotic and amino acid biosynthesis [45,46]. For fungi, the community was dominated by mixed trophic modes, while the proportion of strictly pathotrophic fungi remained low, suggesting overall stability in fungal functional composition. However, the TRP treatment led to a marked increase in pathotroph-saprotroph-symbiotroph fungi, which may be attributed to the selective effects of glucosinolates and their hydrolysis products (e.g., isothiocyanates) in rapeseed residues. These compounds may inhibit fungi with single trophic modes while favoring multifunctional taxa capable of tolerating or utilizing such substrates [47].

5. Conclusions

This study systematically evaluated the effects of three green manure intercropping models—alfalfa (Medicago sativa, TAL), rapeseed (Brassica napus, TRP), and ryegrass (Lolium perenne, TRG)—on tea plantation ecosystems. The results demonstrated that green manure intercropping significantly enhanced tea yield, improved soil fertility, increased soil enzyme activities, and optimized soil microbial community structure and diversity. Among all treatments, intercropping with alfalfa (TAL) showed the best overall performance, with the most substantial increases in bud density, hundred-bud weight, and seasonal yields. TAL also led to the greatest improvements in soil organic matter, total nitrogen, alkali-hydrolyzable nitrogen, and microbial diversity. Microbial analysis revealed that the TAL treatment significantly enriched functional taxa such as Planctomycetota and Mucoromycota, which are closely involved in nutrient cycling, and exhibited the highest OTU counts and diversity indices. This study demonstrated that intercropping tea with green manure significantly improved tea yield, soil fertility, and microbial diversity, with alfalfa showing the greatest overall benefits. These findings highlight the potential of leguminous green manure for sustainable tea plantation management in subtropical red soils. However, the study was limited to a two-year field experiment in one region, and longer-term trials across diverse tea-growing areas are needed to validate the broader applicability of the results. Future research should also investigate the underlying carbon and nitrogen cycling processes to better understand the ecological mechanisms of green manure in tea systems.