Severely Symptomatic Cucurbits in Croatia Dominantly Harbor a Complex of Potyviruses Including the Emerging Moroccan Watermelon Mosaic Virus

Abstract

Potyviruses (family Potyviridae, genus Potyvirus), including emerging ones, pose a growing threat to cucurbit production. This study presents the first virome analysis of severely symptomatic cucurbits in continental Croatia, combining high-throughput sequencing (HTS) and RT-PCR diagnostics. Zucchini, cucumber, and butternut squash plants with severe virus-like symptoms sampled in 2021–2022 were found to consistently host a complex of potyviruses, including watermelon mosaic virus (WMV), zucchini yellow mosaic virus (ZYMV), and Moroccan watermelon mosaic virus (MWMV)—the latter being newly reported in Croatia and representing likely its northernmost detection in Europe. Phylogenetic analysis classified WMV isolates as emerging strains of subgroup EM3 and ZYMV as subgroup A1, consistent with European lineages. Croatian MWMV isolates formed a distinct subclade within the Mediterranean group, raising questions about its diversification trajectory. The findings highlight the expanding range of MWMV and underscore the value of HTS for early detection of emerging threats. These results have critical implications for cucurbit disease management, indicating the need to re-evaluate resistance claims in commercial cultivars and implement stricter phytosanitary surveillance in Croatia. The potential role of climate change in facilitating virus spread via aphid vectors is discussed, warranting further risk assessment and international monitoring efforts.

1. Introduction

Cucurbits (family Cucurbitaceae) are amongst the most important vegetable crops worldwide. Their global production in 2023 was estimated to be 233,257,475 t from the cultivation area of 8,157,592 ha [1]. In Croatian agriculture, cucumber (Cucumis sativus L.), melon (Cucumis melo L.) and watermelon (Citrullus lanatus L.) production was estimated at 40,159 t in 2023 and 41,886 t in 2024 [2]. In addition, zucchini (Cucurbita pepo L.) is also grown in Croatia for fresh consumption, while different pumpkin species (Cucurbita sp.) are mainly used for seed oil production. The latter is of great traditional and economic importance in Međimurje, the northernmost part of Croatia, and watermelon production has the same status in the river Neretva Valley, agriculturally the most important part of the southernmost Dubrovnik-Neretva county [3]. One of the greatest challenges in profitable production of cucurbit crops is diseases, of which viruses play an increasingly important role [4], also endangering sustainability and food security [5]. The importance of viral diseases in food production is also highlighted by the fact that many of them are included in the list of quarantine or regulated non-quarantine pests of the European Union [6]. To date, more than 90 viruses are identified in cucurbits [7]. The causal agents of cucurbit viral diseases are classified into genera Begomovirus, Crinivirus, Cucumovirus, Polerovirus, Orthotospovirus, Ipomovirus, Tobamovirus and Potyvirus [8,9,10,11]. Some of them are quarantine viruses or regulated non-quarantine viruses, but not in cucurbits [6]. The only regulated quarantine virus in cucurbits is tomato leaf curl New Delhi virus (ToLCNDV), an emerging begomovirus [6].

Thanks to the application of high-throughput sequencing (HTS) in recent times, cucurbits were confirmed as suitable hosts for viruses known in other hosts and new viruses were discovered for the first time in cucurbits [12,13,14]. Despite the efforts, HTS based on short reads (e.g., on Illumina platforms) is still not routinely used in plant virus screening, probably due to the complexity of the procedures for obtaining and processing data and still higher costs. Apparently more accessible metagenomic analysis with longer read outputs are possible using Oxford Nanopore Technologies (ONT) platform nanopore sequencing, which probably makes it more suitable for plant virus diagnostics [15,16]. Regardless of the HTS platform, this methodology provides unbiased virus detection and identification. An international framework and guidelines have been established for efficient and safe HTS usage [17,18] and it has been gaining traction in plant virus diagnostics. There is an increasing number of studies in cucurbitaceous host viruses investigated by ONT [19,20,21,22].

In the cucurbit plants of the Mediterranean growing regions, at least 28 different viruses have been detected so far, of which potyviruses (family Potyviridae, genus Potyvirus) are considered to be amongst the most damaging and some of those most frequently occurring in single or multiple infections [10,11]. Potyviruses are monopartite linear positive-sense single-stranded RNA (+ssRNA) viruses with genome sizes of 9.7–11 kb enclosed in 680–900 nm long and 11–13 nm wide filamentous particles [23]. They are mechanically transmissible pathogens of at least 59 plant families [24] and non-persistently transmissible by different aphids in nature. Amongst 214 viruses classified into the genus Potyvirus to date, at least 35 have been detected in cucurbits globally [23,25].

Insects serve as major vectors of plant pathogens, encompassing phytoplasmas, other bacteria, and viruses, including potyviruses. Aphids represent the most prolific group of virus vectors collectively responsible for the transmission of over 275 plant virus species [26]. Numerous studies have demonstrated that climate change, particularly rising temperatures, significantly affects aphid biology and population dynamics [26,27,28,29,30,31,32]. Increases in aphid populations are strongly associated with an elevated risk of epidemics caused by aphid-transmitted viruses.

Watermelon mosaic virus (WMV, Potyvirus citrulli) infects at least 170 plant species from 27 families, including economically important crops and ornamental plants such as pea, carrot, cotton, coriander, orchids (Vanilla fragrans, Habenaria radiata), crape myrtle and cucurbits [33,34,35,36,37]. It was first described in 1963 in Israel [38]; nonetheless, WMV has a worldwide distribution and occurs frequently in most European countries [11], including Croatia [39,40]. Its symptoms can be expressed differently in cucurbit plants depending on the plant host species, environmental factors and WMV strain [41]. Classical (CL) groups G1, G2 and emerging (EM) group G3 of WMV isolates are recognized based on the phylogenetic analyses of its coat protein (CP) gene [42] or nuclear inclusion b (NIb)/CP region [43,44,45]. Since the discovery of WMV EM isolates in France in 2000, severe symptoms of mosaic and mottling in cucurbits have been associated with this group of proposed Asian origin and the virus has become perceived as an important adverse factor in European cucurbit cultivation [11,46,47]. Besides in France, different EM isolates have been found as yet in Poland [48], Turkey [49], Italy [43] and Spain [11]. Outside of Europe, EM isolates were also found in squash in Argentina, as well as in different cucurbits and Palmer amaranth in the USA [45,50].

Zucchini yellow mosaic virus (ZYMV, Potyvirus cucurbitaflavitesselati) is often found in cucurbits in a mixed infection with WMV and even their synergistic relationship was suggested [51]. Unlike WMV, ZYMV has a more restricted host range limited to the plants of the family Cucurbitaceae as main hosts. Nonetheless, it has been found in cultivated plants of the families Solanaceae and Fabaceae, as well as in some ornamental plants and weeds belonging to different families [52,53]. First identified in 1973 and described in 1981 in Italy [54], ZYMV is still considered to be one of the most dangerous cucurbit viruses, causing great losses in production worldwide [55]. In addition to mechanical and aphid transmission, the proven possibility of seed transmission probably contributes to its global occurrence and distribution [56]. ZYMV has been reported so far from Croatia [39,40], as well as from 18 other Mediterranean countries [8]. Similarly to WMV, several ZYMV phylogenetic groups can be delineated and emerging isolates originating from Asia were identified and characterized. They are members of the phylogenetic group A, subgroups A4 and A5 [44]. In Europe, emerging ZYMV isolates have been recorded in France and Poland [57,58]. In addition, Asian isolates from ZYMV group C have been found in Poland. They cause even more severe symptoms in cucurbits than the emerging group A isolates, including stunting [58]. Despite the fact that Asian ZYMV isolates have not yet been reported from other Mediterranean countries [8], their possible spread across Europe is a real concern due to the symptom severity.

Moroccan watermelon mosaic virus (MWMV, Potyvirus citrullimoroccense) is considered as an emerging virus for cucurbit crops in Southern Europe [59,60]; however, its status still has not been regulated officially [53]. Based on the biological and serological characteristics analyzed for the first time in Morocco in 1974, the virus was initially described as a strain of WMV and tentatively named WMV-2, causing severe deformations, blistering and chlorosis of cucurbits fruits and leaves [61]. Subsequent serological and peptide profile analyses confirmed MWMV as a distinct species [62,63], while phylogenetic studies classified it as a member of the papaya ringspot (PRSV) potyvirus subgroup [64,65]. MWMV has a narrow host range with cucurbits as main hosts, but it was also reported in papaya (Carica papaya L., Caricaceae) from the Democratic Republic of Congo [66] and Kenya [67]. Three MWMV phylogenetic groups correlating with the geographical distribution have been recognized so far: Western and Central African (includes isolates from Niger, Cameroon and the Democratic Republic of Congo), Southern African (isolates from Swaziland and South Africa) and the Mediterranean group. The latter comprises isolates from Morocco, Tunisia, Greece, Italy, Spain and France [68]. Additionally, MWMV was detected in Eastern Sudan [59], Portugal, Zimbabwe, Canary Island [64], Tanzania [69], Nigeria [70], Iran [71], Kenya [67,72], Turkey [73], Burkina Faso [72], Benin [74] and Brazil [75].

In Croatia, besides aphid-transmitted cucumber mosaic virus (CMV, Cucumovirus cucumerae), two different potyviruses (WMV and ZYMV) have been found to infect zucchini and pumpkin plants so far by using serological methods [39,40]. In this study, we employed different metagenomic analyses of viromes present in several severely symptomatic cucurbits. In zucchini, cucumbers and pumpkin plants, the virus identification was also performed by RT-PCR and Sanger sequencing. Phylogenetic analyses were performed for ZYMV, WMV, and MWMV and nearly full genomes were reconstructed for WMV, as well as for several MWMV isolates as main cucurbit virome constituents. MWMV was detected for the first time in cucurbits from Croatia in single or mixed infections with WMV and ZYMV.

2. Materials and Methods

2.1. Plant Material

From the surroundings of the town of Pitomača (Supplementary Figure S1) in the Virovitica-Podravina County of Croatia, fruits and/or leaves with virus-like symptoms were collected during two consecutive vegetative seasons (2021 and 2022) from different cucurbit plants (

Table 1. Cucurbit samples collected in Croatia and used in viral genome studies.

Year of Collection	Sampling Location, Croatia	Sample Name	Cucurbit Species	Plant Material
2021	Pitomača	T1	Cucurbita pepo ‘Naxos F1’	fruit skin
	Pitomača	T2	Cucurbita pepo ‘Naxos F1’	fruit skin
	Pitomača	T3	Cucurbita pepo ‘Naxos F1’	fruit skin
	Stari Gradac	T4	Cucurbita pepo ‘Naxos F1’	fruit skin
	Pitomača	T5	Cucurbita pepo ‘Naxos F1’	fruit skin
	Pitomača	T6	Cucurbita pepo ‘Naxos F1’	fruit skin
2022	Sedlarica	74SECu22S	Cucumis sativus ‘Salatar’	leaves
	Sedlarica	96SECu22S	Cucumis sativus ‘Salatar’	leaves
	Sedlarica	97SECu22S	Cucumis sativus ‘Salatar’	leaves
	Sedlarica	101SECu22S	Cucumis sativus ‘Salatar’	leaves
	Sedlarica	102SECu22S	Cucumis sativus ‘Salatar’	leaves
	Sedlarica	125SEZ22S	Cucurbita moschata	leaves
	Sedlarica	150SECu22S	Cucumis sativus ‘Salatar’	leaves
	Sedlarica	152SECu22S	Cucumis sativus ‘Salatar’	leaves

). Virus-like symptoms comprised mosaic, deformations and lumpiness of zucchini fruits, curling, deformations, mosaic, yellowing and necrosis of cucumber leaves, deformations, streaking and necrosis of cucumber fruits, as well as mosaic and vein yellowing of butternut squash leaves (Figure 1). In the first year, six field grown zucchini plants (C. pepo ‘Naxos F1’) were collected (samples labeled T1-T6) from different growers and localities in the area. Even though the exact coordinates were not taken during that sampling, Stari Gradac, a village near the town of Pitomača (45°54′23.7″ N, 17°11′52.0″ E), was recorded as one of the localities (45°55′29.33″ N, 17°17′31.9″ E) for at least one zucchini sample (T4). In the second year, six cucumber plants (C. sativus ‘Salatar’) grown under greenhouse conditions from one grower at the locality Sedlarica (45°54′23.0″ N, 17°12′0.5″ E) were selected for analyses (samples labelled: 74SEC22S, 96SEC22S, 97SEC22S, 101SEC22S, 102SEC22S, 150SEC22S and 152SEC22S). In addition to cucumbers, one field-grown butternut squash (125SEZ22S) was sampled in the same year in Sedlarica (Table 1). Collected plant material was stored at −20 °C until use for analyses.

2.2. Virus Pre-Screening by Immunostrips

Due to the limitations of this study, the pre-screening of a smaller symptomatic plant subset was performed, choosing plants representative of the symptom severity and type. Fresh tissue was pre-screened on the day of the sampling, or the following day, in the laboratory by immunostrips according to the manufacturers’ instructions except for samples T1-T4. They were received to the laboratory as frozen fruit tissue strips and only T4 was pre-screened. Hence, a combination of tests for CMV, impatiens necrotic spot virus (INSV), tobacco mosaic virus (TMV) and tomato spotted wilt orthotospovirus (TSWV) were performed by ImmunoComb for CMV, INSV, TMV, and TSWV (Agdia, Elkhart, IN, USA) for samples T4, 74SEC22S, 102SEC22S, and 125SEZ22S. Individual immunostrips were used additionally for testing the potyvirus group pathogens, as well as for emerging viruses: pepper mild mottle virus (PMMoV) from Tobamovirus genus (ImmunoStrip for Poty group and PMMoV, respectively, Agdia, Elkhart, IN, USA) and regulated tomato leaf curl New Delhi virus (ToLCNDV) belonging to Begomovirus genus (AgriStrip for ToLCNDV, Bioreba, Reinach, Switzerland).

2.3. Nucleic Acid Extraction

Two different types of nucleic acid extraction from cucurbit samples were performed. Total nucleic acids (TNA) were extracted from 500 mg of fruit skin or leaf tissue using a CTAB-based method with a buffer containing 2% PVP and the omission of 2-mercaptoethanol [76]. For the confirmation of HTS results by RT-PCR, RNA extraction was additionally performed from 200 mg of frozen tissue by using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Purity and concentration of extracted nucleic acids were measured by using Nanodrop 2000c Spectrophotometer (Thermo Fischer Scientific, Waltham, MA, USA).

2.4. High-Througput Sequencing

2.4.1. ONT Sequencing Preparation and Data Analyses

One representative zucchini sample (T3) was pooled with five unrelated samples for Nanopore sequencing (Oxford Nanopore Technologies, Oxford, UK). After rRNA depletion (RiboMinus Plant Kit for RNA-Seq; Invitrogen, Carlsbad, CA, USA) and polyA tailing, libraries were prepared for Nanopore sequencing by using cDNA-PCR kit (SQK-PCS109 version PCS_9085_v109_revK_14Aug2019, Oxford Nanopore Technologies, Oxford, UK) and sequencing was performed in MinION flow cells (FLO-Min106 R9.4 version; Oxford Nanopore Technologies) and a MinION MK-1C device.

The ONT generated fast5 files were basecalled using a super accuracy model with Guppy basecaller (v.2.2.3), available to Oxford Nanopore Technology customers via the ONT community site. The ONT MinION read quality was assessed using the FastQC tool [77] (v.0.12.1). The Nanofilt tool [78] (v.2.8.0) was used to remove adapters and filter reads, while Canu [79] (v.2.2) was used to assemble the genomes from the obtained reads. Reads were subsequently aligned to reference viral genomes using Minimap2 (v.2.17) against the Kraken2 viral genome sequence database (v2.1.2). Candidate viral contigs were later confirmed by homology search using BLASTn and BLASTp against the standard NCBI nucleotide (nt) database (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed 14 January 2023).

2.4.2. Illumina Sample Preparation and Data Analysis

Illumina standard RNA-Seq using Illumina NovaSeq 6000 platform (2 × 150 base pairs (bp) configuration) was performed by a service provider (Genewiz, Leipzig, Germany) along with library preparation (Illumina kit) and rRNA depletion (QIAseq FastSelect-rRNA Plant Kit, Qiagen, Hilden, Germany). One symptomatic zucchini (T5) and one cucumber sample (102SEC22) representative of the type and severity of symptoms observed in the field in the seasons 2021 and 2022, respectively, were sequenced this way.

Illumina-generated reads were quality checked using FastQC and trimmed by Cutadapt [80] (v.1.18). Paired-end reads were then merged using FLASh (v.1.2.11). Reads were subsequently aligned to a reference viral genome using BWA-MEM [81], and variant calling and consensus sequence generation were performed using SAMtools and BCFtools [82,83]. Illumina-generated reads were also mapped against the Kraken2 database and BLASTn and BLASTp confirmed as ONT reads described above.

2.4.3. HTS Result Confirmation and Detection by RT-PCR

Confirmation of HTS results and the detection of individual viruses were performed by RT-PCR using OneStep RT-PCR Kit (Qiagen, Hilden, Germany), following manufacturer’s instructions. Previously known primers for WMV, ZYMV and MWMV were used, covering the CP or NIb/CP regions (

Table 2. List of primers used for RT-PCR detection of WMV, ZYMV and MWMV in cucurbits.

Virus	Primer Name	Orientation	Sequence 5′-3′	Region	Product Size (bp)	Reference
WMV	WMV-For	forward	GAATCAGTGTCTCTGCAATCAGG	CP	825	[84]
	WMV-Rev	reverse	ATTCACGTCCCTTGCAGTGTG
ZYMV	ZY-2	forward	GCTCCATACATAGCTGAGACAGC	NIb and CP	1200	[85]
	ZY-3	reverse	TAGGCTTGCAAACGGAGTCTAATC
MWMV	MWMV-5	forward	AGCAAGCGCCATACTCTGA	NIb and CP	627	[60]
	MWMV-3	reverse	CAAACTCCATTAACATTCGG

). Reactions were carried out in ProFlex PCR System (Thermo Fisher Scientific, Waltham, MA, USA), using conditions as follows: reverse transcription at 50 °C for 30 min, denaturation of reverse transcriptase and hot-start polymerase activation at 95 °C for 15 min, 35 cycles of denaturation at 94 °C for 30 s, annealing (at 64 °C for WMV), 63 °C for ZYMV or 54 °C for (MWMV) 30 s and elongation at 72 °C for 1 min. Final extension step was performed at 72 °C for 10 min. Five microliters of each PCR product were analyzed by horizontal electrophoresis in 1.5% agarose gel, with the addition of StainIN™ GREEN Nucleic Acid Stain (HighQu GmbH, Kraichtal, Germany) according to the manufacturer’s instructions, and visualized in Amersham™ ImageQuant 800 (Cytiva, Marlborough, MA, USA).

2.5. Phylogenetic Analyses

After PCR, products were bidirectionally Sanger sequenced at Macrogen Europe (Amsterdam, The Netherlands). Sequences were examined and edited by using Bioedit 7.7.1. [86] and consensus sequences were obtained using MEGA11 [87]. In addition, obtained sequences were compared with all sequences in the NCBI GenBank database (accessed during October 2023) via BLASTx, to provide virus identification. Newly obtained sequences of Croatian viral isolates (Supplementary Table S1), together with worldwide isolates retrieved from GenBank (Supplementary Tables S2–S4), were used to build phylogenetic trees. Neighbor-Joining (NJ) statistical method [88], 1000 bootstrap repeats and nucleotide substitution model based on the lowest score of Bayesian information criterion (BIC) were used. Identity scores between isolates were obtained based on nucleotide sequences using p-distance model in MEGA11, while distance matrices of nucleotide (nt) and amino acid (aa) comparison were created via Sequence Demarcation Tool ver. 1.2 [89].

2.6. Recombination Analysis

In order to detect any potential recombination event and patterns in sequence alignments used for the construction of phylogenetic trees, we utilized Recombination Detection program version Beta 5.67 (RDP5) [90]. The analysis was performed by seven different detection algorithms included in RDP5: RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan, and 3Seq. Recombination events predicted by four or more methods at a probability value (p-value) threshold of 0.05 were considered a proof of a putative recombination event. Recombination events that were marked as potential false positives, by the program itself while exporting the data, were discarded.

3. Results

3.1. Pre-Screened Viruses

ImmunoComb for CMV, INSV, TMV, and TSWV (Agdia, Elkhart, IN, USA) revealed the presence of TMV and TSWV in cucumber 102SEC22S and TMV in pumpkin 125SEZ22S, whilst individual ImmunoStrip (Agdia) or AgriStrip (Bioreba) testing revealed the presence of potyviruses in both of these samples, plus in the sample T4 of zucchini and another cucumber sample (74SEC22S). The emerging ToLCNDV was not recorded in this preliminary screening, whilst the cucumber sample 102SEC22S harbored PMMoV; however, the latter was not confirmed by RT-PCR, indicating possible cross-reactivity with TMV in immunostrips or cross-contamination in pre-screening.

3.2. Metagenomic Results

Sample T3, sequenced using the ONT platform, yielded a total of 80,200 reads, out of which 238 were successfully assembled. The average mapped read length was 760.333 bp. The mean sequencing depth was relatively low at 0.988×, resulting in only 2.94% coverage of the viral genome. In contrast, sample T5 and 102SEC22 generated a substantially higher total of 10,559,780 and 9,354,755 reads, respectively, with 2,049,672 and 1,964,634 reads assembled.

The mean length of mapped reads was 134.974 bp for T5 and 98.765 bp for 102SEC22, characteristic of Illumina short-read sequencing. The data for sample T3 produced a high sequencing depth of 27,981.3×, which allowed for 15.45% coverage of the reference viral genome. For the 102SEC22 sample, 17,115.5× sequencing depth allowed for 4.22% coverage of the reference viral genome.

3.3. HTS and RT-PCR Identification of Cucurbit Virome Constituents

HTS revealed a mixed infection with WMV and MWMV in the zucchini plant T3, while T5 harbored a triple potyvirus complex including WMV, ZYMV and MWMV. Metagenomic analysis also indicated the presence of cucurbit aphid-borne yellows virus (CAYV, genus Polerovirus) in T5. However, we could not reconstruct its complete genome possibly due to a low viral load in this metagenomic sample. Therefore, this virus, known to be a constituent of the cucurbit viromes without affecting fruit quality [10], was excluded from further analysis of this zucchini with severely symptomatic fruits.

In both zucchini samples potyvirus was the most abundant genus, covering about 50% (T5) or 44% (T3) of the virome (Figure 2). Cucumber plant 102SEC22S, with symptoms similar to those in 96SEC22S (Figure 1B,C), sampled in the following year at about 10 km distance from the zucchini fields also harbored a triple virus complex, including potyviruses MWMV and PVY, as well as an orthotospovirus (TSWV). Based on the sequencing data, we managed to partially assemble the MWMV genome from the T3 sample, with total coverage of 2141 bp (OQ729739). From samples T5 and 102SEC22, nearly complete MWMV genomes, with the exception of poly A tail, were assembled (OQ729737 and OQ729736, respectively) and they shared 99% nt identity. Also, from sample 102SEC22, nearly complete genomes of PVY (OQ534355) and TSWV (OQ534346-OQ534348 for S, M and L segments, respectively) were assembled. PVY from this cucumber sample shared the highest nt identity of 99.89% in nBLAST with other Croatian PVY isolates: 86DOW22S (acc. no. OQ534354) from Amaranthus blitum weed growing next to a tomato greenhouse sampled about 100 km northwest in Domašinec [91] and from a tomato PVY-NTN isolate 61SET21S (acc. no. ON505008, 99.23% nt identity) grown in a neighboring greenhouse of the same Sedlarica locality [92]. The TSWV isolate identified from cucumber 102SEC22 in this study had the highest nt identities per genome segments, 99.76 (S), 99.98 (M) and 99.99% (L), with the same A. blitum weed and tomato (105DOT22S, acc. nos. OQ507121-OQ507123) TSWV accessions from the above-mentioned remote locality of Domašinec. The weed and tomato samples from Domašinec, on the other hand, did not harbor any of the potyviruses recorded in cucurbits from this study [91]. All sequences obtained by HTS in this study were deposited in the NCBI GenBank and SRA (PRJNA946736). Their NCBI GenBank accession numbers are available in Supplementary Table S1.

In the RT-PCR experiments from samples collected in 2021, the symptomatic zucchini samples T3, T4 and T6 were confirmed to be infected with two potyviruses WMV and MWMV, while T1, T2 and T5 zucchini confirmation results included amplicons resulting from all three potyviruses (WMV, MWMV and ZYMV), as evidenced from the virome study (Supplementary Table S5). From the 2022 collection year, three cucumber samples (96SEC22S, 97SEC22S, 101SEC22S) tested positive only for MWMV, while the other three samples (74SEC22S, 102SEC22S, 150SEC22S) tested negative for the potyviruses investigated. Potyvirus complex WMV + MWMV was again found in the butternut squash (125SEZ22S) and one cucumber (152SEC22S) sample (Supplementary Table S5). Overall, RT-PCR performed for targeted detection of WMV, ZYMV and MWMV in individual samples of cucurbits (three subjected plus those not subjected to HTS) allowed for the detection of WMV in 6 out of 6 zucchini plants collected in 2021 (100.0%), in 1/7 (14.3%) cucumbers from 2022, as well as in the sole butternut squash sample. In contrast, ZYMV was confirmed only in 50.0% of the zucchini plants (3/6), but not in cucumber and butternut squash samples. Similar to WMV, MWMV was confirmed in all zucchini and the sole butternut plant sample while a higher infection rate was revealed for cucumbers (4 out of 7 tested, or 57.1%). As for mixed infections, all six zucchini plants were infected with at least WMV and MWMV, while in three of them the presence of ZYMV was also confirmed (Supplementary Table S5). In cucumbers, three tested plants were singly infected with MWMV, while one plant was co-infected with WMV and MWMV, as well as the butternut squash (Supplementary Table S5). Newly discovered MWMV isolates in this Croatian study further expand the geographical distribution of the virus in Europe and globally (Figure 3).

Regardless of their virome status, all cucumbers and zucchini plants analyzed here showed similar symptoms, especially in fruits (Figure 1). In three out of seven cucumber plants showing similar severe symptoms as plants wherein viral presence was confirmed (74SEC22S, 102SEC22S, 150SEC22S), we could not confirm the three potyviruses by RT-PCR; however, two out of those samples (74SEC22S and 102SEC22S) were pre-screened by immunostrips and turned positive in generic potyvirus testing.

3.4. Phylogenetic Analyses Results

3.4.1. WMV

Phylogenetic analyses of the WMV CP region [84], based on the nucleotide (nt) sequences of eight WMV isolates from this study and globally distributed isolates chosen from NCBI GenBank database (Supplementary Table S2), revealed three main phylogenetic groups, as previously reported [44]. All Croatian isolates were grouped together with a high bootstrap value into subgroup EM3 of group 3 (Figure 4). This group also comprises French, Polish and Asian isolates (Chinese, Korean) representing emerging isolates (EM) [44].

The distance matrix of the 714 nt sequences analyzed here [84] showed identity rates in the range from 97.3% to 100% for Croatian WMV isolates (Supplementary Figure S2), while their highest percentage of nt identity (96.9–99.3%) was with the South Korean isolate from melon (AB369278) belonging to the same subgroup. The lowest nt identities (91.2–92.9%) were observed in comparison with the isolate CHI87-620 (EU660580) from Chile, belonging to group 2. The second most divergent isolate in comparison to those from this study was isolate A08-170 (JF273466) originating from French zucchini, with nt identity range of 91.3–93.3% (Supplementary Figure S2). This French accession, considered as an emerging isolate from subgroup EM2 (Figure 4), is actually an EM1/EM2 recombinant [93].

3.4.2. ZYMV

Phylogenetic analyses for the NIb/CP sequence of ZYMV [85] isolate from zucchini T5 (T5_Z, OQ405090, Figure 5) from this study and worldwide distributed isolates chosen from GenBank (Supplementary Table S3) revealed previously delineated [44] phylogenetic groups A, B and C (Figure 5). The Croatian isolate was grouped in subgroup A1 under group A, with most of the other European isolates representing non-emerging strains from geographically near countries.

The most similar ZYMV isolates to the newly characterized Croatian isolate T5_Z (OQ405090) from A1 subgroup were isolates H (KF976712) from the Czech Republic, SE04T (KF976713) from Slovakia and Austria 2 (AJ420012), sharing 99.9% or 1081 out of 1082 nucleotides analyzed. Despite this high similarity in the NIb/CP region, the Czech isolate was previously determined as a severe strain and the Slovak isolate as a mild strain in their natural squash (C. pepo) host based on the symptom expression and divergence in the aa position 917 in P3 protein [94]. In contrast, the most divergent isolate in this comparison was ZYMV C-16 (DQ645729) from a melon in Spain, with 93.3% nucleotides shared, while the overall nt identity range for the A1 subgroup was estimated to be 93.3–99.9%. Outside of subgroup A1, T5_Z was the most similar to isolate BR2 (MH042025) from South Korea (95.1%) belonging to the A4 subgroup, representing an emerging strain. The most divergent to isolate T5_Z was ZYMV-VN/Cs1 (DQ925449) from Vietnam (82.2%), belonging to group B (Figure 5, Supplementary Figure S3).

3.4.3. MWMV

Regardless of the type of analysis (NIb/CP region or nearly complete genome), MWMV isolates studied here are clustered into three previously recognized phylogenetic groups [65]. They were clustered into the Mediterranean group together with other isolates originating from the Mediterranean countries (Figure 6 and Figure 7), as well as a recently discovered BR isolate (LC775353) from Brazil. Interestingly, in the NIb/CP genome region, Croatian isolates form a separate branch of the Mediterranean group, supported by a high bootstrap (99%) value (Figure 6).

Distance matrix analyses of the 476 nt sequences (Supplementary Table S4) in the NIb/CP region [60] showed nt identity rates of 98.7–100% among Croatian isolates (Supplementary Figure S4). Identities amongst isolates in the Mediterranean group were in the range of 93.5–100%, with the greatest difference between Croatian isolates T3 (acc. no OR146192) and T6 (acc. no. OR146195) and isolate Yoz2.ESS (MW362136) from Turkey. Croatian isolates are the most similar to isolates from Spain (96.2–96.6%), Morocco (96.2–96.4%), Italy (96.2–96.4%), and the most divergent from isolate Su-94-54 (AF307778) from Sudan (65.0–65.2%). This Sudanese isolate is considered as a strain of MWMV, but possibly also as an evolutionary intermediate between MWMV and PRSV [59]. With nt identity scores of 86.3–89.1%, isolates from the Mediterranean group are more similar to isolates from the Southern African group than to isolates from Western and Central African groups, whose identity score range is 77.7–85.7% (Supplementary Figure S4). Obtained results of nt identity rates were equivalent to results of identities obtained using distance matrix based on 158 aa sequences (Supplementary Figure S5).

3.5. Recombination Analysis Outcome

RDP5 analysis performed on the aligned sequences used for the construction of phylogenetic trees for each virus did not reveal any putative recombination events in sequences obtained in this study. However, it did reveal several putative recombination events in sequences obtained from the GenBank database used in the construction of phylogenetic trees for ZYMV, WMV and MWMV with complete genomic sequences (Supplementary Table S6).

4. Discussion

Potyviruses represent the biggest and one of the most important genera of plant viruses [24]. At least 15 different potyviruses have been recognized so far as pathogens adversely affecting cucurbits. In the Mediterranean region, some of them represent emerging viruses associated with severe symptoms [8,10]. Chemical plant protection products are ineffective in preventing or controlling viral diseases. Consequently, the cultivation of resistant, less susceptible, or tolerant cultivars remains the cornerstone of integrated virus disease management in cucurbits [95]. In Croatia, the presence of CMV, ZYMV and WMV was confirmed previously in field conditions in several zucchini cultivars marketed as tolerant, such as Naxos F1, Brilliante F1, Galatea F1, Tendor F1, and Sofia F1 [40]. This observation, together with the MWMV consistently detected in this study in severely affected zucchini Naxos F1, and cucumbers, with completely unmarketable fruits, prompts critical questions regarding the validity of declared resistance levels, at least in zucchini cultivars. It also raises the question of possible shifts in vector biology and activity, frequently reported in global studies, that may be contributing factors to the observed susceptibility. Supporting these projections in a comprehensive review, Skendžić and coworkers emphasized that global warming is likely to intensify aphid outbreaks and trigger earlier seasonal migrations [96]. These shifts could allow aphid populations to reach damaging densities earlier in the growing season, thereby extending the period during which virus transmission to crops occurs.

So far, (re)emerging MWMV has been reported from seven Mediterranean Basin countries: Morocco, Tunis, Portugal, Spain, France, Italy, Greece and Turkey. Notably, this MWMV report from continental Croatia reinforces its emerging character and potential adverse impact for vegetable production outside the Mediterranean climatic zone (Figure 3). The observation of unusual and severe symptoms in the field, such as severe mosaic, dark-green fruit blistering, deformations and necrosis, preceded its detection and reporting [60,61,97]. Such symptoms in field cucurbits, recorded in other European and African countries, were observed in our study as well (Figure 1). There was no visible difference in the type and severity of symptoms between three zucchini plants infected with the potyvirus complex of WMV + ZYMV + MWMV and three plants co-infected with WMV + MWMV. Similarly, cucumbers singly infected with MWMV displayed similar symptoms as those co-infected with MWMV + WMV, or with MWMV in complex with PVY and TSWV (Figure 1, Supplementary Tables S1 and S5). It is thus tempting to assume that the expression of symptoms in cucurbits from this study may mostly be influenced by MWMV. However, further biological tests would be needed to unequivocally demonstrate this, similar to those performed in France [61] and Greece [97]. There were several severely symptomatic cucumber samples in this study (74SEC22S, 102SEC22S, 150SEC22S) wherein RT-PCR did not confirm the presence of the three investigated potyviruses in repeated experiments. Nonetheless, in two of them (74SEC22S, 102SEC22S) pre-screening with generic potyvirus group immunostrips was positive, suggesting the presence of at least one potyvirus, and in one of them (102SEC22S), the metagenomic analyses were able to identify the presence of MWMV, PVY and TSWV (Supplementary Table S1). The remaining symptomatic cucumber sample 150SEC22S unfortunately could not be subjected to HTS within a limited budget. With unconfirmed viral presence by pre-screening and RT-PCR in this sample, the etiology of its severe symptoms remains a matter of speculation. It could have harbored yet untested virus(es), or masked the presence of the virus, known to happen during hot periods [98], because the sampling was performed late in the season (24 August 2022) at the end of a very hot summer.

The two zucchini (T3 and T5) and one cucumber (102SEC22S) samples representative of the symptom type and severity subjected to HTS revealed complex viromes and enabled the assembly of nearly complete viral genomes, mostly from Illumina reads (Figure 2, Supplementary Table S1). Besides the expected abundance of phage contigs, potyviral dominated in the T3 and T5 overall datasets, and particularly in plant virus-related datasets. Even though the MWMV genome was only partially assembled from T3 reads (acc. no. OQ729739), it contained the NIb/CP region, enabling its nBLAST comparison with the corresponding T3 Sanger sequence (acc. no. OR146192) and confirming it was 97% identical. However, WMV found by RT-PCR in this sample could not be identified in HTS. On the other hand, the HTS data from T5 zucchini provided a nearly complete MWMV genome (acc. no. OQ 729737) but not the genomes of the other WMV and ZYMV identified by RT-PCR (Supplementary Tables S1 and S5). Additionally, the severely symptomatic zucchini fruit T5 dataset revealed a big portion of polerovirus reads. Those were not assembled but could potentially belong to CAYV, a cucurbit virus known not to affect the fruit quality [10] and thus not investigated further here. Nevertheless, more extensive research is needed to fully comprehend the diversity of viruses infecting zucchini, and other cucurbits, in Croatia. The testament to that is the cucumber sample 102SEC22S that, besides MWMV, had only several percents of potyviral Illumina reads, from which a PVY isolate nearly complete genome was assembled (acc. no. OQ534355). It was very similar to PVY-NTN isolates from tomatoes in Sedlarica [92] as well as from weed and tomato hosts in the locality of Domašinec about 100 km away [91]. Moreover, orthotospovirus reads were more abundant from this cucumber and revealed a nearly complete TSWV genome (acc. nos. OQ534346-OQ534348) very similar to isolates from the same remote tomato greenhouse agroecosystem [91]. Given the fact that both PVY and TSWV were detected by immunostrips in pre-screening procedures, and cucumber being amongst hosts of both viruses [53,99], we believe that these viruses may have played a role in the cucumber yield loss in the locality Sedlarica in 2022 and that the epidemiological link between cucumber and tomato agroecosystems should be a focus of future studies.

Cucurbit-infecting potyviruses are generally considered as pathogens of warmer climates, such as the Mediterranean Basin, with aphids as their main vectors, preferring a Mediterranean or even tropical climate [8]. Since climate changes favor the movement of aphids to northern areas, farther from their previously reported niche, this could allow easier and faster spread of viruses. This is especially dangerous in the case of emerging viruses or emerging strains of otherwise widespread viruses [10]. WMV, ZYMV and PRSV are long-known potyviruses of cucurbits, hitherto referred to as the most harmful [70,100]. Although widespread in the Mediterranean Basin and neighboring countries [8,101], WMV and ZYMV were reported only recently from Croatia [39,40]. Extensive ELISA study confirmed high incidence of CMV, WMV and ZYMV among zucchini and pumpkin samples collected across Croatia, including coastal (Istria, and Dubrovnik-Neretva) and continental (Međimurje, Varaždin, Sisak-Moslavina and Virovitica-Podravina) counties. The occurrence of WMV was reported in 31.8% (7/22) of samples from the coastal regions and in 1.7% (1/60) of continental region samples, with the detection in only one sample out of seventeen tested (5.9%) from Virovitica-Podravina County where we performed this study. In contrast, ZYMV was not detected in Croatian Mediterranean regions, while in the continental ones it was found to be present in 73.3% (44/60) of samples tested [39,40]. Much higher overall incidence of 57.1% was demonstrated for WMV throughout the two years in Virovitica-Podravina County in this study (Supplementary Table S5) than in the previous ones [39,40], suggesting that it has spread significantly in the last 4–5 years. It is also reasonable to assume that WMV occurs more frequently in the other Croatian continental counties with cucurbit vegetable production.

Croatian WMV isolates obtained in this study were characterized as emerging (EM) isolates of phylogenetic group 3, which is particularly worrying (Figure 4). More severe symptoms caused by emerging isolates of WMV in cucurbits, in comparison to classical (CL) isolates, which only had been present for the previous 30 years in Europe, were first noticed in 1999 in France [42,46]. Only later were the four phylogenetic subgroups recognized among French EM isolates (EM1, EM2, EM3 and EM4) as they became the most prevalent isolates in France over time [46]. As for France, most of the WMV isolates discovered in Spain in recent time were described as EM isolates [11]. In addition to this trend, all eight WMV isolates discovered in this study from Croatia were characterized as EM3 isolates. Lecoq et al. concluded that co-infections with WMV EM-CL isolates occur very commonly in fields and that some EM transmission characteristics favored their better distribution versus CL isolates [47]. EM isolates supposedly have better transmissibility by vectors from mixed CL-EM infections than CL isolates. Also, CL isolates were transmitted with significantly lower frequency from double CL-EM than from single infections. Despite these described European epidemiological scenarios, only WMV EM isolates were found among Croatian isolates in this study, without coinfection with CL isolates. Considering this, but also phylogenetic analyses which confirmed the greatest similarities of Croatian isolates with EM3 isolates from Asia (Figure 4) and no indication of potential recombinants (Supplementary Table S6), it is tempting to assume that Croatian EM3 isolates could have originated from a new Asian introduction rather than from local spread, as already suggested for EM2 and EM3 isolates discovered in France [46]. Nonetheless, this study is performed on a limited number of samples from a small area, possibly introducing bias in the analyses. Only wider studies examining the spread and diversity of WMV could shed light on this epidemiological question.

In contrast to the probable Asian origin of Croatian WMV isolates, phylogenetic analysis of ZYMV in the NIb/CP genome region showed that newly discovered Croatian isolate T5_Z (OQ405090) belongs to the A1 subgroup (Figure 5). According to the literature, A1 strains are the most common among isolates identified in the European and Mediterranean countries, which probably had a common ancestor [44,102]. Hasiów-Jaroszewska and coworkers demonstrated that Polish isolates from the A1 subgroup cause much milder symptoms in mechanically inoculated test plants in comparison to emerging isolates from group A and group C originating from Asia [58]. As we found and characterized a single non-recombinant ZYMV isolate in butternut squash in this study (Figure 5, Supplementary Table S6), the same limitations and possible bias apply as discussed above for WMV.

MWMV was identified in the majority (11 out of 14) of cucurbitaceous plant samples studied here. This is the first report of MWMV in Croatia and the ninth report of this emerging virus from the Mediterranean region countries (Figure 3), and as such, it deserved more scrutiny. Vercelli province in Italy [103] has been so far the northernmost MWMV reported latitude. Unfortunately, the report did not contain the exact geographical coordinates of the infected plants, nor could they be found afterwards [104]. Hence, the coordinates of the city of Vercelli (N 45°19′32.038″, E 8°25′24.459″) as the province center could be used as an orientation point. The type of agro-ecological factors influencing zucchini cultivation in the north of Italy are quite similar to northeastern Croatia and localities encompassed by this study. The triangle Pitomača–Sedlarica–Stari Gradac (45°54′–45°55′ N) is situated more north than Vercelli and thus may represent the northernmost finding of MWMV in the world. In Italy, Roggero et al. assumed the rapid local spread because it had been initially detected in the Latin Province of central Italy (around 41° N) in 1997 and in Vercelli province in the north (45° N) only a year after [103]. The Croatian MWMV isolates share the highest nucleotide identities (around 96%, Supplementary Figure S4) in the NIb/CP region, containing determinants for vector transmission in the CP region [105], with isolates from Italy, Spain and Morocco (Figure 6 and Figure 7) where a natural way of virus dispersal through a vector transmission was suggested.

One key consequence of warmer winters characteristic of global warming is enhanced aphid vector overwintering success in temperate climates, due to shorter cold periods and reduced frequency of frost events. Such conditions allow aphids to extend their annual period of activity and expand their geographical distribution [29]. Harrington et al. reported that for Myzus persicae (green peach aphid transmitting potyviruses and many others), a 1 °C increase in mean winter temperatures (January–February) could advance spring migration by approximately two weeks [27]. Similarly, it was projected that a 2 °C rise in temperature could result in up to five additional aphid generations annually in temperate zones. Consequently, outbreaks of aphid-borne viral diseases are expected to become more frequent and severe under future climate scenarios.

As a large number of aphid species confirmed as virus vectors [106] are known to occur in Croatia [53], similarly as in Italy, it may be expected that the emerging MWMV will spread further north, repeating the Italian scenario [103]. During this process the virus could diversify, probably through host-specific interactions, as already suggested for phylogenetically distant MWMV isolates (Figure 6 and Figure 7) discovered in papaya [72]. During our study, MWMV was confirmed in three different cucurbit species from two consecutive years and within two different growing systems (field-growing and greenhouse) in the same area of northeastern Croatia (Supplementary Tables S1 and S5). This MWMV population contained no potential recombinants (Supplementary Table S6) and formed a distinct subclade in the Mediterranean group. It was homogeneous across different hosts, time and growing conditions (Figure 6), suggesting it diversified as a separate subgroup with a specific timeline and dispersal pattern that could potentially be revealed by further phylodynamics studies. This diversification could have happened via infected plant material from a common pool, and the local virus establishment via aphid transmission. Although considered, seed transmission has not been proven yet as a means of MWMV transmission [103].

Given that MWMV is a relatively new and apparently emerging virus, it is advisable to conduct further research to determine its distribution and harmfulness in Croatia. Based on the obtained results, in cooperation with the Croatian NPPO (National Plant Protection Organisation), a Pest Risk Analysis is planned, with the possibility of proposing to the EPPO Secretariat to consider including MWMV on the Alert List. (https://www.eppo.int/ACTIVITIES/plant_quarantine/alert_list_intro, accessed on 30 April 2025).

5. Conclusions

This study combines mostly RT-PCR, Sanger sequencing of the amplicons and HTS techniques to identify and characterize the most prevalent viruses in the unmarketable fruits of zucchini in one vegetative season, and other cucurbits, but mostly cucumbers, in the consecutive one. It is somewhat limited in terms of sample number and geography. Even so, it gave us valuable insight into the diversity of cucurbit viruses of crops grown in an important vegetable cultivation zone of northeastern Croatia. Potyviruses seem to play an important part in the viromes linked to the most severe disease symptoms, as they were consistently identified across different host species, seasons and localities. The presence of emerging MWMV and emerging strains of WMV warrant additional research and improvement of cucurbit crop disease management practices.